(Circulation. 2000;101:1396.)
© 2000 American Heart Association, Inc.
Clinical Investigation and Reports |
A Newly Created Splice Donor Site in Exon 25 of the MyBP-C Gene Is Responsible for Inherited Hypertrophic Cardiomyopathy With Incomplete Disease Penetrance
From the Department of Experimental Cardiology, Max-Planck-Institute for Physiological and Clinical Research, Bad Nauheim, Germany (J.A.M., K.U., S.B., B.J., H.-P.V.); the Department of Medical Physiology, University of Stellenbosch, Republic of South Africa (J.A.M.); the Department of Cardiology, Medizinische Klinik I, Rheinisch-Westfälische Technische Hochschule Aachen, Aachen, Germany (S.R., J.O., H.K.); the Institute of Human Genetics, University of Heidelberg, Heidelberg, Germany (C.F.); the Department of Cardiological Sciences, St George’s Hospital Medical School, London, UK (W.J.M.); and European Molecular Biology Laboratory, Heidelberg, Germany (M.G.).
 |
Abstract |
|---|
 Top Abstract IntroductionResultsDiscussionMethodsReferences |
|---|
Background—Hypertrophic cardiomyopathy is a myocardial disorder resulting from inherited sarcomeric dysfunction. We report a mutation in the myosin-binding protein-C (MyBP-C) gene, its clinical consequences in a large family, and myocardial tissue findings that may provide insight into the mechanism of disease.
Methods and Results—History and clinical status (examination,
ECG, and echocardiography) were assessed in 49
members of a multigeneration family. Linkage analysis
implicated the MyBP-C gene on chromosome 11. Myocardial mRNA, genomic
MyBP-C DNA, and the myocardial proteins of patients and healthy
relatives were analyzed. A single guanine
nucleotide insertion in exon 25 of the MyBP-C gene resulted
in the loss of 40 bases in abnormally processed mRNA. A 30-kDa
truncation at the C-terminus of the protein was predicted, but a
polypeptide of the expected size (
95 kDa) was not detected by
immunoblot testing. The disease phenotype in this
family was characterized in detail: only 10 of 27 gene carriers
fulfilled diagnostic criteria. Five carriers showed
borderline hypertrophic cardiomyopathy, and 12
carriers were asymptomatic, with normal ECG and
echocardiograms. The age of onset in symptomatic patients
was late (29 to 68 years). In 2 patients, outflow obstruction required
surgery. Two family members experienced premature sudden cardiac death,
but survival at 50 years was 95%.
Conclusions—Penetrance of this mutation was incomplete and age-dependent. The large number of asymptomatic carriers and the good prognosis support the interpretation of benign disease.
Key Words: genes • cardiomyopathy • diagnosis
|
Introduction |
|---|
|
TopAbstractIntroductionResultsDiscussionMethodsReferences |
|---|
Familial hypertrophic cardiomyopathy (HCM) is an inherited primary heart muscle disease characterized by myocardial hypertrophy in the absence of secondary causes.1 Heterogeneous mutations in genes coding for cardiac muscle proteins are known to account for HCM.2 Mutations often occur in the genes encoding ß-myosin heavy chain, cardiac troponin T, and myosin binding protein-C (MyBP-C) on chromosomes 14, 1, and 11, respectively.3 4 5 Less frequently, mutations will be found in the genes specifying
-tropomyosin, regulatory and essential
myosin light chains, and cardiac troponin I on chromosomes 15, 12, 3,
and 19, respectively.4 6 7 Recently, a mutation in the
cardiac -actin gene on chromosome 15 was described.8 An
unknown HCM gene has been localized on chromosome 7.9
Mutations in MyBP-C are responsible for 15% of cases of
HCM.10 This protein binds with its C-terminus to myosin
heavy chain and to titin.11 It seems to be involved in
thick filament assembly12 13 and may also regulate cardiac
contractility in response to adrenergic
stimulation.14 At this point, >20 mutations in this gene
have been described.5 10 15 16 17 18 Apart from a few missense
mutations,5 10 18 19 most are predicted to result in a
truncation of the protein.5 10 15 16 17 The loss of
C-terminal myosin and titin binding sites suggests a pathogenesis based
on distorted filament assembly. However, molecular details of the
dysfunction are not understood.
In this article, we report on a large family with HCM in which a mutation in exon 25 of the MyBP-C gene (insertion of a single G base pair) was identified on the basis of linkage to chromosome 11. Because the affected cardiac tissue was available, the predicted consequences of the mutational change (truncation of the protein by almost one-third) were investigated in detail. Unexpectedly, the shortened protein was not detected in the myectomy tissue. The significance of this finding remains unclear. Another major point of interest was the assessment of the clinical phenotype associated with this mutation and the comparison of this phenotype with that of other HCM-related mutations. Because of the size of the family (27 gene carriers), the clinical consequences associated with the altered splicing of exon 25 could be reliably assessed as incomplete penetrance, late onset of disease, and low cardiac mortality. However, the overall benign character of the disease does not prevent the occurrence of a typical HCM phenotype once symptoms have developed.
|
Results |
|---|
|
TopAbstractIntroductionResultsDiscussionMethodsReferences |
|---|
Mutation in the MyBP-C Gene
A fragment length difference in amplified myocardial mRNA-derived cDNA from affected tissue suggested an altered sequence in a region including exons 24 to 26 of the MyBP-C gene (exon numbers according to Reference 10 ). By reverse transcriptase polymerase chain reaction (RT-PCR), a predicted 322-bp fragment and a fragment shorter by
40 bp were produced (Figure 1
). When sequencing both amplified
and cloned exon 25 cDNA, a stretch of 40 bp at the 3' end of this exon
was identified as missing, a result suggesting modified splicing
(Figure 2A). In cloned genomic
exon 25 DNA, a single base insertion (G) preceding codon 792 (or in
codon 791) was identified. The additional G in this position converts a
AGTGGG into a AGGTGGG motif, which is apparently used as a 5' consensus
splice site, with AG determining the 3' end of the exon, and GTGGG
defining the beginning of an unscheduled intron (Figure 2B).
