(Circulation. 1999;100:855-860.)
© 1999 American Heart Association, Inc.
Basic Science Reports |
Aggregating Human Platelets Stimulate Expression of Vascular Endothelial Growth Factor in Cultured Vascular Smooth Muscle Cells Through a Synergistic Effect of Transforming Growth Factor-ß1 and Platelet-Derived Growth FactorAB
From Institut für Kardiovaskuläre Physiologie, Klinikum der JWG-Universität (N.K., A.B., R.B., V.B.S.-K.), Frankfurt am Main and Fachbereich Hämostaseologie, Stiftung Deutsche Klinik für Diagnostik GmbH (S.B., C.M.K.), Wiesbaden, Germany.
Correspondence to V.B. Schini-Kerth, PhD, Institut für Kardiovaskuläre Physiologie, Klinikum der JWG-Universität, Theodor-Stern-Kai-7, D-60590 Frankfurt am Main, Germany. E-mail Schini-Kerth{at}em.uni-frankfurt.de
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Background—Vascular endothelial growth factor (VEGF), an endothelial mitogen and chemoattractant, has been implicated in the recovery of the endothelium after balloon injury. The increased expression of VEGF in vascular smooth muscle cells (SMC) at sites of injury suggests that this cell type may be a major cellular source of VEGF. This study examined whether aggregating platelets stimulate VEGF expression in cultured SMC.
Methods and Results—VEGF expression in SMC was assessed by Northern blot analysis and by reverse transcription followed by polymerase chain reaction and the release of VEGF by Western blot analysis and immunoassay. Platelet-derived products (PDP) released by aggregating human platelets time-dependently and concentration-dependently enhanced VEGF mRNA levels, mainly that coding for the soluble splice variant VEGF165/164, and stimulated the release of VEGF protein. These effects were potentiated by transient acidification of PDP, which release bioactive transforming growth factor (TGF)-ß1, and mimicked by platelet-derived growth factor (PDGF)AB and TGF-ß1 in a synergistic manner. Both a TGF-ß–neutralizing antibody and a PDGF-neutralizing antibody significantly attenuated the effect of acidified PDP on VEGF production.
Conclusions—Aggregating human platelets induce VEGF mRNA expression in cultured SMC and the subsequent release of VEGF protein. This effect can be attributed to a supra-additive action of PDGFAB and TGF-ß1 and may represent a novel mechanism by which platelets contribute to the recovery of the endothelial lining at sites of balloon-injured arteries.
Key Words: platelet-derived factors • angiogenesis • muscle, smooth • arteriosclerosis
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Vascular endothelium is now well recognized to play a fundamental role in the local regulation of vascular tone and homeostasis, in part, by the release of short-lived potent vasoactive autacoids such as nitric oxide and prostacyclin.1 During therapeutic angioplasty, the endothelium of the targeted artery is disrupted and the underlying smooth muscle layer is severely damaged by the balloon catheter.2 As a consequence of the exposure of the subendothelial matrix to circulating blood, an instantaneous local activation of the coagulation cascade and of platelets as well as the formation of a mural thrombus occur. This response to injury is associated with the local release of potent vasoactive factors such as thrombin and platelet-derived products [ie, platelet-derived growth factor AB (PDGFAB), epidermal growth factor (EGF), insulin-like growth factor-I (IGF-I), transforming growth factor (TGF)-ß1, serotonin, and thromboxane A2]. Moreover, the arterial wall itself generates vasoactive factors such as PDGF, basic fibroblast growth factor (FGF), IGF-I, endothelin, and angiotensin II in response to balloon injury. Blood-derived and vascular wall–derived factors contribute to limiting the success of the angioplasty by causing local vasospasm and by stimulating the migration, proliferation, and synthesis of extracellular matrix molecules by vascular smooth muscle cells (SMC) that ultimately lead to the development of intimal thickening.
