(Circulation. 2000;101:1792.)
© 2000 American Heart Association, Inc.
Clinical Investigation and Reports |
and ß
From the Divisions of Cardiology (Y.K.H., X.-D.Y., L.D.H.) and Endocrinology (L.T., J.D.G., K.B.H.), Department of Medicine, University of Colorado Health Sciences Center, Denver, Colo.
Correspondence to Lawrence D. Horwitz, MD, Cardiology B130, University of Colorado Health Sciences Center, Denver, CO 80262. E-mail lawrence.horowitz{at}UCHSC.edu
| Abstract |
|---|
|
|
|---|
, the first ER to be cloned, a second subtype called
ERß has recently been discovered.
Methods and ResultsUsing a reverse-transcriptase polymerase
chain reaction assay that employs the same primer pair to
simultaneously amplify ER
and ERß transcripts, we
found that ERß is the ER form that is predominantly expressed in
human vascular smooth muscle, particularly in women. The
transcriptional effects of the 2 ERs in transfected HeLa cells
differed. In response to 17ß-estradiol, ER
is a stronger
transactivator than ERß at low receptor concentrations.
However, at higher receptor concentrations, ER
activity
self-squelches, and ERß is a stronger transactivator.
Tamoxifen has partial agonist effects with ER
but not with
ERß.
ConclusionsThe protective effects of estrogens in the cardiovascular system of women may be due to the genomic effects of ERß in vascular tissue.
Key Words: muscle, smooth receptors, estrogen coronary disease human
| Introduction |
|---|
|
|
|---|
The structure of ER
was elucidated in 1987.6 A second
ER cDNA, designated ERß, was cloned in l996.7 8 The 2
ERs have a similar affinity for 17ß-estradiol, and they bind to the
same estrogen response elements (EREs).9 However, ERß
differs from ER
in 2 important functional domains. First, the
N-terminus containing the AF-1 (activation function-1) activation
domain of ERß has only 30% homology with that of
ER
.7 8 This domain is critical to the partial agonist
properties of some antiestrogens, and it may be involved in tissue
specificity.10 Second, the hormone-binding domains (HBD)
of ER
and ERß have only 53% homology.7 8
Why estrogens enhance the proliferation of breast or uterine cells but
inhibit the proliferation of VSM cells is an enigma. One possible
explanation for this heterogeneity of estrogen action
is that the vascular bed expresses structurally and functionally
different ERs than the breast or uterus. ER
is the predominant
receptor in the breast and uterus.11 However, because
estrogens inhibit VSM proliferation in response to vascular injury in
knockout mice that lack ER
,12 ER
is not essential to
estrogen action in the vascular wall. Cynomolgus monkeys express both
ER
and ERß mRNA in coronary artery and cultured aortic
smooth muscle cells.13 No information about the
distribution of wild-type ERs in human VSM exists.
This study had 2 goals: to describe the relative expression of ER
and ERß transcripts in VSM and to elucidate whether differences exist
in the transcriptional activation and function of ER
and ERß.
| Methods |
|---|
|
|
|---|
RNA (0.5 to 1.0 µg) was heated to 70°C for 5 minutes, and 125 U of MuLV RT was added. Using the random hexamer oligo primer supplied in a GeneAmp RNA PCR kit (Perkin Elmer), an RT reaction was performed at 42°C for 60 minutes. After dilution of the RT cDNA product, PCR was performed with the following thermal cycles: 1 cycle at 94°C for 1 minute, followed by 35 cycles at 94°C for 15 s, 55°C for 25 s, and 72°C for 30 s, and 1 final extension cycle at 72°C for 7 minutes. Products were resolved on an 8% polyacrylamide gel in 1x Tris-borate/EDTA buffer (0.09 mol/L Tris-borate and 0.002 mol/L EDTA, pH 8.0).
Primers
To simultaneously amplify ER
and ERß in the
same PCR reaction, oligonucleotide primers were
designed for PCR amplification of specific DNA fragments contained in
both ER
and ERß (Figure 1
). The forward primer sequence,
ERF2, was AAGAGCTGCCAGGCCTGCCG, and the reverse primer sequence, ERR1,
was GCCCAG-CTGATCATGTGAACCA. There was one mismatch in ERR1 for both
ERß (AT mismatch) and ER
(AG mismatch). The primer ERR1 had
similar stability on both templates. The primer pair ERF2 and ERR1
generated a 382-bp fragment for ER
and a 346-bp fragment for ERß.