PCR-single strand conformation polymorphism (SSCP) screening
of all 35 coding exons of the gene revealed altered mobility of exon 25
(Figure 3) in the DNA of those diagnosed
as having symptomatic or borderline HCM and in 11
asymptomatic individuals (Table 1). This change was not observed
in exon 25 DNA of 100 unrelated healthy individuals from the general
population.
|
|
|
|
Immunoblotting
Unscheduled splicing of exon 25 of MyBP-C mRNA would result in a
reading frame shift with a stop in exon 26, which in turn should lead
to translational termination in position 816. The predicted size of the
protein resulting from a loss of the C-terminus is 95 kDa, 30% less
than the normal 137-kDa protein.5 With
immunoblotting (using cardiac tissue from patient
IV-22), only the native (not truncated) form of the MyBP-C gene was
observed (Figure 4).
|
Clinical Characterization
The clinical identification of the index patient (IV-20, see
Figure 6, see online Methods) occurred after
presentation at age 46 with symptoms of HCM in association
with left ventricular outflow obstruction, which was
treated by surgical myectomy. Other affected family members were—in
generation III—the proband’s mother, her sister, 2 half-siblings and
3 cousins, and—in generation IV—the proband’s brother (IV-22) and 6
of her cousins (see Figure 6, online). The brother developed symptoms
at age 38 and also had a myectomy. In 5 individuals symptoms were mild
(Group B, see Table 1
).
|
A total of 27 members of the family were identified as gene
carriers, of which only 10 persons (group A in Table 1) were
clearly symptomatic according to the criteria used
(clinical evidence, echocardiography, and
electrocardiography21 ).
This group was older and had more obvious manifestations of HCM
(symptoms, echocardiogram, and arrhythmia) than the other gene
carriers (Tables 1 and 2). The age
of onset of HCM-related symptoms was 29 to 68 years (mean, 44). Of the
other gene carriers, 5 (group B) had borderline HCM, and 12 (group C)
were asymptomatic without clinical HCM. Three patients with
longstanding hypertension in group C had increased septum thickness (13
to 14 mm). After an assessment that was blinded to
genotype, the ECG and echocardiographic changes
in these 3 patients were thought to reflect hypertension rather than
HCM.
|
Fractional shortening was within normal limits in all gene carriers. In
17 of the 27 gene carriers, 24-hour Holter monitoring was performed
(Table 1). One patient experienced episodes of paroxysmal atrial
fibrillation and nonsustained ventricular
tachycardia. Episodes of supraventricular
tachycardia were recorded in 7 of 19 gene carriers. A
total of 8 of the 27 gene carriers had a history of documented
hypertension. The incidence of hypertension among non-gene carriers in
the family was 26% (5 of 19 persons), which was similar to that of the
gene carriers.
A comparison of symptomatic patients (group A in Table 1) with mildly symptomatic or
asymptomatic carriers (groups B and C combined) and 22
healthy noncarriers in the family (Table 2) helped characterize
the disease. The late clinical manifestation of HCM in this family is
underscored by the more advanced age (mean, 54.7±4.5 years) in group A
compared with the other groups (group B, 45.2±16.9 years; group C,
37.8±13.6 years). Furthermore, borderline cases and
asymptomatic carriers of the mutation exhibited signs of a
cardiac condition on a preclinical level, as shown by the frequency of
mild symptoms and echocardiographic and ECG
abnormalities.
Survival
Kaplan-Meier product-limit analyses of survival
(heart-related mortality) in all 27 gene carriers and the 5 deceased
family members assumed to be carriers are depicted in Figure 5. In 4 siblings in generation II
(no clinical data available), presumed cardiac death occurred. Because
3 of them had affected progeny, their HCM carrier status was safely
assumed. One (II-6) died suddenly at the age of 35 years. Predeath
echocardiography and postmortem examination
confirmed HCM in another case of sudden death at the age of 33 (IV-9).
Survival of carriers of the MyBP-C mutation at 50 years was 95%, which
is similar to that of carriers of the Asp175Asn mutation in the
-tropomyosin gene but unlike that of carriers of the Arg403Gln
mutation of the ß-myosin heavy chain gene (P<0.0001).
|
),
Asp175Asn missense mutation in 
), |
Discussion |
|---|
|
TopAbstractIntroductionResultsDiscussionMethodsReferences |
|---|
The genetic cause and the phenotypic expression of HCM in a large, multigeneration family with one mutation was investigated.