Recently, complications of balloon catheterization have been prevented by strategies aimed at expediting the recovery of the endothelial lining at sites of arterial injury. Indeed, local application of vascular endothelial growth factor (VEGF), an endothelial cell–specific mitogen that is also able to promote endothelial cell migration,3 4 either as recombinant protein or by VEGF gene transfer to balloon injured arteries, accelerated reendothelialization. This latter effect was associated with reduced intimal thickening, increased thromboresistance, and normalization of vasomotor reactivity.5 6 More recently it was recognized that balloon injury to arteries caused a marked upregulation of VEGF expression predominantly in the neointima and media.7 8 Because continuous administration of a neutralizing VEGF antibody impaired reendothelialization, endogenous SMC-derived VEGF appears to play a critical role in the recovery of the endothelium at sites of balloon injury.8 Although the stimulus responsible for the enhanced smooth muscle VEGF expression at sites of vascular injury remains to be determined, this upregulation shortly after the injury suggests a role for events occurring during the initial hemostatic and thrombotic responses.8 To understand the role of platelets as potential inducers of VEGF expression, the effect of aggregating platelets on VEGF expression in cultured rat and human SMC was examined. The current findings indicate that aggregating platelets stimulate smooth muscle VEGF expression predominantly through a concerted effect of PDGFAB and TGF-ß1.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Materials
Recombinant human PDGFAB, recombinant human TGF-ß1, TGF-ß–neutralizing antibody, and normal rabbit IgG and goat IgG were provided by R&D Systems; PDGF-neutralizing antibody was from Upstate Biotechnology Inc; recombinant human IGF-I and EGF from Prepro Tech EC Ltd; minimum essential medium (MEM) containing Earle's salts, trypsin, penicillin, and streptomycin from Gibco BRL; FCS from Biochrom; and U46619 (9,11-dideoxy-11
,9-epoxymethanoprostaglandin
F2) from Upjohn; all other chemicals were from
Sigma. A 350-bp-long restriction fragment obtained from the cloned rat
VEGF cDNA was kindly provided by Dr C. Frelin (Université de
Nice, France). All plastic ware was obtained from Falcon. Deoxycytidine
5'-[32P]triphosphate (3000 Ci/mmol) was
supplied by Hartmann Analytic. Male Wistar rats were from Charles River
Wiga Deutschland GmbH.
Platelet Preparation
One volume of platelet-rich plasma
(2.6x1010 platelets) obtained from healthy
human subjects was collected into 25% (vol/vol) acid-citrate-dextrose
buffer (38 mmol/L citric acid, 75 mmol/L trisodium citrate,
124 mmol/L glucose, pH 4.5) and centrifuged at
180g for 10 minutes. Thereafter, platelet-rich plasma
was collected and centrifuged at 700g for 10
minutes. Platelets were resuspended in buffer A (25 mL; 130
mmol/L NaCl, 3.9 mmol/L
KH2PO4, 3.9 mmol/L
Na2HPO4, 22 mmol/L
NaH2PO4, 5.5 mmol/L
glucose, 1 mmol/L CaCl2; pH 6.5) and
centrifuged at 700g for 10 minutes. After 2 washing
steps with buffer A, platelets were resuspended in 7.5 mL of buffer
B [0.02 mol/L Tris(hydroxymethyl)aminomethane-HCl
(Tris-HCl; pH 7.4), 0.14 mol/L NaCl, 5 mmol/L glucose, 1
mmol/L CaCl2; platelet buffer].
Preparation and Treatment of Platelet-Derived Products
Platelet-derived products (PDP) were prepared and
treated as previously described.9 Briefly, suspensions of
washed human platelets (3.5x109
platelets/mL) were stimulated with -thrombin (1 U/mL) for 2
minutes before addition of hirudin (10 thrombin-inactivating U/mL).
Platelet buffer was processed in a manner similar to platelet
suspensions. After removal of platelet aggregates by
centrifugation, PDP and platelet buffer were
collected and stored in aliquots at -70°C until use. The protein
content of PDP amounted to 170 to 390 µg protein/mL (16 different
preparations). In some instances, PDP and platelet buffer were
transiently acidified (a condition known to release bioactive
TGF-ß1)10 by addition of HCl (10N)
to pH 2.0 to 2.5 for 30 minutes at 22°C, followed by neutralization
to pH 7.4 with NaOH (2N). In some experiments, transiently acidified
PDP and acidified platelet buffer were incubated with either
PDGF-neutralizing or TGF-ß–neutralizing antibodies or their
respective nonimmune control IgGs (0.2 mg/mL) for 60 minutes at
22°C.
Cell Culture
SMC were isolated by elastase and collagenase
digestion of thoracic aortas from male Wistar rats and from a piece of
human aorta.9 Human cells were kindly provided by Dr T.
Scott-Burden (Texas Heart Institute, Houston). Rat and human SMC were
cultured serially in MEM containing 2 mmol/L
L-glutamine, 5 mmol/L TES, 5 mmol/L HEPES (both
at pH 7.3), 100 U/mL of penicillin and 50 µg/mL of streptomycin, and
10% FCS. All experiments were performed on SMC passages 5 to 24. When
SMC reached confluence, the culture medium was replaced by serum-free
medium containing 0.1% fatty acid–free BSA for 1 day before
treatment.