These primers were tested on ER
and ERß cDNA plasmid clones to
ensure that they generated the specific products targeted, with
equivalent efficiency under the same amplification conditions.
|
Primers specific for ER
or ERß only, but capable of distinguishing
the wild-type from the variant forms of each, were also designed. The
ER
-specific primers, a forward primer ERAF1
(GTCTCCGAGCCCGCTGATGCTACTGCAC) and a reverse primer ERAR1
(CGGATGCCCCTCCACGGCTAGTGG), generated a 1372-bp fragment. The
ERß-specific primers, forward primer ERBF1
(CGTGATGGAGGACTTGCACCCGCGAAGCAC) and reverse primer ERBR1
(TCCCTGGTGTGAAGCAAGTATCG-CTAGAACA), generated a 1212-bp
fragment.
Plasmids
Wild-type human ER
expression vector was provided by Dr
Pierre Chambon (Strasbourg, France). The human ERß Bluescript KS
construct was provided by Drs Eva Enmark and Jan-Ake Gustafsson
(Stockholm, Sweden). The 1460-bp ERß insert was recloned into the
pSG5 expression vector (Stratagene) to generate pSG5-hER. The reporter
plasmids were VIT-tk-CAT15 and
ERE2-TATAtk-CAT.16
Transfection and Reporter Assays
Transfection experiments used 10 ng of human ER
expression
vector or ERß plasmid, 2 µg of
ERE2-TATAtk-CAT or
VIT-tk-CAT reporter, 3 µg of the ß-galactosidase expression plasmid
pCH-110 (Amersham Pharmacia Biotechnology) to correct for transfection
efficiency, and 15 µg of Bluescribe carrier plasmid, for a total of
20 µg of DNA/plate.16 Cells were treated for 24 hours
with 10 nmol/L 17ß-estradiol and/or 100 nmol/L tamoxifen or ICI
182,780 (ICI Pharmaceuticals). Cell lysates were analyzed
for CAT activity, as previously described,16 with
chloramphenicol acetylation measured by thin-layer
chromatography and quantified by phosphorimaging
(Molecular Dynamics).
Statistical Analysis
Statistical analysis was performed with SAS software
(SAS Institute). The 2-tailed significance level was 0.05. Independent
groups were compared using the unpaired t test, and dose
response was assessed by linear regression.
| Results |
|---|
|
|
|---|
and ERß Transcripts in Human VSM
and ERß expression
in human VSM, we designed primers that coamplified different transcript
fragment lengths for each subtype in the same polymerase chain reaction
(PCR). The combined ER
/ß primer set (ERF2/ERR1; see Methods for a
complete description) amplifies both a region of the cDNA
encoding the DNA binding domain (DBD) and the hinge region of the 2
receptors that has a gap in ERß when compared with the ER
sequence
(Figure 1A
, and a 346-bp product from
the cDNA encoding ERß. Equal efficiency of the PCR amplification
reactions was confirmed using control plasmid DNA containing the
recombinant cDNA of ER
or ERß in molar ratios of 1:3 (Figure 1B
ER
and ERß RT-PCR products (determined using the combined
ER
/ß primer sets) in VSM from 12 patients are shown in Figure 2A
. Although both ER
and ERß
transcripts were present in all samples, some subsets expressed
considerably more ERß than ER
. The values of ERß, expressed as a
percentage of total ER, in samples of VSM from 8 male and 12 female
subjects, are shown in the Table
. ERß
was more prevalent in the VSM from female subjects (67±12%) than in
those from male subjects (51±15%; P=0.02). ERß did not
correlate with age in either sex.
|
|
To determine if exposure to estrogens could alter the ER
/ERß
ratio, samples of VSM from 8 male and 12 female patients were treated
for 72 hours with 17ß-estradiol or vehicle. No consistent
differences existed in the subtype ratios between estrogen-treated sets
and controls. Studies of samples from 3 patients found no differences
in ER ratios between tissue immediately frozen when obtained and tissue
incubated for 72 hours in medium (data not shown).
The combined primer set quantifies relative amounts of each subtype,
but it cannot discriminate between wild-type, full-length ER
or
ERß and HBD deletion variants of these subtypes. ER
variants are
common in VSM.14 Therefore, we also used primers designed
to amplify longer lengths of either ER
or ERß specifically (Figure 1A
). These included ERAF1/ERAR1 for ER
and ERBF1/ERBR1 for
ERß, which included the N-terminus, DBD, hinge region, and HBD
(Figure 2B
). The specific primers were tested using plasmid DNA
containing ER
or ERß to confirm that the PCR generated full-length
products (data not shown). The major transcript encoding ERß of
the sample shown in Figure 2B
is full-length (open arrow),
although a small band representing a lower molecular weight
variant (solid arrow) can be discerned. However, the ER
transcripts
are present predominantly as variant forms (solid arrows): there is
little full-length, wild-type ER
present (open arrow).
Similar results were obtained in the other 19 samples of VSM (data not
shown). Therefore, the results with the combined ER
/ERß primer set
underestimate the ratio of wild-type ERß to wild-type ER
transcripts.