The Mutation and Its Consequences
The genetic change was a single base (G) insertion in exon 25 of
the cardiac MyBP-C gene on chromosome 11, which resulted in a sequence
suitable to serve as a 5' splice donor site (AG GTGGG). This mutation
was also recently reported in a nonrelated family of the same ethnic
group in North America.10 We showed that the mutation
resulted in the loss of 40 bp at the 3' end of exon 25 in mRNA
extracted from affected myocardial tissue. This loss resulted in a
premature translational stop, which was then predicted to result in a
truncated protein of 95 kDa and the loss of the C-terminal binding
sites for myosin heavy chain and titin.20 A reading shift
would also occur if mRNA splicing were unaffected by the inserted G in
exon 25. In this case, the shift resulting from the additional G would
lead to a premature stop 40 residues away from the 3' terminal of codon
792. However, such mutated mRNA was not observed (data not shown).
The shortened 95-kDa MyBP-C protein was not detected in
nondenaturing gels (data not shown) or by
immunoblotting the total protein of affected tissue
using 2 different polyclonal antibodies. The absence of detectable
amounts of the truncated MyBP-C protein in the biopsy cannot be readily
explained. The sensitivity of the staining method allows the detection
of MyBP-C of at least 1/64th of the amount of protein used in the
actual loading.17 The epitopes of the polyclonal
antibodies cover 55 kDa of the N-terminal region of MyBP-C. The absence
of a visible band at the 95-kDa position suggests that the protein is
either expressed at levels below the detection limit of 1% of
wild-type protein or is absent (limit based on separate loading
controls; data not shown). Absence could be the result of insufficient
synthesis or rapid degradation. If the truncated MyBP-C protein were
unable to contribute to filament assembly in the sarcomere, it could be
rapidly degraded, as has been reported in cystic fibrosis, in which a
deletion of phenylalanine in position 508 of CFTR results in defective
processing and rapid degradation of partially glycosylated
protein.22 Protein degradation may, therefore, offer a
plausible explanation for the absence of detectable mutant protein.
How does this relate to the pathogenesis of HCM? The presence or
absence of the predicted truncated protein may provide insight into the
mechanism of disease. Another hypothetical explanation (given in
reference 15) may be cotranslational events coupling with the synthesis
of MyBP-C to filament assembly.23 Rapid degradation of the
truncated protein may be the critical step preventing
myofibrillogenesis. Filament formation rather than the function of
assembled filaments would thus be disturbed. Although very low levels
of mutant protein (below 1%) in the cells may exert a negative
effect on filament assembly or maintenance, this seems unlikely
because the interaction of the N-terminal regulatory domain of MyBP-C
with the S2 region of myosin has a kDa of 5
µmol/L.24 Low levels of mutant protein would, therefore,
be insufficient to compete with the filament-associated normal protein.
This suggests that a "poison polypeptide" (or dominant-negative)
mechanism is less likely than a lack of protein (haploinsufficiency) to
explain the mode of action of the mutation.
Experimental data from studies of transgenic mice do not provide an explanation either.25 In mice with mutated MyBP-C lacking the myosin and titin binding sites, the mutated protein was expressed in detectable quantities and had detrimental effects on organization and contractile function of cardiac sarcomeres. We cannot explain the differences between the steady-state levels of truncated MyBP-C in transgenic mice and man. Either these differences are mutation-specific or human cardiomyocytes have an unknown mechanism to prevent the accumulation of truncated MyBP-C in cells.
Phenotype-Genotype Correlation
The second major point of this study was related to the clinical
expression of disease associated with the MyBP-C mutation. The family
was of sufficient size to examine penetrance, disease severity, and
prognosis.
Penetrance was assessed by evaluating the 26 gene carriers and the one case of premature sudden death that was considered to be a consequence of the mutation (27 total carriers). The overall nature of the disease was characterized by late onset, a moderate course, and a high proportion of completely asymptomatic or mildly affected carriers. Different phenotypes among gene carriers led to the assignment of affected family members into 1 of 3 groups: symptomatic clinical HCM (group A), borderline clinical HCM (group B), and clinically normal (group C).
The first group included 10 patients who fulfilled conventional
diagnostic criteria for HCM.1 21 In these
patients, the mutation was judged to be fully penetrant. Three of the 5
members of the borderline HCM group (group B) fulfilled recently
proposed criteria for the diagnosis of HCM within the context of
familial disease with diagnostic ECG abnormalities, whereas
the other 2 had disease-related symptoms. Septal thickness was in the
upper range of normal in 4 of these 5 persons. There were 12 clinically
normal gene carriers in whom the mutation was apparently not penetrant.
A confounding factor in this group was the occurrence of systemic
hypertension associated with concentric hypertrophy in 3
individuals (III-22, IV-4, and IV-36). In the absence of symptoms and
typical morphological features of HCM, septal changes in these
individuals (see Table 1) were thought to reflect chronic systemic
hypertension rather than the action of the MyBP-C mutation. The
prevalence of hypertension was comparable among mutation carriers (8 of
27; 30%) and noncarriers (6 of 23; 26%) in the family.
Overall, only 15 of 27 carriers (56%) showed features of the
HCM phenotype. The older age in patients with phenotypic
expression and the fact that the age at which symptoms first developed
was >44 years confirms the late disease development of HCM caused by
MyBP-C mutations.10 28 A total of 95% of the carriers of
the G insertion were alive at the age of 50 years (Figure 5).
This is similar to the survival of carriers of the Asp175Asn mutation
of the -tropomyosin gene26 and significantly better
than the survival of most reported troponin T and ß-myosin heavy
chain families.27 29 30 The relatively good prognosis
seems to be consistent with the late-onset, benign HCM caused
by MyBP-C mutations.
It is of interest, however, that patients with the morphological
features of the HCM phenotype experienced syncope,
supraventricular and ventricular
arrhythmias, premature sudden cardiac death, and severe
symptoms requiring surgical myectomy (Table 1). The perspective
that HCM caused by MyBP-C mutations has a relatively benign prognosis
arises in large part because of the late onset of disease expression.