Reverse Transcription–Polymerase Chain Reaction and Northern
Blot Analyses
Total RNA was isolated by guanidinium isothiocyanate and phenol
extraction. For the reverse transcription (RT), 2 µg total RNA was
incubated with 200 U reverse transcriptase (Gibco), dNTP (175
µmol/L), oligo (dT) (200 ng), dithiothreitol (1 mmol/L), and
reaction buffer in a final volume of 20 µL at 37°C for 60 minutes.
In some reaction mixtures, reverse transcriptase or total RNA was
omitted to determine the amplification of contaminating genomic DNA or
cDNA. After a final denaturation at 94°C for 7 minutes, 6 µL of
cDNA was subjected to polymerase chain reaction (PCR) consisting of
denaturation at 94°C for 1 minute followed by 90 seconds of annealing
at 65°C and 2 minutes of elongation at 72°C for 30 cycles. The last
cycle was ended by 7 minutes of elongation at 72°C. The
oligonucleotide primers used for amplification of VEGF
cDNAs were derived from the sequence of the cloned human cDNA (sense
primer: 5'GGAGAGATGAGCTTCCTACAG3', antisense primer:
5'TCACCGCCTTGGCTTGTCACA3') and have previously been shown to amplify
all reported VEGF splice variants.11 The PCR contained
0.4 µmol/L of each primer, dNTP (200 µmol/L),
MgCl2 (1 mmol/L) reaction buffer, and 2.5 U
Taq DNA-polymerase (Promega) in a final volume of 50 µL. The
amplified cDNAs were size-fractionated by PAGE (12%), visualized under
UV after ethidium bromide staining, and transferred to nylon membranes
(Porablot NY amp, Macherey-Nagel). VEGF PCR products were
identified by Southern blot analysis with a rat
32P-labeled VEGF cDNA probe. Northern blots were
performed with 20 to 25 µg total RNA. RNA was electrophoresed on a
1.2% formaldehyde-denatured agarose gel, visualized with ethidium
bromide, transferred to nylon membranes, and hybridized with either a
rat 32P-labeled VEGF cDNA probe or a
32P-labeled 18S ribosomal RNA fragment.
Autoradiography was performed with Fuji RX film with
intensifying screens (DuPont de Nemours) at -70°C. The
autoradiographs were analyzed by scanning densitometry. VEGF
mRNA levels were normalized to their respective 18S ribosomal RNA
levels and expressed in arbitrary units as a fold increase of the
signal obtained with untreated cells.
Western Blot Analysis
Proteins present in the conditioned medium of SMC were
precipitated by the addition of trichloroacetic acid (7%) for 30
minutes at 4°C. Samples were centrifuged (15 000g
for 30 minutes at 4°C) and pellets washed with ethanol (70%)
followed by centrifugation (15 000g for 15
minutes at 4°C). Pellets were resuspended in 2% (wt/vol) SDS, 5%
(vol/vol) ß-mercaptoethanol, 10% (vol/vol) glycerin, and 0.001%
(wt/vol) bromophenol blue and 63 mmol/L Tris-HCl (pH 6.8), heated
at 95°C for 5 minutes, and subjected to 12% SDS-PAGE. The separated
proteins were electrophoretically transferred to nitrocellulose
membranes. Nitrocellulose blots were incubated overnight at 4°C with
a polyclonal rabbit antibody directed against human VEGF, which
recognizes VEGF isoforms of rat and human origin (dilution 1:1000;
Santa Cruz Biotechnology), and then with a secondary polyclonal goat
anti-rabbit antibody conjugated to horseradish peroxidase (1:10 000,
Calbiochem). VEGF immunoreactivity was visualized by exposing an x-ray
film to blots incubated with the ECL reagent.
Determination of VEGF
A commercially available immunoassay (human VEGF immunoassay,
R&D Systems) was used for the determination of VEGF content in PDP and
in rat SMC-conditioned medium. The amount of VEGF present in PDP
and in acidified PDP was subtracted from that measured in
conditioned medium of PDP-treated and acidified PDP-treated SMC,
respectively. Because the cross-reactivity of rat VEGF with the
antibody directed against human VEGF is unknown, the amount of VEGF in
conditioned medium of PDP-treated SMC was arbitrarily defined as
100%.