Transcription by ER
and ERß: Promoter and Ligand
Specificity
To examine differences in promoter specificity between ER
and
ERß, ER-negative HeLa cells were cotransfected with either the
ERE2-TATAtk-CAT (Figure 3A
) or vitellogenin (VIT-tk-CAT)
(Figure 3B
) promoter/reporter constructs, as well as increasing
concentrations (1 to 100 ng) of ER
or ERß expression vectors. The
cells were treated with vehicle or 10 nmol/L 17ß-estradiol. The
chloramphenicol transferase (CAT) transcription driven by each promoter
was measured. Substantial estradiol-induced transcription occurred in
cells with low levels of ER
; however, as the receptor concentration
increased, transcription decreased due to a phenomenon called
"self-squelching." The mechanism underlying self-squelching is
unknown, but a similar effect of the progesterone receptor A-isoform
requires an intact HBD.17 Unlike ER
, ERß had
no transcriptional activity with
ERE2-TATAtk-CAT (Figure 3A
). With VIT-tk-CAT, estradiol induced similar transcriptional
activity in ERß and ER
at low concentrations (1 and 5 ng cDNA;
Figure 3B
). However, at higher receptor concentrations, because
ERß did not self-squelch, it was a more potent
transactivator than ER
. The
ERE2-TATAtk-CAT promoter
construct contains 2 consecutive, synthetic EREs upstream of a minimal
thymidine kinase promoter linked to the CAT gene.16 The
VIT-tk-CAT promoter contains 2 repeats of the ERE found in the
vitellogenin A1 gene promoter.15 Differences in the EREs
and flanking sequences probably account for the differences in promoter
recognition by the 2 ERs. Specifically, the VIT-tk-CAT promoter has
several potential AP-1 sites that could modulate transcriptional
activation by the 2 ERs.18 Such differences in specific
gene transcription between the 2 receptors may underlie the variation
in responses to 17ß-estradiol observed in different tissues,
including VSM.
|
To further analyze possible differences in the transcriptional
activities of ER
and ERß, we studied the differential effects of
antiestrogens. Some antiestrogens possess partial agonist activity (ie,
tamoxifen), and others are pure antagonists (ie, ICI
182,780). HeLa cells were cotransfected with ER
or ERß and with
the reporters
ERE2-TATAtk-CAT (Figure 4A
) or VIT-tk-CAT (Figure 4B
). The
transfected cells were treated with 17ß-estradiol, tamoxifen, or ICI
182,780, either alone or in combination. Compared with 17ß-estradiol,
tamoxifen is a partial agonist on the
ERE2-TATAtk-CAT reporter
when bound to ER
; under these conditions, tamoxifen did not suppress
the agonist effects of 17ß-estradiol (Figure 4A
). ICI 182,780
had no agonist effect on this promoter and strongly suppressed the
transcription induced by 17ß-estradiol. ERß did not induce the
transcription of
ERE2-TATAtk-CAT with any
ligand (Figure 4A
).
|
Tamoxifen is also an agonist in the presence of ER
on the VIT-tk-CAT
reporter (Figure 4B
). Again, ICI 182,780 is a pure
antagonist. When bound to ERß with VIT-tk-CAT, tamoxifen
lacked partial agonist activity and, unlike ICI 182,780, it did not
suppress the agonist effects of 17ß-estradiol.
L7/SPA is a novel transcriptional coactivator that enhances
the partial agonist effect of tamoxifen but has no effect on
transactivation by estrogens or pure
antagonists.19 To determine whether any
ERß-mediated latent partial agonist activity by tamoxifen could be
exposed, this antiestrogen was tested on both ER subtypes in the
presence of an L7/SPA expression vector using the VIT-tk-CAT reporter
(Figure 5
). Coexpression of L7/SPA
increased the partial agonist effects of tamoxifen on ER
to levels
that exceeded those obtained with 17ß-estradiol. However, even in the
presence of L7/SPA, no agonist effects of tamoxifen were detectable in
cells transfected with ERß constructs. Thus, a fundamental difference
exists in the 2 ERs with respect to the actions of antiestrogens.
|
Effect of ERß on Transcriptional Effects of ER
Because ER
and ERß are coexpressed in VSM, it is important to
determine whether the presence of one ER subtype can modify the
transcriptional effects of the other. We examined the effect of ERß
on ER
-controlled transcription of the VIT-tk-CAT reporter in cells
treated with tamoxifen (Figure 6
). A
5-fold molar excess of ERß substantially reduced the agonist effect
of tamoxifen on ER
(P=0.005 for linear dose response and
P=0.02 for dose of 0 versus 2.5). Therefore, at least one
transcriptional effect of ER
can be inhibited by the presence of
ERß.
