Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 2000;101:1792-1798

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hodges, Y. K.
Right arrow Articles by Horwitz, L. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hodges, Y. K.
Right arrow Articles by Horwitz, L. D.
Related Collections
Right arrow Other Vascular biology

(Circulation. 2000;101:1792.)
© 2000 American Heart Association, Inc.


Clinical Investigation and Reports

Estrogen Receptors {alpha} and ß

Prevalence of Estrogen Receptor ß mRNA in Human Vascular Smooth Muscle and Transcriptional Effects

Yvonne K. Hodges, PhD; Lin Tung, MS; Xiang-Dong Yan, MS; J. Dinny Graham, PhD; Kathryn B. Horwitz, PhD; Lawrence D. Horwitz, MD

From the Divisions of Cardiology (Y.K.H., X.-D.Y., L.D.H.) and Endocrinology (L.T., J.D.G., K.B.H.), Department of Medicine, University of Colorado Health Sciences Center, Denver, Colo.

Correspondence to Lawrence D. Horwitz, MD, Cardiology B130, University of Colorado Health Sciences Center, Denver, CO 80262. E-mail lawrence.horowitz{at}UCHSC.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background—Estrogens have vascular effects through the activation of estrogen receptors (ERs). In addition to ER{alpha}, the first ER to be cloned, a second subtype called ERß has recently been discovered.

Methods and Results—Using a reverse-transcriptase polymerase chain reaction assay that employs the same primer pair to simultaneously amplify ER{alpha} and ERß transcripts, we found that ERß is the ER form that is predominantly expressed in human vascular smooth muscle, particularly in women. The transcriptional effects of the 2 ERs in transfected HeLa cells differed. In response to 17ß-estradiol, ER{alpha} is a stronger transactivator than ERß at low receptor concentrations. However, at higher receptor concentrations, ER{alpha} activity self-squelches, and ERß is a stronger transactivator. Tamoxifen has partial agonist effects with ER{alpha} but not with ERß.

Conclusions—The protective effects of estrogens in the cardiovascular system of women may be due to the genomic effects of ERß in vascular tissue.


Key Words: muscle, smooth • receptors, estrogen • coronary disease • human


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Premenopausal women with normal estrogen levels rarely manifest coronary disease. In addition, the administration of exogenous estrogens to healthy postmenopausal women markedly reduces the incidence of coronary events.1 However, the mechanisms underlying this benefit are unknown. The modest cholesterol-lowering effect of estrogens does not explain their substantial protective effects.2 An alternative hypothesis is that estrogens protect against coronary heart disease through genomic mechanisms in the vascular bed. Estrogens inhibit the growth of vascular smooth muscle (VSM), which characterizes obstructive atherosclerotic lesions.3 4 Functional estrogen receptors (ERs) are present in VSM.5

The structure of ER{alpha} was elucidated in 1987.6 A second ER cDNA, designated ERß, was cloned in l996.7 8 The 2 ERs have a similar affinity for 17ß-estradiol, and they bind to the same estrogen response elements (EREs).9 However, ERß differs from ER{alpha} in 2 important functional domains. First, the N-terminus containing the AF-1 (activation function-1) activation domain of ERß has only 30% homology with that of ER{alpha}.7 8 This domain is critical to the partial agonist properties of some antiestrogens, and it may be involved in tissue specificity.10 Second, the hormone-binding domains (HBD) of ER{alpha} and ERß have only 53% homology.7 8

Why estrogens enhance the proliferation of breast or uterine cells but inhibit the proliferation of VSM cells is an enigma. One possible explanation for this heterogeneity of estrogen action is that the vascular bed expresses structurally and functionally different ERs than the breast or uterus. ER{alpha} is the predominant receptor in the breast and uterus.11 However, because estrogens inhibit VSM proliferation in response to vascular injury in knockout mice that lack ER{alpha},12 ER{alpha} is not essential to estrogen action in the vascular wall. Cynomolgus monkeys express both ER{alpha} and ERß mRNA in coronary artery and cultured aortic smooth muscle cells.13 No information about the distribution of wild-type ERs in human VSM exists.

This study had 2 goals: to describe the relative expression of ER{alpha} and ERß transcripts in VSM and to elucidate whether differences exist in the transcriptional activation and function of ER{alpha} and ERß.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
RNA Isolation and RT-PCR
VSM tissue from the human coronary artery, iliac artery, aorta, or saphenous vein was cultured for 72 hours and then frozen at -80°C, as described previously.14 Total RNA was isolated with TriReagent (Sigma).

RNA (0.5 to 1.0 µg) was heated to 70°C for 5 minutes, and 125 U of MuLV RT was added. Using the random hexamer oligo primer supplied in a GeneAmp RNA PCR kit (Perkin Elmer), an RT reaction was performed at 42°C for 60 minutes. After dilution of the RT cDNA product, PCR was performed with the following thermal cycles: 1 cycle at 94°C for 1 minute, followed by 35 cycles at 94°C for 15 s, 55°C for 25 s, and 72°C for 30 s, and 1 final extension cycle at 72°C for 7 minutes. Products were resolved on an 8% polyacrylamide gel in 1x Tris-borate/EDTA buffer (0.09 mol/L Tris-borate and 0.002 mol/L EDTA, pH 8.0).

Primers
To simultaneously amplify ER{alpha} and ERß in the same PCR reaction, oligonucleotide primers were designed for PCR amplification of specific DNA fragments contained in both ER{alpha} and ERß (Figure 1Down). The forward primer sequence, ERF2, was AAGAGCTGCCAGGCCTGCCG, and the reverse primer sequence, ERR1, was GCCCAG-CTGATCATGTGAACCA. There was one mismatch in ERR1 for both ERß (AT mismatch) and ER{alpha} (AG mismatch). The primer ERR1 had similar stability on both templates. The primer pair ERF2 and ERR1 generated a 382-bp fragment for ER{alpha} and a 346-bp fragment for ERß. These primers were tested on ER{alpha} and ERß cDNA plasmid clones to ensure that they generated the specific products targeted, with equivalent efficiency under the same amplification conditions.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 1. Design of primers for simultaneous PCR amplification of ER{alpha} and ERß transcripts. A, Schematic of location of primers relative to protein structures of ER{alpha} and ERß. The combined ER{alpha}/ERß primer set, ERF2/ERR1, amplifies a cDNA segment (black arrows) that encodes the DBD and the hinge (D) regions. The ER{alpha} and ERß specific primers ERAF1/ERAR1 and ERBF1/ERBR1 amplify a large cDNA fragment (open arrows) that lies between the N-terminal (A/B) and the HBD (F) regions of each. B, PCR of plasmids containing ER{alpha} or ERß cDNAs using combined primer set. Lanes 1 through 3 contain molar ratios of ER{alpha} to ERß plasmid DNA of 1:3, 1:1, and 1:2. Lane 4 is a negative control with no DNA. Lanes 5 and 6 contain ER{alpha} and ERß plasmids, respectively. PCR products were separated on an 8% polyacrylamide gel and stained with ethidium bromide. The specific 382-bp fragment for ER{alpha} and the 346-bp fragment for ERß are indicated.