Statistical Analysis
Results are shown as mean±SEM. Statistical analyses
were performed with a Student's paired t test (2-tailed) or
an ANOVA followed by Fisher's protected least significant difference
test to compare 2 treatments. A value of P<0.05 was
considered statistically significant.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Expression of VEGF mRNA in SMC
VEGF mRNA levels in serum-deprived quiescent rat and human aortic SMC were low and sometimes even barely detectable (Figures 1
and 2).
Steady-state levels of the transcript were markedly increased after
exposure of rat and human SMC to products released by aggregating
washed human platelets, whereas exposure of cells to the same
volume of buffer had only minor effects (Figures 1 and 4). The
stimulatory effect of PDP was transient. After a delay of 30 minutes,
VEGF mRNA levels increased to reach maximum values after 
2 hours and
thereafter returned to baseline within the next 13 hours (Figure 1A). The stimulatory effect of PDP was concentration dependent,
with a consistent increase obtained at concentrations 
5 µg
protein/mL (Figure 1B).
|
|
|
To identify putative mediators of the stimulatory PDP effect, the
effect of several exogenous platelet-derived factors was
investigated at concentrations previously shown to evoke maximal
activation of SMC.12 13 14 15 Exposure of rat and human SMC to
either TGF-ß1 (the only isoform present in
human platelets) or PDGFAB (the predominant
isoform in human platelets) significantly increased VEGF mRNA
levels, whereas IGF-I and EGF had only minor effects (Figure 2
).
No stimulatory effect was found with serotonin (1
µmol/L; 1.4±0.3, n=5), platelet factor-4 (250 ng/mL; 0.7±0.2,
n=4), or the thromboxane A2 mimetic
U46619 (3 µmol/L, 1.4±0.5, n=3). In addition,
simultaneous treatment of rat SMC with
TGF-ß1 and PDGFAB caused
a supra-additive increase in VEGF mRNA levels (Figure 3).
|
Thrombin-activated human platelets secrete
TGF-ß1 predominantly in a biologically latent
form in which the precursor peptide (the latency-associated peptide)
remains covalently associated with the mature 25-kDa
TGF-ß1 dimer.16 Biologically
active TGF-ß1 is released from the
latency-associated peptide in vitro by transient acidification or
alkalinization.10 To determine whether
platelet-derived TGF-ß1 regulates VEGF
expression, PDP were transiently acidified (pH 2 to 2.5 for 30 minutes)
before their addition to SMC. Transient acidification significantly
enhanced the stimulatory effect of PDP on VEGF mRNA expression in rat
and human SMC, whereas exposure to the same volume of transiently
acidified buffer only slightly increased VEGF mRNA levels (Figure 4).
Next, selective neutralizing antibodies against the most potent
inducers of VEGF expression, TGF-ß1 and
PDGFAB, were used to identify the role of these 2
factors in the stimulatory effect of acidified PDP. Treatment of
acidified PDP with either a TGF-ß–neutralizing antibody or a
PDGF-neutralizing antibody significantly reduced their stimulatory
effect by 43% and 65% in rat SMC, respectively (Figure 5), whereas control IgGs had only minor
effects (data not shown).
|
RT-PCR analysis was performed to characterize the VEGF isoforms
expressed in rat and human SMC. Low levels of a single 219 bp VEGF cDNA
corresponding to the amplification of the VEGF165
transcript were found in quiescent human SMC (Figure 6A). In contrast, in RNA samples from
PDP-treated or acidified PDP-treated SMC, levels of the 219 bp VEGF
transcript were markedly increased, and 2 additional faint cDNAs of 87
bp and 291 bp, corresponding to VEGF121 and
VEGF189, respectively, were amplified (Figure 6A).
Similar findings were also obtained with the use of rat SMC
(Figure 6B).
|
Release of VEGF Protein From SMC
Western blot analysis indicated the presence of an
immunoreactive band of 21 kDa in conditioned medium of PDP-treated
rat SMC (Figure 7A). The abundance of the
VEGF signal was increased by transient acidification of PDP, whereas no
such signal was found in conditioned medium of SMC exposed to either
buffer or acidified buffer (Figure 7A) and in fresh medium
containing PDP (10 µg protein/mL; data not shown). The
TGF-ß1 and PDGFAB
treatments of SMC were also associated with a VEGF signal, and a
synergistic effect was found in response to the combined treatment with
the 2 factors (Figure 7A).
|
An immunoassay indicated the presence of human VEGF (23.6±0.7 pg/mL,
n=7) in fresh medium containing PDP (10 µg protein/mL), and this
level was not significantly changed by transient acidification
(22.4±1.3 pg/mL). Detectable levels of VEGF were also found in
conditioned medium of PDP-treated rat SMC from which the amount of VEGF
present in PDP has been subtracted, and this level was
increased by 2.9-fold after transient acidification of PDP (Figure 7B). Moreover, significant levels of VEGF were detected in
conditioned medium of TGF-ß1–treated or
PDGFAB-treated SMC, and a more than additive
effect was found in response to TGF-ß1 and
PDGFAB (Figure 7B).