This family suggests that once the phenotype has developed,
individual patients are at risk for the well-recognized complications
of HCM.
In conclusion, we characterized a mutation in the MyBP-C gene leading to an internal truncation of the transcript and to a predicted premature translational stop in the message. The molecular details of the pathogenic mechanisms of this truncation require further investigation. Our phenotype analysis is in general agreement with the results of 2 recent studies10 28 of a number of families suffering from different MyBP-C mutations, in particular regarding the late age of onset and the incomplete penetrance of the mutation. We wish to emphasize that despite the seemingly mild character of the disease, significant complications may occur once the phenotype has developed.
|
Methods |
|---|
|
TopAbstractIntroductionResultsDiscussionMethodsReferences |
|---|
Clinical Analysis
A total of 49 members of the family were evaluated (one deceased member, IV-9, who was assumed to be a carrier was included in the study; Figure 6
). Two adults refused
participation, and individuals younger than 18 years of age were
excluded from the investigation. All adults (except IV-9) underwent a
history, physical examination, 12-lead ECG, and 2D
echocardiography (Table 1). The family
history sought information about possible disease-related deaths to
identify deceased gene carriers. ECG and ultrasound recordings
were analyzed by 2 independent observers;one observer
(W.J.M.) was blinded to gene carrier status. The diagnosis of HCM was
based on recently proposed criteria for the diagnosis of HCM within the
context of known familial disease.21 31 In brief, given a
50% chance of inheriting a disease-causing gene, the presence of
unexplained ECG changes and/or echocardiographic
abnormalities were considered diagnostic if major or
sufficient minor criteria were fulfilled.21 Written
consent was obtained from all family members. This study was approved
by the Ethics Committee of the Aachen Rheinisch Westfälische
Technische Hochschule University Hospital.
Genetic Investigation
Linkage analyses of HCM genes on chromosomes 1, 11, 14,
and 15 (cardiac troponin T, MyBP-C, ß-myosin heavy chain, and
-tropomyosin) were performed using markers as described
previously.15 32 33 34 After linkage was established for
chromosome 11 (the 2-point LOD score, or logarithm of odds was 4.2,
calculated with the software MLINK, with no recombination for the
microsatellite marker locus D11S1344),the mutation was searched
and identified by RT-PCR, direct sequencing of cDNA, and PCR-SSCP of
genomic DNA.
RT-PCR
The mutation was identified in cDNA derived from mRNA isolated
from myectomy tissue (patient IV-22) (RNEasy Kit, Qiagen). Primers used
for RT-amplification were derived from the published MyBP-C cDNA
sequence (EMBL accession number Y10129).5 The RT
reaction was done with primer R-2700, 5'-ACTTGAGGG-AGACCGTGGTGT, and
MoMuLV reverse transcriptase (Gibco BRL). The second amplification was
done using R-2700 and F-1934 (5'-CAAGATTGACTTCGTACCCAGGC)
as first-round primers and using a touchdown protocol (658C to 618C).
In the second round, the following primers were used: F-2148
(Cy5-labeled; 5'-GGTGACAGCGATGAGTGG GTG) and R-2450
(5'TCTTCTTGCGCTCCAGGATGT). A touchdown protocol (708C to 608C with
2-degree decrements) was employed. PCR product lengths were
analyzed with the ALFexpress DNA Sequencer (Amersham
Pharmacia Biotech).34
Cloning and Sequencing of PCR Fragments
Cardiac RT-PCR cDNA fragments synthesized by nested RT-PCR,
using primers F-2148 and R-2450, were reamplified using the same
primers containing HindIII and SacII restriction sites and then cloned
into Bluescript KS (±) phasmid vectors. Genomic DNA of the exon 25
region of the MyBP-C gene was cloned using a similar protocol. After
blue-white selection, recombinant plasmids were purified from alkaline
cell lysates (Qiagen). Solid-phase DNA sequencing was done as
previously described.34
PCR-SSCP of Genomic DNA
DNA from leukocytes was extracted as previously
described34 from the blood samples of 49 individuals. All
35 coding exons of the gene were screened separately (primers according
to Reference 55 ) to detect SSCP mobility shifts in polyacrylamide
gels. PCR products were loaded onto nondenaturing 5% to 20%
gradient polyacrylamide gels. Horizontal electrophoresis
(Multiphor II equipment, LKB/Pharmacia) was performed, and products
were visualized by silver staining.
Protein Analysis
The extraction of proteins from tissue and analysis by
Western blotting using anti–MyBP-C antibodies were done as previously
described.17 Cardiac MyBP-C was detected using 2
polyclonal antibodies directed against the MyBP-C N-terminal
region17 20 35 that were specific for the C0-C1 and C1-C2
domains of the protein. These sera recognize 55 kDa of the
N-terminal MyBP-C sequence. Bound antibody was visualized with
anti–rabbit-horseradish peroxidaseconjugate (Sigma) and
enhanced chemiluminescenceusing the instructions provided by
Amersham. Blots were exposed on Kodak X-AR5 film for between 0.5 to 10
minutes.