|
| Discussion |
|---|
|
|
|---|
Although the relationship between estrogens and vascular disease is poorly understood, evidence exists that estrogens have genomic effects on the vascular wall, which is probably mediated through ERs. These effects include the inhibition of VSM growth and migration in vitro and the inhibition of arterial intimal hyperplasia in vivo.3 4 Without dietary manipulation or vascular trauma, ovarian ablation in sheep induces aortic intimal hyperplasia, which can be prevented by the administration of an estrogen.23
A seeming paradox of estrogenic effects is the observation of growth
inhibition in the vascular bed but growth stimulation in other target
organs, such as the breast and uterus. Our demonstration that the newly
discovered ERß subtype is the most prevalent receptor mRNA in human
VSM offers a possible explanation for the important differences in the
effects of estrogens on the vascular bed compared with other organs. We
offer evidence that ERß differs in its transcriptional activation and
effects from ER
, which is the most prevalent receptor in the breast
and uterus.11 We propose that the
physiological effects of estrogens or antiestrogens
in a tissue depend to a considerable extent on the type of ER expressed
in that tissue.
ERß is the Prevalent Wild-Type ER mRNA in Human VSM
Because reliable monoclonal antibodies for human ERß are not
commercially available, we used RT-PCR to quantify transcript
expression for both ER
and ERß in human VSM. Our method allows the
cDNA encoding each subtype to be amplified in the same reaction tube.
Because the amplified products differ in size, they can be
distinguished from one another on electrophoretic gels, and the
relative percentage of each ER subtype in a sample can be quantified.
Because this method cannot distinguish between wild-type and
exon-deletion variants of ER
and ERß, we also performed separate
PCR reactions using primers that recognized longer transcripts specific
for either ER
or ERß.
We demonstrated that although both ERß and ER
mRNA were
present in all 20 subjects we studied, the more prevalent wild-type
receptor mRNA was ERß. In women, ERß was present in higher
quantities in most samples, and in men, ERß and ER
were
present in approximately equal quantities. Qualitative
analysis of the mRNAs with specific primers demonstrated that
ERß was encoded primarily by full-length transcripts, but ER
transcripts included substantial amounts of putative exon-deletion
variants.
The importance of variant ER messages due to exon deletions is unclear.
In cells transfected with variants of ER
, stimulation with estrogens
could result in anomalous transcriptional activities that dominantly
inhibit or enhance the effects of wild-type ER
.14 24 25
There has been no confirmation that the ER
variant transcripts are
translated into proteins in vivo. Thus, ER
exon-deletion variants
may have no physiological effects. If so, the
wild-type receptors would determine the estrogenic effects in VSM, and
ERß would be the major receptor subtype mediating transcription.
Potential Influence of Differences in Structure of ER
and ERß
on Function
Human ERß differs significantly from ER
at the N-terminus
(including the AF-1 region), the hinge region, and the HBD (including
differences in the AF-2 region and F domain at the far C-terminus;
Figure 1
). Although the functional domains of ERß have not yet
been delineated, these structural differences probably account for
differences in transcriptional activities. The AF-1 region of ER
is
responsible for the partial agonist effects of
tamoxifen,10 26 and we found that tamoxifen lacks partial
agonist activity on ERß. Structural differences between the 2
subtypes in the AF-2 region and the F domain may also contribute to the
differing effects of antiestrogens on the 2 receptors. In
crystallographic analyses, the F domain generates an
-helix
(helix 12), whose appropriate folding over the surface of the
ligand-activated HBD is critical in imparting agonist versus
antagonist information to the transcriptional
machinery.27 28 The amino acid composition of the ERß F
domain differs considerably from that of ER
.7 8
Our data also allowed us to deduce important functional information
about the hinge region between the DBD and HBD. We recently isolated a
transcriptional coactivator (termed L7/SPA) that binds to
the hinge region of ER
and enhances the agonist activity of
antiestrogens, such as tamoxifen.19 Thus, the hinge region
may be an important site for protein-protein interactions. Because
tamoxifen-occupied ERß is not influenced by L7/SPA (Figure 5
),
the ERß hinge region functions differently from that of ER
, which
has only 19% homology with ERß.
Possible Functional Significance of the Prevalence of ERß in
VSM
Although low levels of wild-type ER
induce strong estrogenic
responses, self-squelching limits transcriptional activity at higher
receptor levels. Because ERß does not self-squelch, at high
concentrations, ERß is a more potent transactivator than
ER
. Cotransfection of ERß did not suppress estradiol-induced,
ER
-dependent transcription (data not shown).