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
This study demonstrates that aggregating human platelets markedly stimulate the expression of VEGF in rat and human SMC, as indicated by the time-dependent and concentration-dependent increases in the steady-state levels of VEGF mRNA and the secretion of VEGF protein.
To date, molecular cloning of cDNAs for human VEGF has revealed the existence of 4 major closely related members of the VEGF family, each formed by alternative splicing from a single 8-exon gene. VEGF mRNAs encode proteins of 121, 165, 189, and 206 amino acids.17 Nonhuman VEGFs are expected to be shorter by 1 amino acid.17 They comprise 34- to 42-kDa homodimeric, disulfide-bonded glycoproteins able to evoke biological responses in endothelial cells, but they differ predominantly in their cellular distribution. The shorter VEGF isoforms (VEGF121/120 and VEGF165/164) are readily secreted by producer cells, whereas the 2 larger ones (VEGF189/188 and VEGF206) are retained on the cell surface and in the extracellular matrix by heparin-like molecules.
Consistent with previous observations, quiescent SMC expressed a single VEGF mRNA transcript corresponding to VEGF165/164.18 19 In contrast, 3 distinct VEGF mRNA transcripts were found in SMC exposed to aggregating human platelets, demonstrating a marked upregulation of VEGF165/164 mRNA and the appearance of VEGF mRNA signals corresponding to VEGF189/188 and VEGF121/120. These findings indicate that aggregating platelets increase the expression of secreted VEGF isoforms, mostly VEGF165/164, but also of a cell-associated VEGF isoform, VEGF189/188.
Aggregating platelet–induced upregulation of VEGF expression in
SMC appears to be mediated by factors released during the
thrombin-stimulated activation and degranulation of platelets.
Moreover, the kinetics of VEGF expression suggest that the stimulatory
effect of platelet-derived products is due to a direct effect
on SMC. The study of several authentic platelet-derived factors on
VEGF expression indicated that PDGFAB and
TGF-ß1 are potent inducers of VEGF expression
in SMC, whereas IGF-I, EGF, serotonin, platelet
factor-4, and thromboxane A2, which
was studied with its stable mimetic U46619, were inactive (all growth
factors were tested at concentrations previously shown to evoke maximal
activation of cultured SMC).12 13 14 15 The hypothesis that
PDGFAB and TGF-ß1 are the
physiologically relevant mediators of VEGF
expression in SMC by aggregating platelets is supported by the
following findings: (1) Transient acidification, which releases
biologically active TGF-ß1 from its
latency-associated peptide, markedly increased PDP-induced VEGF mRNA
expression and the secretion of VEGF protein. (2) Selective
TGF-ß–neutralizing and PDGF-neutralizing antibodies significantly
prevented the stimulatory effect of acidified PDP on VEGF mRNA
expression. (3) TGF-ß1 and
PDGFAB levels in acidified PDP amounted to 6
ng and 3 ng/10 µg protein, respectively.9 Such growth
factor levels are within the range of those eliciting biological
responses in cultured SMC.14 20 (4) Although the
upregulation of VEGF expression in SMC by PDGFBB
and TGF-ß1 alone has been previously
described,18 the current findings indicate that the
combination of the 2 growth factors was markedly more effective.
Altogether, this study indicates that aggregating platelets are
potential endogenous stimulators of vascular smooth muscle
VEGF expression after balloon catheter injury of arteries, mainly
through a concerted effect of PDGFAB and
TGF-ß1.