Statistical Analysis
The Kaplan-Meier survival curve for carriers of the mutation in
the MyBP-C mutation and its comparisons with published data for
-tropomyosin and ß-myosin heavy chain mutations were calculated
using the Prism scientific software program. Evaluation of probability
values was based on the Wilcoxon-rank test.
|
Acknowledgments |
|---|
We thank G. Kunst for samples of the reference myocardium. This work was supported by grants from Max-Planck-Gesellschaft (to J.A.M.), the Deutsche Forschungsgemeinschaft (grant 405/3-6 to M.G.), the Stifterverband für die deutsche Wissenschaft (to K.U., S.B., and H.-P.V.), by the BIOMED 2 program of the European Union (contract BHM4-CT 3876 to W.J.M. and H.-P.V.), and the British Heart Foundation (to W.J.M.).
|
Footnotes |
|---|
The Methods section of this article can be found at http://www.circulationaha.org
Correspondance to Professor Hans-Peter Vosberg, MD, Max-Planck-Institut für physiologische und klinische Forschung, Abteilung Experimentelle Kardiologie, Benekestr 2, D-61231 Bad Nauheim, Germany.
Received May 18, 1999; revision received October 7, 1999; accepted October 19, 1999.
|
References |
|---|
|
TopAbstractIntroductionResultsDiscussionMethodsReferences |
|---|
1. Maron BJ, Bonow RO, Cannon RO III, Leon MB, Epstein SE. Hypertrophic cardiomyopathy: interrelations of clinical manifestations, pathophysiology, and therapy (part 1). N Engl J Med. 1987;316:780–789.[Medline] [Order article via Infotrieve]
2. Malik MS, Watkins H. The molecular genetics of hypertrophic cardiomyopathy. Curr Opin Cardiol. 1997;12:295–302.[Medline] [Order article via Infotrieve]
3. Geisterfer-Lowrance AAT, Kass S, Tanigawa, G, Vosberg HP, McKenna W, Seidman CE, Seidman JG. A molecular basis for familial hypertrophic cardiomyopathy: a beta cardiac myosin heavy chain missense mutation. Cell. 1990;62:999–1006.[Medline] [Order article via Infotrieve]
4. Thierfelder L, Watkins H, MacRae C, Lamas R, McKenna W, Vosberg HP, Seidman JG, Seidman CE. Alpha-tropomyosin and cardiac troponin T mutations cause familial hypertrophic cardiomyopathy: a disease of the sarcomere. Cell. 1994;77:701–712.[Medline] [Order article via Infotrieve]
5. Carrier L, Bonne G, Bahrend E, Yu B, Richard P, Niel F, Hainque B, Cruaud C, Gary F, Labeit S, Bouhour JB, Dubourg O, Desnos M, Hagege AA, Trent RJ, Komajda M, Fiszman M, Schwartz K. Organization and sequence of human cardiac myosin binding protein C gene (MYBPC3) and identification of mutations predicted to produce truncated proteins in familial hypertrophic cardiomyopathy. Circ Res. 1997;80:427–434.
6. Poetter K, Jiang H, Hassanzadeh S, Master SR, Chang A, Dalakas MC, Rayment I, Sellers JR, Fananapazir L, Epstein ND. Mutations in either the essential or regulatory light chains of myosin are associated with a rare myopathy in human heart and skeletal muscle. Nat Genet. 1996;13:63–69.[Medline] [Order article via Infotrieve]
7. Kimura A, Harada H, Park JE, Nishi H, Satoh M, Takahashi M, Hiroi S, Sasaoka T, Ohbuchi N, Nakamura T, Koyanagi T, Hwang TH, Choo JA, Chung KS, Hasegawa A, Nagai R, Okazaki O, Nakamura H, Matsuzaki M, Sakamoto T, Toshima H, Koga Y, Imaizumi T, Sasazuki T. Mutations in the cardiac troponin I gene associated with hypertrophic cardiomyopathy. Nat Genet. 1997;16:379–382.[Medline] [Order article via Infotrieve]
8. Mogensen J, Klausen IC, Pedersen AK, Egeblad H, Bross P, Kruse TA, Gregersen N, Hansen PS, Baandrup U, Borglum AD. Alpha-cardiac actin is a novel disease gene in familial hypertrophic cardiomyopathy. J Clin Invest. 1999;103:R39–R43.
9. MacRae C, Ghaisas N, Kass S, Donnelly S, Basson CT, Watkins HC, Anan R, Thierfelder LH, McGarry K, Rowland E, McKenna WJ, Seidman JG, Seidman CE. Familial hypertrophic cardiomyopathy with Wolff-Parkinson-White syndrome maps to a locus on chromosome 7q3. J Clin Invest. 1995;96:1216–1220.
10.
Niimura H, Bachinski LL, Sangwatanaroj S, Watkins H,
Chudley AE, McKenna W, Kristinsson A, Roberts R, Sole M, Maron BJ,
Seidman JG, Seidman CE. Mutations in the gene for cardiac
myosin-binding protein C and late-onset familial hypertrophic
cardiomyopathy. N Engl J Med. 1998;338:1248–1257.
11. Freiburg A, Gautel M. A molecular map of the interactions between titin and myosin-binding protein C: implications for sarcomeric assembly in familial hypertrophic cardiomyopathy. Eur J Biochem. 1996;235:317–323.[Medline] [Order article via Infotrieve]
12. Obinata T, Reinach FC, Bader DM, Masaki T, Kitani S, Fischman DA. Immunochemical analysis of C-protein isoform transitions during the development of chicken skeletal muscle. Dev Biol. 1984;101:116–124.[Medline] [Order article via Infotrieve]
13.
Schultheiss T, Lin ZX, Lu MH, Murray J, Fischman DA,
Weber K, Masaki T, Imamura M, Holtzer H. Differential distribution of
subsets of myofibrillar proteins in cardiac nonstriated and striated
myofibrils. J Cell Biol. 1990;110:1159–1172.