Primers specific for ER{alpha} or ERß only, but capable of distinguishing the wild-type from the variant forms of each, were also designed. The ER{alpha}-specific primers, a forward primer ERAF1 (GTCTCCGAGCCCGCTGATGCTACTGCAC) and a reverse primer ERAR1 (CGGATGCCCCTCCACGGCTAGTGG), generated a 1372-bp fragment. The ERß-specific primers, forward primer ERBF1 (CGTGATGGAGGACTTGCACCCGCGAAGCAC) and reverse primer ERBR1 (TCCCTGGTGTGAAGCAAGTATCG-CTAGAACA), generated a 1212-bp fragment.

Plasmids
Wild-type human ER{alpha} expression vector was provided by Dr Pierre Chambon (Strasbourg, France). The human ERß Bluescript KS construct was provided by Drs Eva Enmark and Jan-Ake Gustafsson (Stockholm, Sweden). The 1460-bp ERß insert was recloned into the pSG5 expression vector (Stratagene) to generate pSG5-hER. The reporter plasmids were VIT-tk-CAT15 and ERE2-TATAtk-CAT.16

Transfection and Reporter Assays
Transfection experiments used 10 ng of human ER{alpha} expression vector or ERß plasmid, 2 µg of ERE2-TATAtk-CAT or VIT-tk-CAT reporter, 3 µg of the ß-galactosidase expression plasmid pCH-110 (Amersham Pharmacia Biotechnology) to correct for transfection efficiency, and 15 µg of Bluescribe carrier plasmid, for a total of 20 µg of DNA/plate.16 Cells were treated for 24 hours with 10 nmol/L 17ß-estradiol and/or 100 nmol/L tamoxifen or ICI 182,780 (ICI Pharmaceuticals). Cell lysates were analyzed for CAT activity, as previously described,16 with chloramphenicol acetylation measured by thin-layer chromatography and quantified by phosphorimaging (Molecular Dynamics).

Statistical Analysis
Statistical analysis was performed with SAS software (SAS Institute). The 2-tailed significance level was 0.05. Independent groups were compared using the unpaired t test, and dose response was assessed by linear regression.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Distribution of ER{alpha} and ERß Transcripts in Human VSM
To investigate the relative levels of ER{alpha} and ERß expression in human VSM, we designed primers that coamplified different transcript fragment lengths for each subtype in the same polymerase chain reaction (PCR). The combined ER{alpha}/ß primer set (ERF2/ERR1; see Methods for a complete description) amplifies both a region of the cDNA encoding the DNA binding domain (DBD) and the hinge region of the 2 receptors that has a gap in ERß when compared with the ER{alpha} sequence (Figure 1AUp). A 382-bp product was generated from the cDNA encoding ER{alpha}, and a 346-bp product from the cDNA encoding ERß. Equal efficiency of the PCR amplification reactions was confirmed using control plasmid DNA containing the recombinant cDNA of ER{alpha} or ERß in molar ratios of 1:3 (Figure 1BUp, lane 1), 1:1 (lane 2), and 1:2 (lane 3). Therefore, it was possible to simultaneously measure the relative reverse-transcriptase (RT) PCR product amount for each ER subtype, despite the exponential nature of PCR and the minimal variations in template sequences and reaction efficiencies.

ER{alpha} and ERß RT-PCR products (determined using the combined ER{alpha} primer sets) in VSM from 12 patients are shown in Figure 2ADown. Although both ER{alpha} and ERß transcripts were present in all samples, some subsets expressed considerably more ERß than ER{alpha}. The values of ERß, expressed as a percentage of total ER, in samples of VSM from 8 male and 12 female subjects, are shown in the TableDown. ERß was more prevalent in the VSM from female subjects (67±12%) than in those from male subjects (51±15%; P=0.02). ERß did not correlate with age in either sex.



View larger version (39K):
[in this window]
[in a new window]
 
Figure 2. ER{alpha} to ERß ratios: wild-type (Wt) ERß expression predominates. A, Total RNA in VSM from 12 patients was reverse-transcribed into cDNA. RT-PCR using combined ER{alpha}/ERß primer set was performed on cDNA, and reaction products were loaded on an 8% polyacrylamide gel. Human ER{alpha} expression vector and ERß plasmids were positive controls, and reaction mixtures lacking RT were negative controls (not shown). The 382-bp fragments amplified from ER{alpha} and the 346-bp fragments amplified from ERß are present in all samples, although the ERß band in lane 6 is extremely faint. Lanes 3 through 6 were samples from male subjects, and lanes 1, 2, and 7 through 12 were samples from female subjects. B, Independent primers for ER{alpha} or ERß were used to amplify the cDNA reverse-transcribed from the RNA of a female patient. Reaction products were resolved on an agarose gel and stained with ethidium bromide. The 1372-bp ER{alpha} and 1212-bp ERß amplified DNA fragments expected from the wild-type receptors are denoted by the open arrows, and the shorter splice variants by solid arrows. A single ERß splice variant and several ER{alpha} splice variants are present.


View this table:
[in this window]
[in a new window]
 
Table 1. Percentage of ERs That are ERß in Women and Men

To determine if exposure to estrogens could alter the ER{alpha}/ERß ratio, samples of VSM from 8 male and 12 female patients were treated for 72 hours with 17ß-estradiol or vehicle. No consistent differences existed in the subtype ratios between estrogen-treated sets and controls. Studies of samples from 3 patients found no differences in ER ratios between tissue immediately frozen when obtained and tissue incubated for 72 hours in medium (data not shown).