The platelet response at vascular sites of balloon injury has been shown to rapidly subside 24 hours after the in vivo injury, suggesting that although aggregating platelets may provide a stimulus for the early enhanced smooth muscle VEGF expression, they are unlikely to explain its upregulation throughout the development of intimal thickening.8 21 Such a long-term upregulation of smooth muscle VEGF expression may be controlled by endogenous factors possibly released from injured cells within the arterial wall. Indeed, an increased production of TGF-ß1 and PDGF-A has been found in balloon-injured rat carotid arteries during the development of intimal thickening.22 23 In addition, basic FGF, angiotensin II, and endothelin, all involved in the proliferative response to balloon injury,24 25 26 and the proinflammatory mediator interleukin-1ß are other potential endogenous stimuli as these factors increased VEGF expression in cultured SMC.27 28 29 Although SMC are the major source of these factors at sites of vascular injury, they are also produced and secreted by inflammatory cells present within the neointima and by surrounding endothelial cells.2
In conclusion, this study demonstrates that aggregating platelets stimulate VEGF expression in cultured SMC mainly through a synergistic effect of TGF-ß1 and PDGFAB. Thus it is conceivable that the local activation of platelets at sites of endothelial denudation after balloon catheterization might provide an important endogenous stimulus for VEGF production in the arterial smooth muscle during the early phase of the vascular response to injury. Thereafter, the long-term upregulation of smooth muscle VEGF expression during the development of intimal thickening may be due to factors generated within the arterial wall itself. Smooth muscle–derived VEGF might act as a paracrine hormone to stimulate migration and proliferation of surrounding endothelial cells and hence contribute to the recovery of the protective endothelial lining at sites of balloon-injured arteries.
|
Acknowledgments |
|---|
This study was supported by grants from the Institut de Recherches Internationales Servier (Paris) and from the Commission of the European Communities (BMH4-CT96-0979).
Received December 21, 1998; revision received April 14, 1999; accepted April 22, 1999.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
-
Vanhoutte PM. Endothelial
dysfunction and atherosclerosis. Eur Heart
J.. 1997;18:E19–E29.
-
Ross R. The pathogenesis of
atherosclerosis: a perspective for the 1990s.
Nature. 1993;362:801–809.[Medline]
[Order article via Infotrieve]
-
Leung DW, Cachianes G, Kuang WJ, Goeddel DV, Ferrara
N. Vascular endothelial growth factor is a secreted
angiogenic mitogen. Science. 1989;246:1306–1309.
[Abstract/Free Full Text]
-
Senger DR, Ledbetter SR, Claffey KP,
Papadopoulos-Sergiou A, Peruzzi CA, Detmar M. Stimulation of
endothelial cell migration by vascular permeability
factor/vascular endothelial growth factor through
cooperative mechanisms involving the
vß3 integrin, osteopontin, and
thrombin. Am J Pathol. 1996;149:293–305.[Abstract]
-
Asahara T, Bauters C, Pastore C, Kearney M, Rossow S,
Bunting S, Ferrara N, Symes JF, Isner JM. Local delivery of vascular
endothelial growth factor accelerates
reendothelialization and attenuates intimal hyperplasia
in balloon-injured rat carotid artery. Circulation. 1996;91:2793–2801.
[Abstract/Free Full Text]
-
Asahara T, Chen D, Tsurumi Y, Kearney M, Rossow S,
Passeri J, Symes JF, Isner JM. Accelerated restitution of
endothelial integrity and
endothelium-dependent function following
phVEGF165 gene transfer. Circulation. 1996;94:3291–3302.
[Abstract/Free Full Text]
-
Ruef J, Hu ZY, Yin LY, Wu Y, Hanson SR, Kelly AB,
Harker LA, Rao GN, Runge MS, Patterson C. Induction of vascular
endothelial growth factor in balloon-injured baboon
arteries. Circ Res. 1997;81:24–33.
[Abstract/Free Full Text]
-
Tsurumi Y, Murohara T, Krasinski K, Chen D,
Witzenbichler B, Kearney M, Couffinhal T, Isner JM. Reciprocal relation
between VEGF and NO in the regulation of endothelial
integrity. Nat Med. 1997;3:879–886.[Medline]
[Order article via Infotrieve]
-
Schini-Kerth VB, Bassus S, Fisslthaler B, Kirchmaier
CM, Busse R. Aggregating human platelets stimulate the expression
of thrombin receptors in cultured vascular smooth muscle cells via the
release of transforming growth factor-ß1
and platelet-derived growth factorAB.
Circulation. 1997;96:3888–3896.
[Abstract/Free Full Text]
-
Pircher R, Jullien P, Lawrence DA.
ß-Transforming growth factor is stored in human blood platelets
as a latent high molecular weight complex. Biochem Biophys Res
Commun. 1986;136:30–37.[Medline]
[Order article via Infotrieve]
-
Poltorak Z, Cohen T, Sivan R, Kandelis Y, Spira G,
Vlodavsky I, Keshet E, Neufeld G. VEGF145, a
secreted vascular endothelial growth factor isoform
that binds to extracellular matrix. J Biol Chem. 1997;272:7151–7158.