14. Hartzell HC. Effects of phosphorylated and unphosphorylated C-protein on cardiac actomyosin ATPase. J Mol Biol. 1985;186:185–195.[Medline] [Order article via Infotrieve]
15. Bonne G, Carrier L, Bercovici J, Cruaud C, Richard P, Hainque B, Gautel M, Labeit S, James M, Beckmann J, Weissenbach J, Vosberg HP, Fiszman M, Komajda M, Schwartz K. Cardiac myosin binding protein-C gene splice acceptor site mutation is associated with familial hypertrophic cardiomyopathy. Nat Genet. 1995;11:438–440.[Medline] [Order article via Infotrieve]
16. Watkins H, Conner D, Thierfelder L, Jarcho JA, MacRae C, McKenna WJ, Maron BJ, Seidman JG, Seidman CE. Mutations in the cardiac myosin binding protein-C gene on chromosome 11 cause familial hypertrophic cardiomyopathy. Nat Genet. 1995;11:434–437.[Medline] [Order article via Infotrieve]
17. Rottbauer W, Gautel M, Zehelein J, Labeit S, Franz WM, Fischer C, Vollrath B, Mall G, Dietz R, Kübler W, Katus HA. Novel splice donor site mutation in the cardiac myosin-binding protein-C gene in familial hypertrophic cardiomyopathy: characterization of cardiac transcript and protein. J Clin Invest. 1997;100:475–482.[Medline] [Order article via Infotrieve]
18.
Moolman-Smooke JC, Mayosi B, Brink P, Corfield V.
Identification of a new missense mutation in MyBP-C associated with
hypertrophic cardiomyopathy. J Med
Genet. 1998;35:253–254.
19.
Yu B, French JA, Carrier L, Jeremy RW, McTaggart DR,
Nicholson MR, Hambly B, Semsarian C, Richmond DR, Schwartz K, Trent RJ.
Molecular pathology of familial hypertrophic
cardiomyopathy caused by mutations in the cardiac
myosin binding protein C gene. J Med Genet. 1998;35:205–210.
20. Gautel M, Zuffardi O, Freiburg A, Labeit S. Phosphorylation switches specific for the cardiac isoform of myosin binding protein-C: a modulator of cardiac contraction? EMBO J. 1995;14:1952–1960.[Medline] [Order article via Infotrieve]
21.
McKenna WJ, Spirito P, Dubourg O, Komajda M. Experience
from clinical genetics in hypertrophic
cardiomyopathy: proposal for a new
diagnostic criteria in adult members of affected families.
Heart. 1997;77:130–132.
22. Welsh MJ, Smith AE. Molecular mechanisms of CFTR chloride channel dysfunction in cystic fibrosis. Cell. 1993;73:1251–1254.[Medline] [Order article via Infotrieve]
23. Fulton AB, L’Ecuyer T. Cotranslational assembly of some cytoskeletal proteins: implications and prospects. J Cell Sci. 1993;105:867–871.[Medline] [Order article via Infotrieve]
24. Gruen M, Gautel M. Mutations in beta-myosin S2 that cause familial hypertrophic cardiomyopathy (FHC) abolish the interaction with the regulatory domain of myosin binding protein-C. J Mol Biol. 1999;286:933–949.[Medline] [Order article via Infotrieve]
25. Yang Q, Sanbe A, Osinska H, Hewett TE, Klevitsky R, Robbins J. A mouse model of myosin binding protein C human familial hypertrophic cardiomyopathy. J Clin Invest. 1998;102:1292–1300.[Medline] [Order article via Infotrieve]
26. Coviello DA, Maron BJ, Spirito P, Watkins H, Vosberg HP, Thierfelder L, Schoen FJ, Seidman JG, Seidman CE. Clinical features of hypertrophic cardiomyopathy caused by mutation of a "hot spot" in the alpha tropomyosin gene. J Am Coll Cardiol. 1997;29:635–640.[Abstract]
27. Watkins H, Rosenzweig A, Hwang DS, Levi T, McKenna W, Seidman CF, Seidman JG. Characteristics and prognostic implications of myosin missense mutations in familial hypertrophic cardiomyopathy. N Engl J Med. 1992;326:1108–1114.[Abstract]
28.
Charron P, Dubourg O, Desnos M, Isnard R, Hagege
A, Bonne G, Carrier L, Tesson F, Bonhour JB, Buzzi JC, Feingold J,
Schwartz K, Komajda M. Genotype-phenotype correlations
in familial hypertrophic cardiomyopathy: a
comparison between mutations in cardiac myosin binding protein-C and
beta myosin heavy chain genes. Eur Heart J. 1998;19:139–145.
29.
Watkins H, McKenna WJ, Thierfelder L, Suk HJ,
Anan R, O’Donoghue A, Spirito P, Matsumori A, Moravec CS, Seidman JG,
Seidman CE. Mutations in the genes for cardiac troponin T and
-tropomyosin in hypertrophic cardiomyopathy.
N Engl J Med. 1995;332:1058–1064.
30. Moolman JC, Corfield VA, Posen B, Ngumbela K, Seidman C, Brink PA, Watkins H. Sudden death due to troponin T mutations. J Am Coll Cardiol. 1997;29:549–555.[Abstract]
31.