The combined primer set quantifies relative amounts of each subtype, but it cannot discriminate between wild-type, full-length ER{alpha} or ERß and HBD deletion variants of these subtypes. ER{alpha} variants are common in VSM.14 Therefore, we also used primers designed to amplify longer lengths of either ER{alpha} or ERß specifically (Figure 1AUp). These included ERAF1/ERAR1 for ER{alpha} and ERBF1/ERBR1 for ERß, which included the N-terminus, DBD, hinge region, and HBD (Figure 2BUp). The specific primers were tested using plasmid DNA containing ER{alpha} or ERß to confirm that the PCR generated full-length products (data not shown). The major transcript encoding ERß of the sample shown in Figure 2BUp is full-length (open arrow), although a small band representing a lower molecular weight variant (solid arrow) can be discerned. However, the ER{alpha} transcripts are present predominantly as variant forms (solid arrows): there is little full-length, wild-type ER{alpha} present (open arrow). Similar results were obtained in the other 19 samples of VSM (data not shown). Therefore, the results with the combined ER{alpha}/ERß primer set underestimate the ratio of wild-type ERß to wild-type ER{alpha} transcripts.

Transcription by ER{alpha} and ERß: Promoter and Ligand Specificity
To examine differences in promoter specificity between ER{alpha} and ERß, ER-negative HeLa cells were cotransfected with either the ERE2-TATAtk-CAT (Figure 3ADown) or vitellogenin (VIT-tk-CAT) (Figure 3BDown) promoter/reporter constructs, as well as increasing concentrations (1 to 100 ng) of ER{alpha} or ERß expression vectors. The cells were treated with vehicle or 10 nmol/L 17ß-estradiol. The chloramphenicol transferase (CAT) transcription driven by each promoter was measured. Substantial estradiol-induced transcription occurred in cells with low levels of ER{alpha}; however, as the receptor concentration increased, transcription decreased due to a phenomenon called "self-squelching." The mechanism underlying self-squelching is unknown, but a similar effect of the progesterone receptor A-isoform requires an intact HBD.17 Unlike ER{alpha}, ERß had no transcriptional activity with ERE2-TATAtk-CAT (Figure 3ADown). With VIT-tk-CAT, estradiol induced similar transcriptional activity in ERß and ER{alpha} at low concentrations (1 and 5 ng cDNA; Figure 3BDown). However, at higher receptor concentrations, because ERß did not self-squelch, it was a more potent transactivator than ER{alpha}. The ERE2-TATAtk-CAT promoter construct contains 2 consecutive, synthetic EREs upstream of a minimal thymidine kinase promoter linked to the CAT gene.16 The VIT-tk-CAT promoter contains 2 repeats of the ERE found in the vitellogenin A1 gene promoter.15 Differences in the EREs and flanking sequences probably account for the differences in promoter recognition by the 2 ERs. Specifically, the VIT-tk-CAT promoter has several potential AP-1 sites that could modulate transcriptional activation by the 2 ERs.18 Such differences in specific gene transcription between the 2 receptors may underlie the variation in responses to 17ß-estradiol observed in different tissues, including VSM.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 3. ERß has different promoter transactivation effects than ER{alpha}, and it does not self-squelch. HeLa cells were cotransfected with expression vectors (1 to 100 ng) encoding ER{alpha} or ERß and either ERE2-TATAtk-CAT (A) or VIT-tk-CAT (B) reporters. Cells were treated with 10 nmol/L 17ß-estradiol, and CAT activity was measured by thin-layer chromatography using cell lysates that were normalized to ß-galactosidase activity. An empty vector lacking ER was used to evaluate background transcription, which was subtracted.

To further analyze possible differences in the transcriptional activities of ER{alpha} and ERß, we studied the differential effects of antiestrogens. Some antiestrogens possess partial agonist activity (ie, tamoxifen), and others are pure antagonists (ie, ICI 182,780). HeLa cells were cotransfected with ER{alpha} or ERß and with the reporters ERE2-TATAtk-CAT (Figure 4ADown) or VIT-tk-CAT (Figure 4BDown). The transfected cells were treated with 17ß-estradiol, tamoxifen, or ICI 182,780, either alone or in combination. Compared with 17ß-estradiol, tamoxifen is a partial agonist on the ERE2-TATAtk-CAT reporter when bound to ER{alpha}; under these conditions, tamoxifen did not suppress the agonist effects of 17ß-estradiol (Figure 4ADown). ICI 182,780 had no agonist effect on this promoter and strongly suppressed the transcription induced by 17ß-estradiol. ERß did not induce the transcription of ERE2-TATAtk-CAT with any ligand (Figure 4ADown).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 4. Tamoxifen lacks partial agonist activity on ERß. HeLa cells were cotransfected with 2 µg of ERE2-TATAtk-CAT (A) or 2 µg of VIT-tk-CAT (B) and 10 ng of ER{alpha} or ERß. Cells were then treated with 17ß-estradiol (10 nmol/L), tamoxifen (100 nmol/L), or ICI 182,780 (100 nmol/L). CAT activity levels (mean±SD) represent 3 independent experiments, each done in duplicate.

Tamoxifen is also an agonist in the presence of ER{alpha} on the VIT-tk-CAT reporter (Figure 4BUp). Again, ICI 182,780 is a pure antagonist. When bound to ERß with VIT-tk-CAT, tamoxifen lacked partial agonist activity and, unlike ICI 182,780, it did not suppress the agonist effects of 17ß-estradiol.

L7/SPA is a novel transcriptional coactivator that enhances the partial agonist effect of tamoxifen but has no effect on transactivation by estrogens or pure antagonists.19 To determine whether any ERß-mediated latent partial agonist activity by tamoxifen could be exposed, this antiestrogen was tested on both ER subtypes in the presence of an L7/SPA expression vector using the VIT-tk-CAT reporter (Figure 5Down). Coexpression of L7/SPA increased the partial agonist effects of tamoxifen on ER{alpha} to levels that exceeded those obtained with 17ß-estradiol. However, even in the presence of L7/SPA, no agonist effects of tamoxifen were detectable in cells transfected with ERß constructs. Thus, a fundamental difference exists in the 2 ERs with respect to the actions of antiestrogens.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 5. The antagonist-specific coactivator L7/SPA cannot activate transcription by tamoxifen-occupied ERß. HeLa cells were cotransfected with 2 µg of VIT-tk-CAT reporter and 10 ng of ER{alpha} or ERß expression vectors, with or without expression vector for L7/SPA. Cells were then treated with 100 nmol/L tamoxifen or 10 nmol/L 17ß-estradiol. CAT activity levels (mean±SD) represent 2 independent experiments, each done in duplicate.