[Abstract/Free Full Text]
-
Schini-Kerth VB, Fisslthaler B, Van Obberghen-Schilling
E, Busse R. Serotonin stimulates the expression of thrombin
receptors in cultured vascular smooth muscle cells: role of protein
kinase C and protein tyrosine kinases. Circulation. 1996;93:2170–2177.
[Abstract/Free Full Text]
-
Scott-Burden T, Resink TJ, Baur U, Burgin M, Buhler FR.
Epidermal growth factor responsiveness in smooth muscle cells from
hypertensive and normotensive rats. Hypertension. 1989;13:295–304.
[Abstract/Free Full Text]
-
Schini VB, Durante W, Elizondo E, Scott-Burden T,
Junquero DC, Schafer AI, Vanhoutte PM. The induction of nitric oxide
synthase activity is inhibited by TGF-ß1,
PDGFAB and PDGFBB in
vascular smooth muscle cells. Eur J Pharmacol. 1992;216:379–383.[Medline]
[Order article via Infotrieve]
-
Schini VB, Catovsky S, Schray-Utz B, Busse R, Vanhoutte
PM. Insulin-like growth factor I inhibits induction of nitric oxide
synthase in vascular smooth muscle cells. Circ Res. 1994;74:24–32.
[Abstract/Free Full Text]
-
Wakefield LM, Smith DM, Flanders KC, Sporn MB. Latent
transforming growth factor-ß from human platelets: a high
molecular weight complex containing precursor sequences. J
Biol Chem. 1988;263:7646–7654.
[Abstract/Free Full Text]
-
Ferrara N, Davis-Smyth T. The biology of vascular
endothelial growth factor. Endocr Rev. 1997;13:18–32.[Medline]
[Order article via Infotrieve]
-
Brogi E, Wu T, Namiki A, Isner JM. Indirect angiogenic
cytokines upregulate VEGF and bFGF expression in vascular
smooth muscle cells, whereas hypoxia upregulates VEGF
expression only. Circulation. 1994;90:649–652.
[Abstract/Free Full Text]
-
Ferrara N, Winer J, Burton T. Aortic smooth muscle
cells express and secrete vascular endothelial growth
factor. Growth Factors. 1991;5:141–148.[Medline]
[Order article via Infotrieve]
-
Sachinidis A, Locher R, Vetter W, Tatje D, Hoppe J.
Different effects of platelet-derived growth factor isoforms on rat
vascular smooth muscle cells. J Biol Chem. 1990;265:10238–10243.
[Abstract/Free Full Text]
-
Groves HM, Kinlough-Rathbone RL, Richardson M, Moore S,
Mustard JF. Platelet interaction with damaged rabbit aorta.
Lab Invest. 1979;40:194–200.[Medline]
[Order article via Infotrieve]
-
Majesky MW, Reidy MA, Bowen-Pope DF, Hart CE, Wilcox
JN, Schwartz SM. PDGF ligand and receptor gene expression during repair
of arterial injury. J Cell Biol. 1990;111:2149–2158.
[Abstract/Free Full Text]
-
Majesky MW, Lindner V, Twardzik DR, Schwartz SM, Reidy
MA. Production of transforming growth factor
ß1 during repair of arterial
injury. J Clin Invest. 1991;88:904–910.
-
Lindner V, Reidy A. Proliferation of smooth muscle
cells after vascular injury is inhibited by an antibody against basic
fibroblast growth factor. Proc Natl Acad Sci U S A. 1991;88:3739–3743.
[Abstract/Free Full Text]
-
Laporte S, Escher E. Neointima formation
after vascular injury is angiotensin II mediated.
Biochem Biophys Res Commun. 1992;187:1510–1516.[Medline]
[Order article via Infotrieve]
-
Chandra S, Clark LV, Coatney RW, Phan L, Sarkar SK,
Ohlstein EH. Application of serial in vivo magnetic resonance imaging
to evaluate the efficacy of endothelin receptor antagonist
SB 217242 in the rat carotid artery model of neointima
formation. Circulation. 1998;97:2252–2258.
[Abstract/Free Full Text]
-
Li J, Perrella MA, Tsai JC, Yet SF, Hsieh CM, Yoshizumi
M, Patterson C, Endege WO, Zhou F, Lee ME. Induction of vascular
endothelial growth factor gene expression by
interleukin-1ß in rat aortic smooth muscle cells. J
Biol Chem. 1995;270:308–312.