However, tamoxifen bound to ERß suppressed the agonist effects of
tamoxifen-occupied ER
. Complicating any analysis is the
observation that the inhibitory potency of
antagonists and their agonist effects are dependent on
promoter context and cell-type specificity.29 We found
that with ER
, tamoxifen had partial agonist effects on the
ERE2-TATAtk-CAT promoter
but not on the VIT-tk-CAT promoter. Tamoxifen-occupied ERß
lacks agonist effects on both promoters. Nevertheless,
tamoxifen-occupied ERß can have agonist effects on some promoters
containing AP-1 sites.18
Potential Clinical Importance of ERß Activation in VSM
Inhibition by estrogens of VSM growth in vitro can be prevented by
the antiestrogen ICI 182,780 and by actinomycin D, an
inhibitor of transcription.4 This observation
supports the hypothesis that the effects of estrogens in VSM are
primarily mediated through classic ER-dependent transcriptional
mechanisms. Interestingly, in ER
-deficient mice (ERKO), estrogens
inhibit VSM proliferation in response to vascular
injury.12 Because ERß is expressed in the vasculature of
these mice, this receptor subtype seems to be sufficient for mediating
the antiproliferative effects of estrogens.
If, as we propose, the predominant ER in a tissue determines the local physiological effects of estrogens, the clinical implications of the high prevalence of ERß in the vascular bed are considerable. The differential effects of ERß activation in the vascular bed offer an attractive hypothesis to explain why estrogens are inhibitory in this tissue but stimulatory in others.
| Acknowledgments |
|---|
Received August 30, 1999; revision received November 4, 1999; accepted November 15, 1999.
| References |
|---|
|
|
|---|
2.
Skafar DF, Xu R, Ram J, Sowers JR. Female sex hormones
and cardiovascular disease in women. J Clin
Endocrinol Metab. 1997;82:39133918.
3.
Chen S, Li H, Durand J, Oparil S, Chen Y-F. Estrogen
reduces myointimal proliferation after balloon injury of rat carotid
artery. Circulation. 1996;93:57784.
4. Kolodgie FD, Jacob A, Wilson PS, Carlson GC, Frab A, Verma A, Virmani R. Estradiol attenuates directed migration of vascular smooth muscle cells in vitro. Am J Pathol. 1996;148:969976.[Abstract]
5. Horwitz KB, Horwitz LD. Canine vascular tissues are targets for androgens, estrogens, progestins, and glucocorticoids. J Clin Invest. 1982;69:750758.
6. Kumar V, Green S, Sftack G, Berry M, Jinn J, Chambon P. Functional domains of the human estrogen receptor. Cell. 1987;51:941945.[Medline] [Order article via Infotrieve]
7.
Kuiper GGJM, Enmark E, Pelto-Huikko M, Nilsson S,
Gustafsson JA. Cloning of a novel estrogen receptor expressed in rat
prostate and ovary. Proc Nat Acad Sci U S A. 1996;93:59255930.
8. Mosselman S, Polman J, Dijkema R. ERß: identification and characterization of a novel human estrogen receptor. FEBS Lett. 1996;392:4953.[Medline] [Order article via Infotrieve]
9.
Pace P, Taylor J, Suntharalingam S, Coombes RC, Ali S.
Human estrogen receptor beta binds DNA in a manner similar to and
dimerizes with estrogen receptor alpha. J Biol Chem. 1997;272:2583225838.
10. McInerney EM, Katzenellenbogen BS. Different regions in activation function-1 of the human estrogen receptor required for antiestrogen- and estradiol-dependent transcription activation. J Biol Chem. 1996;27:2417224178.
11.
Kuiper GG, Carlsson B, Grandien K, Enmark E, Haggblad
J, Nilsson S, Gustafsson JA. Comparison of the ligand binding
specificity and transcript tissue distribution of estrogen receptors
alpha and beta. Endocrinology. 1997;138:863870.
12. Iafrati MD, Karas RH, Aronovitz M, Kim S, Sullivan TR Jr, Lubahn DB, ODonnell TAF Jr, Horach KS, Mendelsohn ME. Estrogen inhibits the vascular injury response in estrogen receptor alpha-deficient mice. Nat Med. 1997;3:545548.[Medline] [Order article via Infotrieve]
13. Register TC, Adams MR. Coronary artery and cultured aortic smooth muscle cells express mRNA for both the classical estrogen receptor and the newly described estrogen receptor beta. J Steroid Biochem Mol Biol. 1998;64:187191.[Medline] [Order article via Infotrieve]
14.
Hodges YK, Richer JK, Horwitz KB, Horwitz LD. Variant
estrogen and progesterone messages in human vascular smooth muscle.
Circulation. 1999;99:26882693.
15. Klein-Hitpass L, Schorpp M, Wagner U, Ryffel GU. An estrogen responsive element derived from the 5' flanking region of the xenopus vitellogenin A-2 gene functions in transfected human cells. Cell. 1986;46:10531061.[Medline] [Order article via Infotrieve]
16.
Sartorius CA, Melville MY, Hovland AR, Tung L, Takimoto
GS, Horwitz KB. A third transactivation function (AF3) of human
progesterone receptors located in the unique N-terminal segment of the
B-isoform. Mol Endocrinol. 1994;8:13471360.
17.
Hovland AR, Powell RL, Takimoto GS, Tung L, Horwitz KB.