Effect of ERß on Transcriptional Effects of ER{alpha}
Because ER{alpha} and ERß are coexpressed in VSM, it is important to determine whether the presence of one ER subtype can modify the transcriptional effects of the other. We examined the effect of ERß on ER{alpha}-controlled transcription of the VIT-tk-CAT reporter in cells treated with tamoxifen (Figure 6Down). A 5-fold molar excess of ERß substantially reduced the agonist effect of tamoxifen on ER{alpha} (P=0.005 for linear dose response and P=0.02 for dose of 0 versus 2.5). Therefore, at least one transcriptional effect of ER{alpha} can be inhibited by the presence of ERß.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 6. Partial agonist activity of tamoxifen on ER{alpha} is suppressed by ERß. HeLa cells were transfected with 0.5 ng of ER{alpha} and VIT-tk-CAT promoter/reporter. ERß expression vector was cotransfected in amounts of 0.0, 0.5, and 2.5 ng. Cells were then treated with tamoxifen (100 nmol/L). CAT activity levels (mean±SD) represent 3 independent experiments, each done in duplicate.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
Considerable clinical information has supported the notion that estrogens protect against atherosclerosis, particularly coronary artery disease. Atherosclerotic-mediated events are rare in premenopausal women, and exogenous estrogen reduces their incidence in healthy postmenopausal women.1 However, in the Heart and Estrogen-progestin Replacement Study (HERS),20 a randomized, placebo-controlled protocol in postmenopausal women with preexisting coronary artery disease, treatment with 0.625 mg of conjugated equine estrogens with 2.5 mg of medroxyprogesterone acetate failed to reduce coronary events and increased thromboembolic events. Although it is possible that the large body of previous evidence showing that estrogens protect the vascular bed is incorrect, other explanations for the findings in the HERS study deserve consideration. (1) In light of the increase in thromboembolic events in the HERS study, an increased tendency to thrombosis due to the hormone therapy may have offset the beneficial effects in the vascular wall. (2) Evidence from animal studies indicates that concomitant administration of the progestin medroxyprogesterone acetate may have adverse vascular effects that oppose the protective effects of estrogens.21 22

Although the relationship between estrogens and vascular disease is poorly understood, evidence exists that estrogens have genomic effects on the vascular wall, which is probably mediated through ERs. These effects include the inhibition of VSM growth and migration in vitro and the inhibition of arterial intimal hyperplasia in vivo.3 4 Without dietary manipulation or vascular trauma, ovarian ablation in sheep induces aortic intimal hyperplasia, which can be prevented by the administration of an estrogen.23

A seeming paradox of estrogenic effects is the observation of growth inhibition in the vascular bed but growth stimulation in other target organs, such as the breast and uterus. Our demonstration that the newly discovered ERß subtype is the most prevalent receptor mRNA in human VSM offers a possible explanation for the important differences in the effects of estrogens on the vascular bed compared with other organs. We offer evidence that ERß differs in its transcriptional activation and effects from ER{alpha}, which is the most prevalent receptor in the breast and uterus.11 We propose that the physiological effects of estrogens or antiestrogens in a tissue depend to a considerable extent on the type of ER expressed in that tissue.

ERß is the Prevalent Wild-Type ER mRNA in Human VSM
Because reliable monoclonal antibodies for human ERß are not commercially available, we used RT-PCR to quantify transcript expression for both ER{alpha} and ERß in human VSM. Our method allows the cDNA encoding each subtype to be amplified in the same reaction tube. Because the amplified products differ in size, they can be distinguished from one another on electrophoretic gels, and the relative percentage of each ER subtype in a sample can be quantified. Because this method cannot distinguish between wild-type and exon-deletion variants of ER{alpha} and ERß, we also performed separate PCR reactions using primers that recognized longer transcripts specific for either ER{alpha} or ERß.

We demonstrated that although both ERß and ER{alpha} mRNA were present in all 20 subjects we studied, the more prevalent wild-type receptor mRNA was ERß. In women, ERß was present in higher quantities in most samples, and in men, ERß and ER{alpha} were present in approximately equal quantities. Qualitative analysis of the mRNAs with specific primers demonstrated that ERß was encoded primarily by full-length transcripts, but ER{alpha} transcripts included substantial amounts of putative exon-deletion variants.

The importance of variant ER messages due to exon deletions is unclear. In cells transfected with variants of ER{alpha}, stimulation with estrogens could result in anomalous transcriptional activities that dominantly inhibit or enhance the effects of wild-type ER{alpha}.14 24 25 There has been no confirmation that the ER{alpha} variant transcripts are translated into proteins in vivo. Thus, ER{alpha} exon-deletion variants may have no physiological effects. If so, the wild-type receptors would determine the estrogenic effects in VSM, and ERß would be the major receptor subtype mediating transcription.

Potential Influence of Differences in Structure of ER{alpha} and ERß on Function
Human ERß differs significantly from ER{alpha} at the N-terminus (including the AF-1 region), the hinge region, and the HBD (including differences in the AF-2 region and F domain at the far C-terminus; Figure 1Up). Although the functional domains of ERß have not yet been delineated, these structural differences probably account for differences in transcriptional activities. The AF-1 region of ER{alpha} is responsible for the partial agonist effects of tamoxifen,10 26 and we found that tamoxifen lacks partial agonist activity on ERß. Structural differences between the 2 subtypes in the AF-2 region and the F domain may also contribute to the differing effects of antiestrogens on the 2 receptors. In crystallographic analyses, the F domain generates an {alpha}-helix (helix 12), whose appropriate folding over the surface of the ligand-activated HBD is critical in imparting agonist versus antagonist information to the transcriptional machinery.27 28 The amino acid composition of the ERß F domain differs considerably from that of ER{alpha}.7 8

Our data also allowed us to deduce important functional information about the hinge region between the DBD and HBD. We recently isolated a transcriptional coactivator (termed L7/SPA) that binds to the hinge region of ER{alpha} and enhances the agonist activity of antiestrogens, such as tamoxifen.19 Thus, the hinge region may be an important site for protein-protein interactions. Because tamoxifen-occupied ERß is not influenced by L7/SPA (Figure 5Up), the ERß hinge region functions differently from that of ER{alpha}, which has only 19% homology with ERß.