Charron P, Dubourg O, Desnos M, Isnard R, Hagege A,
Millaire A, Carrier L, Bonne G, Tesson F, Richard P, Bouhour JB,
Schwartz K, Komajda M. Diagnostic value of
electrocardiography and
echocardiography for familial hypertrophic
cardiomyopathy in a genotyped adult
population. Circulation. 1997;96:214–219.
32.
Thierfelder L, MacRae C, Watkins H, Tomfohrde J,
Williams M, McKenna W, Bohm K, Noeske G, Schlepper M, Bowcock A,
Vosberg HP, Seidman JG, Seidman C. A familial hypertrophic
cardiomyopathy locus maps to chromosome 15q2.
Proc Natl Acad Sci U S A. 1993;90:6270–6274.
33. Watkins H, MacRae C, Thierfelder L, Chou YH, Frenneaux M, McKenna W, Seidman JG, Seidman CE. A disease locus for familial hypertrophic cardiomyopathy maps to chromosome 1q3. Nat Genet. 1993;3:333–337.[Medline] [Order article via Infotrieve]
34. Jeschke B, Uhl K, Weist B, Schröder D, Meitinger T, Döhlemann C, Vosberg HP. A high risk phenotype of hypertrophic cardiomyopathy associated with a compound genotype of two mutated beta-myosin heavy chain genes. Hum Genet. 1998;102:299–304.[Medline] [Order article via Infotrieve]
35.
Gautel M, Fürst DO, Cocco A, Schiaffino S.
Isoform transitions of the myosin-binding protein C family in
developing human and mouse muscles: lack of isoform
transcomplementation in cardiac muscle. Circ Res. 1998;82:124–129.
This article has been cited by other articles:
 |
|
 |
|
  L. Carrier, S. Schlossarek, M. S. Willis, and T. Eschenhagen Ubiquitin-proteasome system and nonsense-mediated mRNA decay in hypertrophic cardiomyopathy Cardiovasc Res, December 4, 2009; (2009) cvp247v3. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Mearini, C. Gedicke, S. Schlossarek, C. C. Witt, E. Kramer, P. Cao, M. D. Gomes, S. H. Lecker, S. Labeit, M. S. Willis, et al. Atrogin-1 and MuRF1 regulate cardiac MyBP-C levels via different mechanisms Cardiovasc Res, November 18, 2009; (2009) cvp348v2. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Marston, O. Copeland, A. Jacques, K. Livesey, V. Tsang, W. J. McKenna, S. Jalilzadeh, S. Carballo, C. Redwood, and H. Watkins Evidence From Human Myectomy Samples That MYBPC3 Mutations Cause Hypertrophic Cardiomyopathy Through Haploinsufficiency Circ. Res., July 31, 2009; 105(3): 219 - 222. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Vignier, S. Schlossarek, B. Fraysse, G. Mearini, E. Kramer, H. Pointu, N. Mougenot, J. Guiard, R. Reimer, H. Hohenberg, et al. Nonsense-Mediated mRNA Decay and Ubiquitin-Proteasome System Regulate Cardiac Myosin-Binding Protein C Mutant Levels in Cardiomyopathic Mice Circ. Res., July 31, 2009; 105(3): 239 - 248. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. L. Theis, J. M. Bos, J. D. Theis, D. V. Miller, J. A. Dearani, H. V. Schaff, B. J. Gersh, S. R. Ommen, R. L. Moss, and M. J. Ackerman Expression Patterns of Cardiac Myofilament Proteins: Genomic and Protein Analysis of Surgical Myectomy Tissue From Patients With Obstructive Hypertrophic Cardiomyopathy Circ Heart Fail, July 1, 2009; 2(4): 325 - 333. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. J. van Dijk, D. Dooijes, C. dos Remedios, M. Michels, J. M.J. Lamers, S. Winegrad, S. Schlossarek, L. Carrier, F. J. ten Cate, G. J.M. Stienen, et al. Cardiac Myosin-Binding Protein C Mutations and Hypertrophic Cardiomyopathy: Haploinsufficiency, Deranged Phosphorylation, and Cardiomyocyte Dysfunction Circulation, March 24, 2009; 119(11): 1473 - 1483. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Pohlmann, I. Kroger, N. Vignier, S. Schlossarek, E. Kramer, C. Coirault, K. R. Sultan, A. El-Armouche, S. Winegrad, T. Eschenhagen, et al. Cardiac Myosin-Binding Protein C Is Required for Complete Relaxation in Intact Myocytes Circ. Res., October 26, 2007; 101(9): 928 - 938. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Kubo, J. R. Gimeno, A. Bahl, U. Steffensen, M. Steffensen, E. Osman, R. Thaman, J. Mogensen, P. M. Elliott, Y. Doi, et al. Prevalence, Clinical Significance, and Genetic Basis of Hypertrophic Cardiomyopathy With Restrictive Phenotype J. Am. Coll. Cardiol., June 26, 2007; 49(25): 2419 - 2426. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R H Lekanne Deprez, J J Muurling-Vlietman, J Hruda, M J H Baars, L C D Wijnaendts, I Stolte-Dijkstra, M Alders, and J M van Hagen Two cases of severe neonatal hypertrophic cardiomyopathy caused by compound heterozygous mutations in the MYBPC3 gene J. Med. Genet., October 1, 2006; 43(10): 829 - 832. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Zolk, C. Schenke, and A. Sarikas The ubiquitin-proteasome system: Focus on the heart Cardiovasc Res, June 1, 2006; 70(3): 410 - 421. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. M. Meurs, X. Sanchez, R. M. David, N. E. Bowles, J. A. Towbin, P. J. Reiser, J. A. Kittleson, M. J. Munro, K. Dryburgh, K. A. MacDonald, et al. A cardiac myosin binding protein C mutation in the Maine Coon cat with familial hypertrophic cardiomyopathy Hum. Mol. Genet., December 1, 2005; 14(23): 3587 - 3593. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Kubo, H. Kitaoka, M. Okawa, Y. Matsumura, N. Hitomi, N. Yamasaki, T. Furuno, J. Takata, M. Nishinaga, A. Kimura, et al. Lifelong Left Ventricular Remodeling of Hypertrophic Cardiomyopathy Caused by a Founder Frameshift Deletion Mutation in the Cardiac Myosin-Binding Protein C Gene Among Japanese J. Am. Coll. Cardiol., November 1, 2005; 46(9): 1737 - 1743. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H.-P. Vosberg The ubiquitin-proteasome system may be involved in the pathogenesis of hypertrophic cardiomyopathy Cardiovasc Res, April 1, 2005; 66(1): 1 - 3. [Full Text] [PDF]
|
|
|
|
|
|
A. Sarikas, L. Carrier, C. Schenke, D. Doll, J. Flavigny, K. S. Lindenberg, T. Eschenhagen, and O. Zolk Impairment of the ubiquitin-proteasome system by truncated cardiac myosin binding protein C mutants Cardiovasc Res, April 1, 2005; 66(1): 33 - 44. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. P. Harris, E. Rostkova, M. Gautel, and R. L. Moss Binding of Myosin Binding Protein-C to Myosin Subfragment S2 Affects Contractility Independent of a Tether Mechanism Circ. Res., October 29, 2004; 95(9): 930 - 936. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Carrier, R. Knoll, N. Vignier, D. I Keller, P. Bausero, B. Prudhon, R. Isnard, M.-L. Ambroisine, M. Fiszman, J. Ross Jr., et al. Asymmetric septal hypertrophy in heterozygous cMyBP-C null mice Cardiovasc Res, August 1, 2004; 63(2): 293 - 304. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. M. Palmer, D. Georgakopoulos, P. M. Janssen, Y. Wang, N. R. Alpert, D. F. Belardi, S. P. Harris, R. L. Moss, P. G. Burgon, C. E. Seidman, et al. Role of Cardiac Myosin Binding Protein C in Sustaining Left Ventricular Systolic Stiffening Circ. Res., May 14, 2004; 94(9): 1249 - 1255. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Flavigny, P. Robert, J.-C. Camelin, K. Schwartz, L. Carrier, and I. Berrebi-Bertrand Biomolecular interactions between human recombinant {beta}-MyHC and cMyBP-Cs implicated in familial hypertrophic cardiomyopathy Cardiovasc Res, November 1, 2003; 60(2): 388 - 396. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Alders, R. Jongbloed, W. Deelen, A. van den Wijngaard, P. Doevendans, F. Ten Cate, V. Regitz-Zagrosek, H.-P. Vosberg, I. van Langen, A. Wilde, et al. The 2373insG mutation in the MYBPC3 gene is a founder mutation, which accounts for nearly one-fourth of the HCM cases in the Netherlands Eur. Heart J., October 2, 2003; 24(20): 1848 - 1853. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Konno, M. Shimizu, H. Ino, T. Matsuyama, M. Yamaguchi, H. Terai, K. Hayashi, T. Mabuchi, M. Kiyama, K. Sakata, et al. A novel missense mutation in the myosin binding protein-C gene is responsible for hypertrophic cardiomyopathy with left ventricular dysfunction and dilation in elderly patients J. Am. Coll. Cardiol., March 5, 2003; 41(5): 781 - 786. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Frustaci, M. Pieroni, and C. Chimenti Late-onset primary LVH HCM versus cardiac fabry variant J. Am. Coll. Cardiol., April 17, 2002; 39(8): 1405 - 1406. [Full Text] [PDF]
|
|
|
|
|
|
S. P. Harris, C. R. Bartley, T. A. Hacker, K. S. McDonald, P. S. Douglas, M. L. Greaser, P. A. Powers, and R. L. Moss Hypertrophic Cardiomyopathy in Cardiac Myosin Binding Protein-C Knockout Mice Circ. Res., March 22, 2002; 90(5): 594 - 601. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J R Ortlepp, H P Vosberg, S Reith, F Ohme, N G Mahon, D Schroder, H G Klues, P Hanrath, and W J McKenna Genetic polymorphisms in the renin-angiotensin-aldosterone system associated with expression of left ventricular hypertrophy in hypertrophic cardiomyopathy: a study of five polymorphic genes in a family with a disease causing mutation in the myosin binding protein C gene Heart, March 1, 2002; 87(3): 270 - 275. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Erdmann, J.o. Raible, J. Maki-Abadi, M. Hummel, J. Hammann, B. Wollnik, E. Frantz, E. Fleck, R. Hetzer, and V. Regitz-Zagrosek Spectrum of clinical phenotypes and gene variants in cardiac myosin-binding protein C mutation carriers with hypertrophic cardiomyopathy J. Am. Coll. Cardiol., August 1, 2001; 38(2): 322 - 330. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. P. Harris, C. R. Bartley, T. A. Hacker, K. S. McDonald, P. S. Douglas, M. L. Greaser, P. A. Powers, and R. L. Moss Hypertrophic Cardiomyopathy in Cardiac Myosin Binding Protein-C Knockout Mice Circ. Res., March 22, 2002; 90(5): 594 - 601. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||