An N-terminal inhibitory function, IF, suppresses
transcription by the A-isoform but not the B-isoform of human
progesterone receptors. J Biol Chem. 1998;273:54555460.
18.
Paech K, Webb P, Kuiper GGJM, Nilsson S, Gustafsson
J-A, Kushner PJ, Scanlan T. Differential ligand activation of estrogen
receptors ER
and ERß at AP1 sites. Science. 1997;277:15081510.
19.
Jackson TA, Richer JK, Bain DL, Takimoto GS, Tung L,
Horwitz KB. The partial agonist activity of
antagonist-occupied steroid receptors is controlled by a
novel hinge domain-binding coactivator L7/SPA and the
corepressors N-CoR or SMRT. Mol Endocrinol. 1997;11:693705.
20.
Hulley S, Grady D, Bush T, Furberg C, Herrington D,
Riggs B, Vittinghoff E. Randomized trial of estrogen plus progestin
for secondary prevention of coronary artery disease in
postmenopausal women: heart and estrogen/progestin replacement study
(HERS) research group. JAMA. 1998;280:605613.
21. Williams JK, Honore EK, Washburn SA, Clarkson TB. Effects of hormone replacement therapy on reactivity of atherosclerotic coronary arteries in cynomolgus monkeys. J Am Coll Cardiol.. 1994;24:17571761.[Abstract]
22. Miyagawa K, Roch J, Stanczyk F, Hersmeyer K. Medroxyprogesterone interfered with ovarian steroid protection against coronary vasospasm. Nat Med. 1997;3:324327.[Medline] [Order article via Infotrieve]
23.
Selzman CH, Gaynor JS, Turner AS, Johnson SM, Horwitz
LD, Whitehill TA, Harken AH. Ovarian ablation alone promotes
aortic intimal hyperplasia and accumulation of fibroblast growth
factor. Circulation. 1998;98:20492054.
24.
Chaidarun SS, Swearingen B, Alexander JM. Differential
expression of estrogen receptor-ß (ERß) in human pituitary
tumors: functional interactions with ER
and a tumor-specific splice
variant. J Clin Endocrinol Metab. 1998;83:33083315.
25. Inoue S, Hoshino S, Miyoshi H, Akishita M, Hosoi T, Orimo H, Ouchi Y. Identification of a novel isoform of estrogen receptor, a potential inhibitor of estrogen action, in vascular smooth muscle cells. Biochem Biophys Res Commun. 1996;219:766772.[Medline] [Order article via Infotrieve]
26. Berry M, Metzger D, Chambon P. Role of the two activating domains of the oestrogen receptor in the cell-type and promoter-context dependent agonistic activity of the anti-oestrogen 4-hydroxytamoxifen. EMBO J. 1990;9:9281192818.
27. Brzozowski AM, Pike ACW, Dauter Z, Hubbard RE, Bonn T, Engstrom O, Ohman L, Greene GL, Gustaffson JA, Carlquist M. Molecular basis of agonism and antagonism in the oestrogen receptor. Nature. 1997;389:753758.[Medline] [Order article via Infotrieve]
28. Nichols M, Rientjes JM, Stewart AF. Different positioning of the ligand-binding domain helix 12 and the F domain of the estrogen receptor accounts for functional differences between agonists and antagonists. EMBO J. 1998;17:765773.[Medline] [Order article via Infotrieve]
29. Watanabe T, Inoue S, Ogawa S, Ishii Y, Hiroi H, Ikeda K, Orimo A, Muramatsu M. Agonistic effect of tamoxifen is dependent on cell type, ERE-promoter context, and estrogen receptor subtype: functional difference between estrogen receptors alpha and beta. Biochem Biophys Res Commun. 1997;236:140145.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
S. Domingues-Montanari, I. Subirana, M. Tomas, J. Marrugat, and M. Senti Association between ESR2 Genetic Variants and Risk of Myocardial Infarction Clin. Chem., July 1, 2008; 54(7): 1183 - 1189. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. D. Patel and R. R. Arora Review: Endothelial dysfunction: A potential tool in gender related cardiovascular disease Therapeutic Advances in Cardiovascular Disease, April 1, 2008; 2(2): 89 - 100. [Abstract] [PDF] |
||||
![]() |
L. L. Yanes, J. C. Sartori-Valinotti, and J. F. Reckelhoff Sex Steroids and Renal Disease: Lessons From Animal Studies Hypertension, April 1, 2008; 51(4): 976 - 981. [Full Text] [PDF] |
||||
![]() |
G. Douglas, M. Natalia Cruz, L. Poston, J.-A. Gustafsson, and K. Kublickiene Functional characterization and sex differences in small mesenteric arteries of the estrogen receptor- knockout mouse Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2008; 294(1): R112 - R120. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Rexrode, P. M. Ridker, H. H. Hegener, J. E. Buring, J. E. Manson, and R. Y.L. Zee Polymorphisms and Haplotypes of the Estrogen Receptor-{beta} Gene (ESR2) and Cardiovascular Disease in Men and Women Clin. Chem., October 1, 2007; 53(10): 1749 - 1756. [Abstract] [Full Text] [PDF] |