Possible Functional Significance of the Prevalence of ERß in VSM
Although low levels of wild-type ER{alpha} induce strong estrogenic responses, self-squelching limits transcriptional activity at higher receptor levels. Because ERß does not self-squelch, at high concentrations, ERß is a more potent transactivator than ER{alpha}. Cotransfection of ERß did not suppress estradiol-induced, ER{alpha}-dependent transcription (data not shown).

However, tamoxifen bound to ERß suppressed the agonist effects of tamoxifen-occupied ER{alpha}. Complicating any analysis is the observation that the inhibitory potency of antagonists and their agonist effects are dependent on promoter context and cell-type specificity.29 We found that with ER{alpha}, tamoxifen had partial agonist effects on the ERE2-TATAtk-CAT promoter but not on the VIT-tk-CAT promoter. Tamoxifen-occupied ERß lacks agonist effects on both promoters. Nevertheless, tamoxifen-occupied ERß can have agonist effects on some promoters containing AP-1 sites.18

Potential Clinical Importance of ERß Activation in VSM
Inhibition by estrogens of VSM growth in vitro can be prevented by the antiestrogen ICI 182,780 and by actinomycin D, an inhibitor of transcription.4 This observation supports the hypothesis that the effects of estrogens in VSM are primarily mediated through classic ER-dependent transcriptional mechanisms. Interestingly, in ER{alpha}-deficient mice (ERKO), estrogens inhibit VSM proliferation in response to vascular injury.12 Because ERß is expressed in the vasculature of these mice, this receptor subtype seems to be sufficient for mediating the antiproliferative effects of estrogens.

If, as we propose, the predominant ER in a tissue determines the local physiological effects of estrogens, the clinical implications of the high prevalence of ERß in the vascular bed are considerable. The differential effects of ERß activation in the vascular bed offer an attractive hypothesis to explain why estrogens are inhibitory in this tissue but stimulatory in others.


*    Acknowledgments
 
This work was supported by grants HL55291, HL57144, CA26860, and DK58238 from the National Institutes of Health. We thank Dr A.D. Robertson for performing the statistical analysis.

Received August 30, 1999; revision received November 4, 1999; accepted November 15, 1999.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Stampfer MJ, Colditz GA. Estrogen replacement therapy and coronary heart disease: a quantitative assessment of the epidemiologic evidence. Prev Med. 1991;20:47–63.[Medline] [Order article via Infotrieve]

2. Skafar DF, Xu R, Ram J, Sowers JR. Female sex hormones and cardiovascular disease in women. J Clin Endocrinol Metab. 1997;82:3913–3918.[Abstract/Free Full Text]

3. Chen S, Li H, Durand J, Oparil S, Chen Y-F. Estrogen reduces myointimal proliferation after balloon injury of rat carotid artery. Circulation. 1996;93:577–84.[Abstract/Free Full Text]

4. Kolodgie FD, Jacob A, Wilson PS, Carlson GC, Frab A, Verma A, Virmani R. Estradiol attenuates directed migration of vascular smooth muscle cells in vitro. Am J Pathol. 1996;148:969–976.[Abstract]

5. Horwitz KB, Horwitz LD. Canine vascular tissues are targets for androgens, estrogens, progestins, and glucocorticoids. J Clin Invest. 1982;69:750–758.

6. Kumar V, Green S, Sftack G, Berry M, Jinn J, Chambon P. Functional domains of the human estrogen receptor. Cell. 1987;51:941–945.[Medline] [Order article via Infotrieve]

7. Kuiper GGJM, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson JA. Cloning of a novel estrogen receptor expressed in rat prostate and ovary. Proc Nat Acad Sci U S A. 1996;93:5925–5930.[Abstract/Free Full Text]

8. Mosselman S, Polman J, Dijkema R. ERß: identification and characterization of a novel human estrogen receptor. FEBS Lett. 1996;392:49–53.[Medline] [Order article via Infotrieve]

9. Pace P, Taylor J, Suntharalingam S, Coombes RC, Ali S. Human estrogen receptor beta binds DNA in a manner similar to and dimerizes with estrogen receptor alpha. J Biol Chem. 1997;272:25832–25838.[Abstract/Free Full Text]

10. McInerney EM, Katzenellenbogen BS. Different regions in activation function-1 of the human estrogen receptor required for antiestrogen- and estradiol-dependent transcription activation. J Biol Chem. 1996;27:24172–24178.

11. Kuiper GG, Carlsson B, Grandien K, Enmark E, Haggblad J, Nilsson S, Gustafsson JA. Comparison of the ligand binding specificity and transcript tissue distribution of estrogen receptors alpha and beta. Endocrinology. 1997;138:863–870.[Abstract/Free Full Text]

12. Iafrati MD, Karas RH, Aronovitz M, Kim S, Sullivan TR Jr, Lubahn DB, O’Donnell TAF Jr, Horach KS, Mendelsohn ME. Estrogen inhibits the vascular injury response in estrogen receptor alpha-deficient mice. Nat Med. 1997;3:545–548.[Medline] [Order article via Infotrieve]

13. Register TC, Adams MR. Coronary artery and cultured aortic smooth muscle cells express mRNA for both the classical estrogen receptor and the newly described estrogen receptor beta. J Steroid Biochem Mol Biol. 1998;64:187–191.[Medline] [Order article via Infotrieve]

14. Hodges YK, Richer JK, Horwitz KB, Horwitz LD. Variant estrogen and progesterone messages in human vascular smooth muscle. Circulation. 1999;99:2688–2693.[Abstract/Free Full Text]

15. Klein-Hitpass L, Schorpp M, Wagner U, Ryffel GU. An estrogen responsive element derived from the 5' flanking region of the xenopus vitellogenin A-2 gene functions in transfected human cells. Cell. 1986;46:1053–1061.[Medline] [Order article via Infotrieve]

16. Sartorius CA, Melville MY, Hovland AR, Tung L, Takimoto GS, Horwitz KB. A third transactivation function (AF3) of human progesterone receptors located in the unique N-terminal segment of the B-isoform. Mol Endocrinol. 1994;8:1347–1360.[Abstract/Free Full Text]

17. Hovland AR, Powell RL, Takimoto GS, Tung L, Horwitz KB. An N-terminal inhibitory function, IF, suppresses transcription by the A-isoform but not the B-isoform of human progesterone receptors. J Biol Chem. 1998;273:5455–5460.[Abstract/Free Full Text]