[Abstract/Free Full Text]
-
Williams B, Baker AQ, Gallacher B, Lodwick D.
Angiotensin II increases vascular permeability factor gene
expression by human vascular smooth muscle cells.
Hypertension. 1995;25:913–917.
[Abstract/Free Full Text]
-
Pedram A, Razandi M, Hu RM, Levin ER. Vasoactive
peptides modulate vascular endothelial growth factor
production and endothelial cell proliferation
and invasion. J Biol Chem. 1997;272:17097–17103.
[Abstract/Free Full Text]
This article has been cited by other articles:
 |
|
 |
|
  X. Deng, S. Szabo, T. Khomenko, M. R. Jadus, and M. Yoshida Gene Therapy with Adenoviral Plasmids or Naked DNA of Vascular Endothelial Growth Factor and Platelet-Derived Growth Factor Accelerates Healing of Duodenal Ulcer in Rats J. Pharmacol. Exp. Ther., December 1, 2004; 311(3): 982 - 988. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Gawaz Role of platelets in coronary thrombosis and reperfusion of ischemic myocardium Cardiovasc Res, February 15, 2004; 61(3): 498 - 511. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M.-H. Oak, M. Chataigneau, T. Keravis, T. Chataigneau, A. Beretz, R. Andriantsitohaina, J.-C. Stoclet, S.-J. Chang, and V. B. Schini-Kerth Red Wine Polyphenolic Compounds Inhibit Vascular Endothelial Growth Factor Expression in Vascular Smooth Muscle Cells by Preventing the Activation of the p38 Mitogen-Activated Protein Kinase Pathway Arterioscler. Thromb. Vasc. Biol., June 1, 2003; 23(6): 1001 - 1007. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. F. Dvorak Vascular Permeability Factor/Vascular Endothelial Growth Factor: A Critical Cytokine in Tumor Angiogenesis and a Potential Target for Diagnosis and Therapy J. Clin. Oncol., November 1, 2002; 20(21): 4368 - 4380. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Iba, H. Matsubara, Y. Nozawa, S. Fujiyama, K. Amano, Y. Mori, H. Kojima, and T. Iwasaka Angiogenesis by Implantation of Peripheral Blood Mononuclear Cells and Platelets Into Ischemic Limbs Circulation, October 8, 2002; 106(15): 2019 - 2025. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. P. Bracamonte, K. S. Rud, W. G. Owen, and V. M. Miller Ovariectomy increases mitogens and platelet-induced proliferation of arterial smooth muscle Am J Physiol Heart Circ Physiol, September 1, 2002; 283(3): H853 - H860. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. C. G. LEE, D. MELKERNEKER, P. J. THOMPSON, R. W. LIGHT, and K. B. LANE Transforming Growth Factor beta Induces Vascular Endothelial Growth Factor Elaboration from Pleural Mesothelial Cells in Vivo and in Vitro Am. J. Respir. Crit. Care Med., January 1, 2002; 165(1): 88 - 94. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Bassus, O. Herkert, N. Kronemann, A. Gorlach, D. Bremerich, C. M. Kirchmaier, R. Busse, and V. B. Schini-Kerth Thrombin Causes Vascular Endothelial Growth Factor Expression in Vascular Smooth Muscle Cells: Role of Reactive Oxygen Species Arterioscler. Thromb. Vasc. Biol., September 1, 2001; 21(9): 1550 - 1555. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Bouloumie, C. Sengenes, G. Portolan, J. Galitzky, and M. Lafontan Adipocyte Produces Matrix Metalloproteinases 2 and 9: Involvement in Adipose Differentiation Diabetes, September 1, 2001; 50(9): 2080 - 2086. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. G. Christen, R. J. Glynn, U. A. Ajani, D. A. Schaumberg, E. Y. Chew, J. E. Buring, J. E. Manson, and C. H. Hennekens Age-Related Maculopathy in a Randomized Trial of Low-Dose Aspirin Among US Physicians Arch Ophthalmol, August 1, 2001; 119(8): 1143 - 1149. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Gorlach, I. Diebold, V. B. Schini-Kerth, U. Berchner-Pfannschmidt, U. Roth, R. P. Brandes, T. Kietzmann, and R. Busse Thrombin Activates the Hypoxia-Inducible Factor-1 Signaling Pathway in Vascular Smooth Muscle Cells : Role of the p22phox-Containing NADPH Oxidase Circ. Res., July 6, 2001; 89(1): 47 - 54. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||