18. Paech K, Webb P, Kuiper GGJM, Nilsson S, Gustafsson J-A, Kushner PJ, Scanlan T. Differential ligand activation of estrogen receptors ER{alpha} and ERß at AP1 sites. Science. 1997;277:1508–1510.[Abstract/Free Full Text]

19. Jackson TA, Richer JK, Bain DL, Takimoto GS, Tung L, Horwitz KB. The partial agonist activity of antagonist-occupied steroid receptors is controlled by a novel hinge domain-binding coactivator L7/SPA and the corepressors N-CoR or SMRT. Mol Endocrinol. 1997;11:693–705.[Abstract/Free Full Text]

20. Hulley S, Grady D, Bush T, Furberg C, Herrington D, Riggs B, Vittinghoff E. Randomized trial of estrogen plus progestin for secondary prevention of coronary artery disease in postmenopausal women: heart and estrogen/progestin replacement study (HERS) research group. JAMA. 1998;280:605–613.[Abstract/Free Full Text]

21. Williams JK, Honore EK, Washburn SA, Clarkson TB. Effects of hormone replacement therapy on reactivity of atherosclerotic coronary arteries in cynomolgus monkeys. J Am Coll Cardiol.. 1994;24:1757–1761.[Abstract]

22. Miyagawa K, Roch J, Stanczyk F, Hersmeyer K. Medroxyprogesterone interfered with ovarian steroid protection against coronary vasospasm. Nat Med. 1997;3:324–327.[Medline] [Order article via Infotrieve]

23. Selzman CH, Gaynor JS, Turner AS, Johnson SM, Horwitz LD, Whitehill TA, Harken AH. Ovarian ablation alone promotes aortic intimal hyperplasia and accumulation of fibroblast growth factor. Circulation. 1998;98:2049–2054.[Abstract/Free Full Text]

24. Chaidarun SS, Swearingen B, Alexander JM. Differential expression of estrogen receptor-ß (ERß) in human pituitary tumors: functional interactions with ER{alpha} and a tumor-specific splice variant. J Clin Endocrinol Metab. 1998;83:3308–3315.[Abstract/Free Full Text]

25. Inoue S, Hoshino S, Miyoshi H, Akishita M, Hosoi T, Orimo H, Ouchi Y. Identification of a novel isoform of estrogen receptor, a potential inhibitor of estrogen action, in vascular smooth muscle cells. Biochem Biophys Res Commun. 1996;219:766–772.[Medline] [Order article via Infotrieve]

26. Berry M, Metzger D, Chambon P. Role of the two activating domains of the oestrogen receptor in the cell-type and promoter-context dependent agonistic activity of the anti-oestrogen 4-hydroxytamoxifen. EMBO J. 1990;9:92811–92818.

27. Brzozowski AM, Pike ACW, Dauter Z, Hubbard RE, Bonn T, Engstrom O, Ohman L, Greene GL, Gustaffson JA, Carlquist M. Molecular basis of agonism and antagonism in the oestrogen receptor. Nature. 1997;389:753–758.[Medline] [Order article via Infotrieve]

28. Nichols M, Rientjes JM, Stewart AF. Different positioning of the ligand-binding domain helix 12 and the F domain of the estrogen receptor accounts for functional differences between agonists and antagonists. EMBO J. 1998;17:765–773.[Medline] [Order article via Infotrieve]

29. Watanabe T, Inoue S, Ogawa S, Ishii Y, Hiroi H, Ikeda K, Orimo A, Muramatsu M. Agonistic effect of tamoxifen is dependent on cell type, ERE-promoter context, and estrogen receptor subtype: functional difference between estrogen receptors alpha and beta. Biochem Biophys Res Commun. 1997;236:140–145.[Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
Clin. Chem.Home page
S. Domingues-Montanari, I. Subirana, M. Tomas, J. Marrugat, and M. Senti
Association between ESR2 Genetic Variants and Risk of Myocardial Infarction
Clin. Chem., July 1, 2008; 54(7): 1183 - 1189.
[Abstract] [Full Text] [PDF]


Home page
Ther Adv Cardiovasc DisHome page
P. D. Patel and R. R. Arora
Review: Endothelial dysfunction: A potential tool in gender related cardiovascular disease
Therapeutic Advances in Cardiovascular Disease, April 1, 2008; 2(2): 89 - 100.
[Abstract] [PDF]


Home page
HypertensionHome page
L. L. Yanes, J. C. Sartori-Valinotti, and J. F. Reckelhoff
Sex Steroids and Renal Disease: Lessons From Animal Studies
Hypertension, April 1, 2008; 51(4): 976 - 981.
[Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
G. Douglas, M. Natalia Cruz, L. Poston, J.-A. Gustafsson, and K. Kublickiene
Functional characterization and sex differences in small mesenteric arteries of the estrogen receptor- knockout mouse
Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2008; 294(1): R112 - R120.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
K. M. Rexrode, P. M. Ridker, H. H. Hegener, J. E. Buring, J. E. Manson, and R. Y.L. Zee
Polymorphisms and Haplotypes of the Estrogen Receptor-{beta} Gene (ESR2) and Cardiovascular Disease in Men and Women
Clin. Chem., October 1, 2007; 53(10): 1749 - 1756.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
Ma. E. D. Esqueda, T. Craig, and C. Hinojosa-Laborde
Effect of Ovariectomy on Renal Estrogen Receptor-{alpha} and Estrogen Receptor-{beta} in Young Salt-Sensitive and -Resistant Rats
Hypertension, October 1, 2007; 50(4): 768 - 772.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
T. Traupe, C. D. Stettler, H. Li, E. Haas, I. Bhattacharya, R. Minotti, and M. Barton
Distinct Roles of Estrogen Receptors {alpha} and {beta} Mediating Acute Vasodilation of Epicardial Coronary Arteries
Hypertension, June 1, 2007; 49(6): 1364 - 1370.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
L. Luksha, L. Poston, J.-A. Gustafsson, K. Hultenby, and K. Kublickiene
The oestrogen receptor {beta} contributes to sex related differences in endothelial function of murine small arteries via EDHF
J. Physiol., December 15, 2006; 577(3): 945 - 955.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
C. Bolego, E. Vegeto, C. Pinna, A. Maggi, and A. Cignarella
Selective Agonists of Estrogen Receptor Isoforms: New Perspectives for Cardiovascular Disease
Arterioscler Thromb Vasc Biol, October 1, 2006; 26(10): 2192 - 2199.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
W. D. Zoma, R. S. Baker, J. L. Mershon, and K. E. Clark
Hemodynamic effects of acute and repeated exposure to raloxifene in ovariectomized sheep
Am J Physiol Heart Circ Physiol, September 1, 2006; 291(3): H1216 - H1225.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
R. C. Christian, P. Y. Liu, S. Harrington, M. Ruan, V. M. Miller, and L. A. Fitzpatrick
Intimal Estrogen Receptor (ER){beta}, But Not ER{alpha} Expression, Is Correlated with Coronary Calcification and Atherosclerosis in Pre- and Postmenopausal Women
J. Clin. Endocrinol. Metab., July 1, 2006; 91(7): 2713 - 2720.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
M. R. Meyer, E. Haas, and M. Barton
Gender Differences of Cardiovascular Disease: New Perspectives for Estrogen Receptor Signaling
Hypertension, June 1, 2006; 47(6): 1019 - 1026.
[Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. N. Cruz, L. Luksha, H. Logman, L. Poston, S. Agewall, and K. Kublickiene
Acute responses to phytoestrogens in small arteries from men with coronary heart disease
Am J Physiol Heart Circ Physiol, May 1, 2006; 290(5): H1969 - H1975.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
G. Han, X. Yu, L. Lu, S. Li, H. Ma, S. Zhu, X. Cui, and R. E. White
Estrogen Receptor {alpha} Mediates Acute Potassium Channel Stimulation in Human Coronary Artery Smooth Muscle Cells
J. Pharmacol. Exp. Ther., March 1, 2006; 316(3): 1025 - 1030.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. Jayachandran and V. M. Miller
Mechanisms of estrogenic vascular protection
Am J Physiol Heart Circ Physiol, February 1, 2006; 290(2): H507 - H508.
[Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. N. Cruz, G. Douglas, J.-A Gustafsson, L. Poston, and K. Kublickiene
Dilatory responses to estrogenic compounds in small femoral arteries of male and female estrogen receptor-{beta} knockout mice
Am J Physiol Heart Circ Physiol, February 1, 2006; 290(2): H823 - H829.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
R. G. Mishra, F. Z. Stanczyk, K. A. Burry, S. Oparil, B. S. Katzenellenbogen, M. L. Nealen, J. A. Katzenellenbogen, and R. K. Hermsmeyer
Metabolite ligands of estrogen receptor-{beta} reduce primate coronary hyperreactivity
Am J Physiol Heart Circ Physiol, January 1, 2006; 290(1): H295 - H303.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
L. Luksha, L. Poston, J.-A. Gustafsson, L. Aghajanova, and K. Kublickiene
Gender-Specific Alteration of Adrenergic Responses in Small Femoral Arteries From Estrogen Receptor-{beta} Knockout Mice
Hypertension, November 1, 2005; 46(5): 1163 - 1168.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
A. K. Natoli, T. L. Medley, A. A. Ahimastos, B. G. Drew, D. J. Thearle, R. J. Dilley, and B. A. Kingwell
Sex Steroids Modulate Human Aortic Smooth Muscle Cell Matrix Protein Deposition and Matrix Metalloproteinase Expression
Hypertension, November 1, 2005; 46(5): 1129 - 1134.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
V. Dhawan, Z. L. S. Brookes, and S. Kaufman
Repeated pregnancies (multiparity) increases venous tone and reduces compliance
Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2005; 289(1): R23 - R28.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
E. Rzewuska-Lech, M. Jayachandran, L. A. Fitzpatrick, and V. M. Miller
Differential effects of 17{beta}-estradiol and raloxifene on VSMC phenotype and expression of osteoblast-associated proteins
Am J Physiol Endocrinol Metab, July 1, 2005; 289(1): E105 - E112.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
C. Bolego, A. Cignarella, P. Sanvito, V. Pelosi, F. Pellegatta, L. Puglisi, and C. Pinna
The Acute Estrogenic Dilation of Rat Aorta Is Mediated Solely by Selective Estrogen Receptor-{alpha} Agonists and Is Abolished by Estrogen Deprivation
J. Pharmacol. Exp. Ther., June 1, 2005; 313(3): 1203 - 1208.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
M. J. Byers, A. Zangl, T. M. Phernetton, G. Lopez, D.-b. Chen, and R. R. Magness
Endothelial vasodilator production by ovine uterine and systemic arteries: ovarian steroid and pregnancy control of ER{alpha} and ER{beta} levels
J. Physiol., May 15, 2005; 565(1): 85 - 99.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
R. S. Scotland, M. Madhani, S. Chauhan, S. Moncada, J. Andresen, H. Nilsson, A. J. Hobbs, and A. Ahluwalia
Investigation of Vascular Responses in Endothelial Nitric Oxide Synthase/Cyclooxygenase-1 Double-Knockout Mice: Key Role for Endothelium-Derived Hyperpolarizing Factor in the Regulation of Blood Pressure in Vivo
Circulation, February 15, 2005; 111(6): 796 - 803.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
P. Y. Liu, R. C. Christian, M. Ruan, V. M. Miller, and L. A. Fitzpatrick
Correlating Androgen and Estrogen Steroid Receptor Expression with Coronary Calcification and Atherosclerosis in Men without Known Coronary Artery Disease
J. Clin. Endocrinol. Metab., February 1, 2005; 90(2): 1041 - 1046.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
R. K. Dubey, E. K. Jackson, D. G. Gillespie, M. Rosselli, F. Barchiesi, A. Krust, H. Keller, L. C. Zacharia, and B. Imthurn
Cytochromes 1A1/1B1- and Catechol-O-Methyltransferase-Derived Metabolites Mediate Estradiol-Induced Antimitogenesis in Human Cardiac Fibroblast
J. Clin. Endocrinol. Metab., January 1, 2005; 90(1): 247 - 255.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
Y. Nakamura, K. Igarashi, T. Suzuki, J. Kanno, T. Inoue, C. Tazawa, M. Saruta, T. Ando, N. Moriyama, T. Furukawa, et al.
E4F1, a Novel Estrogen-Responsive Gene in Possible Atheroprotection, Revealed by Microarray Analysis
Am. J. Pathol., December 1, 2004; 165(6): 2019 - 2031.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
V. M. Miller, D. J. Tindall, and P. Y. Liu
Of Mice, Men, and Hormones
Arterioscler Thromb Vasc Biol, June 1, 2004; 24(6): 995 - 997.
[Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
F. Barchiesi, E. K. Jackson, B. Imthurn, J. Fingerle, D. G. Gillespie, and R. K. Dubey
Differential Regulation of Estrogen Receptor Subtypes {alpha} and {beta} in Human Aortic Smooth Muscle Cells by Oligonucleotides and Estradiol
J. Clin. Endocrinol. Metab., May 1, 2004; 89(5): 2373 - 2381.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
J. M. Orshal and R. A. Khalil
Gender, sex hormones, and vascular tone
Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2004; 286(2): R233 - R249.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
F. L. Wynne, J. A. Payne, A. E. Cain, J. F. Reckelhoff, and R. A. Khalil
Age-Related Reduction in Estrogen Receptor-Mediated Mechanisms of Vascular Relaxation in Female Spontaneously Hypertensive Rats
Hypertension, February 1, 2004; 43(2): 405 - 412.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
L. A. Fitzpatrick
Hormones and the Heart: Controversies and Conundrums
J. Clin. Endocrinol. Metab., December 1, 2003; 88(12): 5609 - 5610.
[Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
J. D. Wagner, D. C. Schwenke, K. A. Greaves, L. Zhang, M. S. Anthony, R. M. Blair, M. K. Shadoan, and J. K. Williams
Soy Protein With Isoflavones, but not an Isoflavone-Rich Supplement, Improves Arterial Low-Density Lipoprotein Metabolism and Atherogenesis
Arterioscler Thromb Vasc Biol, December 1, 2003; 23(12): 2241 - 2246.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
Y. Nakamura, Y. Miki, T. Suzuki, T. Nakata, A. D. Darnel, T. Moriya, C. Tazawa, H. Saito, T. Ishibashi, S. Takahashi, et al.
Steroid Sulfatase and Estrogen Sulfotransferase in the Atherosclerotic Human Aorta
Am. J. Pathol., October 1, 2003; 163(4): 1329 - 1339.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
T. Watanabe, M. Akishita, T. Nakaoka, K. Kozaki, Y. Miyahara, H. He, Y. Ohike, T. Ogita, S. Inoue, M. Muramatsu, et al.
Estrogen receptor {beta} mediates the inhibitory effect of estradiol on vascular smooth muscle cell proliferation
Cardiovasc Res, September 1, 2003; 59(3): 734 - 744.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
F. M Steinberg, N. L Guthrie, A. C Villablanca, K. Kumar, and M. J Murray
Soy protein with isoflavones has favorable effects on endothelial function that are independent of lipid and antioxidant effects in healthy postmenopausal women
Am. J. Clinical Nutrition, July 1, 2003; 78(1): 123 - 130.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
F. C. W. Wu and A. von Eckardstein
Androgens and Coronary Artery Disease
Endocr. Rev., April 1, 2003; 24(2): 183 - 217.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. K. Mukherjee, L. Nathan, H. Dinh, S. T. Reddy, and G. Chaudhuri
17-Epiestriol, an Estrogen Metabolite, Is More Potent Than Estradiol in Inhibiting Vascular Cell Adhesion Molecule 1 (VCAM-1) mRNA Expression
J. Biol. Chem., March 28, 2003; 278(14): 11746 - 11752.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
R. Liew, J. K. Williams, P. Collins, and K. T. MacLeod
Soy-Derived Isoflavones Exert Opposing Actions on Guinea Pig Ventricular Myocytes
J. Pharmacol. Exp. Ther., March 1, 2003; 304(3): 985 - 993.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
R. Tatchum-Talom, C. Martel, F. Labrie, and A. Marette
Acute vascular effects of the selective estrogen receptor modulator EM-652 (SCH 57068) in the rat mesenteric vascular bed
Cardiovasc Res, February 1, 2003; 57(2): 535 - 543.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. P. Bracamonte, M. Jayachandran, K. S. Rud, and V. M. Miller
Acute effects of 17beta -estradiol on femoral veins from adult gonadally intact and ovariectomized female pigs
Am J Physiol Heart Circ Physiol, December 1, 2002; 283(6): H2389 - H2396.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
C. E. Gargett, M. Zaitseva, K. Bucak, S. Chu, P. J. Fuller, and P. A. W. Rogers
17{beta}-Estradiol Up-Regulates Vascular Endothelial Growth Factor Receptor-2 Expression in Human Myometrial Microvascular Endothelial Cells: Role of Estrogen Receptor-{alpha} and -{beta}
J. Clin. Endocrinol. Metab., September 1, 2002; 87(9): 4341 - 4349.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
E. F. Verdu, Y. Deng, P. Bercik, and S. M. Collins
Modulatory effects of estrogen in two murine models of experimental colitis
Am J Physiol Gastrointest Liver Physiol, July 1, 2002; 283(1): G27 - G36.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
F. Barchiesi, E. K. Jackson, D. G. Gillespie, L. C. Zacharia, J. Fingerle, and R. K. Dubey
Methoxyestradiols Mediate Estradiol-Induced Antimitogenesis in Human Aortic SMCs
Hypertension, April 1, 2002; 39(4): 874 - 879.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
T. S Mikkola and T. B Clarkson
Estrogen replacement therapy, atherosclerosis, and vascular function
Cardiovasc Res, February 15, 2002; 53(3): 605 - 619.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
T. V. Pham and M. R. Rosen
Sex, hormones, and repolarization
Cardiovasc Res, February 15, 2002; 53(3): 740 - 751.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
G. G. Geary, A. M. McNeill, J. A. Ospina, D. N. Krause, K. S. Korach, and S. P. Duckles
Genome and Hormones: Gender Differences in Physiology: Selected Contribution: Cerebrovascular NOS and cyclooxygenase are unaffected by estrogen in mice lacking estrogen receptor-alpha
J Appl Physiol, November 1, 2001; 91(5): 2391 - 2399.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
R. K. Dubey and E. K. Jackson
Estrogen-induced cardiorenal protection: potential cellular, biochemical, and molecular mechanisms
Am J Physiol Renal Physiol, March 1, 2001; 280(3): F365 - F388.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Jankowski, G. Rachelska, W. Donghao, S. M. McCann, and J. Gutkowska
Estrogen receptors activate atrial natriuretic peptide in the rat heart
PNAS, September 25, 2001; 98(20): 11765 - 11770.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hodges, Y. K.
Right arrow Articles by Horwitz, L. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hodges, Y. K.
Right arrow Articles by Horwitz, L. D.
Related Collections
Right arrow Other Vascular biology