||||
![]() |
Ma. E. D. Esqueda, T. Craig, and C. Hinojosa-Laborde Effect of Ovariectomy on Renal Estrogen Receptor-{alpha} and Estrogen Receptor-{beta} in Young Salt-Sensitive and -Resistant Rats Hypertension, October 1, 2007; 50(4): 768 - 772. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Traupe, C. D. Stettler, H. Li, E. Haas, I. Bhattacharya, R. Minotti, and M. Barton Distinct Roles of Estrogen Receptors {alpha} and {beta} Mediating Acute Vasodilation of Epicardial Coronary Arteries Hypertension, June 1, 2007; 49(6): 1364 - 1370. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Luksha, L. Poston, J.-A. Gustafsson, K. Hultenby, and K. Kublickiene The oestrogen receptor {beta} contributes to sex related differences in endothelial function of murine small arteries via EDHF J. Physiol., December 15, 2006; 577(3): 945 - 955. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Bolego, E. Vegeto, C. Pinna, A. Maggi, and A. Cignarella Selective Agonists of Estrogen Receptor Isoforms: New Perspectives for Cardiovascular Disease Arterioscler Thromb Vasc Biol, October 1, 2006; 26(10): 2192 - 2199. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. D. Zoma, R. S. Baker, J. L. Mershon, and K. E. Clark Hemodynamic effects of acute and repeated exposure to raloxifene in ovariectomized sheep Am J Physiol Heart Circ Physiol, September 1, 2006; 291(3): H1216 - H1225. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. Christian, P. Y. Liu, S. Harrington, M. Ruan, V. M. Miller, and L. A. Fitzpatrick Intimal Estrogen Receptor (ER){beta}, But Not ER{alpha} Expression, Is Correlated with Coronary Calcification and Atherosclerosis in Pre- and Postmenopausal Women J. Clin. Endocrinol. Metab., July 1, 2006; 91(7): 2713 - 2720. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Meyer, E. Haas, and M. Barton Gender Differences of Cardiovascular Disease: New Perspectives for Estrogen Receptor Signaling Hypertension, June 1, 2006; 47(6): 1019 - 1026. [Full Text] [PDF] |
||||
![]() |
M. N. Cruz, L. Luksha, H. Logman, L. Poston, S. Agewall, and K. Kublickiene Acute responses to phytoestrogens in small arteries from men with coronary heart disease Am J Physiol Heart Circ Physiol, May 1, 2006; 290(5): H1969 - H1975. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Han, X. Yu, L. Lu, S. Li, H. Ma, S. Zhu, X. Cui, and R. E. White Estrogen Receptor {alpha} Mediates Acute Potassium Channel Stimulation in Human Coronary Artery Smooth Muscle Cells J. Pharmacol. Exp. Ther., March 1, 2006; 316(3): 1025 - 1030. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Jayachandran and V. M. Miller Mechanisms of estrogenic vascular protection Am J Physiol Heart Circ Physiol, February 1, 2006; 290(2): H507 - H508. [Full Text] [PDF] |
||||
![]() |
M. N. Cruz, G. Douglas, J.-A Gustafsson, L. Poston, and K. Kublickiene Dilatory responses to estrogenic compounds in small femoral arteries of male and female estrogen receptor-{beta} knockout mice Am J Physiol Heart Circ Physiol, February 1, 2006; 290(2): H823 - H829. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. G. Mishra, F. Z. Stanczyk, K. A. Burry, S. Oparil, B. S. Katzenellenbogen, M. L. Nealen, J. A. Katzenellenbogen, and R. K. Hermsmeyer Metabolite ligands of estrogen receptor-{beta} reduce primate coronary hyperreactivity Am J Physiol Heart Circ Physiol, January 1, 2006; 290(1): H295 - H303. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Luksha, L. Poston, J.-A. Gustafsson, L. Aghajanova, and K. Kublickiene Gender-Specific Alteration of Adrenergic Responses in Small Femoral Arteries From Estrogen Receptor-{beta} Knockout Mice Hypertension, November 1, 2005; 46(5): 1163 - 1168. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Natoli, T. L. Medley, A. A. Ahimastos, B. G. Drew, D. J. Thearle, R. J. Dilley, and B. A. Kingwell Sex Steroids Modulate Human Aortic Smooth Muscle Cell Matrix Protein Deposition and Matrix Metalloproteinase Expression Hypertension, November 1, 2005; 46(5): 1129 - 1134. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Dhawan, Z. L. S. Brookes, and S. Kaufman Repeated pregnancies (multiparity) increases venous tone and reduces compliance Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2005; 289(1): R23 - R28. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Rzewuska-Lech, M. Jayachandran, L. A. Fitzpatrick, and V. M. Miller Differential effects of 17{beta}-estradiol and raloxifene on VSMC phenotype and expression of osteoblast-associated proteins Am J Physiol Endocrinol Metab, July 1, 2005; 289(1): E105 - E112. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Bolego, A. Cignarella, P. Sanvito, V. Pelosi, F. Pellegatta, L. Puglisi, and C. Pinna The Acute Estrogenic Dilation of Rat Aorta Is Mediated Solely by Selective Estrogen Receptor-{alpha} Agonists and Is Abolished by Estrogen Deprivation J. Pharmacol. Exp. Ther., June 1, 2005; 313(3): 1203 - 1208. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Byers, A. Zangl, T. M. Phernetton, G. Lopez, D.-b. Chen, and R. R. Magness Endothelial vasodilator production by ovine uterine and systemic arteries: ovarian steroid and pregnancy control of ER{alpha} and ER{beta} levels J. Physiol., May 15, 2005; 565(1): 85 - 99. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Scotland, M. Madhani, S. Chauhan, S. Moncada, J. Andresen, H. Nilsson, A. J. Hobbs, and A. Ahluwalia Investigation of Vascular Responses in Endothelial Nitric Oxide Synthase/Cyclooxygenase-1 Double-Knockout Mice: Key Role for Endothelium-Derived Hyperpolarizing Factor in the Regulation of Blood Pressure in Vivo Circulation, February 15, 2005; 111(6): 796 - 803. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Y. Liu, R. C. Christian, M. Ruan, V. M. Miller, and L. A. Fitzpatrick Correlating Androgen and Estrogen Steroid Receptor Expression with Coronary Calcification and Atherosclerosis in Men without Known Coronary Artery Disease J. Clin. Endocrinol. Metab., February 1, 2005; 90(2): 1041 - 1046. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. K. Dubey, E. K. Jackson, D. G. Gillespie, M. Rosselli, F. Barchiesi, A. Krust, H. Keller, L. C. Zacharia, and B. Imthurn Cytochromes 1A1/1B1- and Catechol-O-Methyltransferase-Derived Metabolites Mediate Estradiol-Induced Antimitogenesis in Human Cardiac Fibroblast J. Clin. Endocrinol. Metab., January 1, 2005; 90(1): 247 - 255. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Nakamura, K. Igarashi, T. Suzuki, J. Kanno, T. Inoue, C. Tazawa, M. Saruta, T. Ando, N. Moriyama, T. Furukawa, et al. E4F1, a Novel Estrogen-Responsive Gene in Possible Atheroprotection, Revealed by Microarray Analysis Am. J. Pathol., December 1, 2004; 165(6): 2019 - 2031. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. M. Miller, D. J. Tindall, and P. Y. Liu Of Mice, Men, and Hormones Arterioscler Thromb Vasc Biol, June 1, 2004; 24(6): 995 - 997. [Full Text] [PDF] |
||||
![]() |
F. Barchiesi, E. K. Jackson, B. Imthurn, J. Fingerle, D. G. Gillespie, and R. K. Dubey Differential Regulation of Estrogen Receptor Subtypes {alpha} and {beta} in Human Aortic Smooth Muscle Cells by Oligonucleotides and Estradiol J. Clin. Endocrinol. Metab., May 1, 2004; 89(5): 2373 - 2381. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Orshal and R. A. Khalil Gender, sex hormones, and vascular tone Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2004; 286(2): R233 - R249. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. L. Wynne, J. A. Payne, A. E. Cain, J. F. Reckelhoff, and R. A. Khalil Age-Related Reduction in Estrogen Receptor-Mediated Mechanisms of Vascular Relaxation in Female Spontaneously Hypertensive Rats Hypertension, February 1, 2004; 43(2): 405 - 412. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Fitzpatrick Hormones and the Heart: Controversies and Conundrums J. Clin. Endocrinol. Metab., December 1, 2003; 88(12): 5609 - 5610. [Full Text] [PDF] |
||||
![]() |
J. D. Wagner, D. C. Schwenke, K. A. Greaves, L. Zhang, M. S. Anthony, R. M. Blair, M. K. Shadoan, and J. K. Williams Soy Protein With Isoflavones, but not an Isoflavone-Rich Supplement, Improves Arterial Low-Density Lipoprotein Metabolism and Atherogenesis Arterioscler Thromb Vasc Biol, December 1, 2003; 23(12): 2241 - 2246. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Nakamura, Y. Miki, T. Suzuki, T. Nakata, A. D. Darnel, T. Moriya, C. Tazawa, H. Saito, T. Ishibashi, S. Takahashi, et al. Steroid Sulfatase and Estrogen Sulfotransferase in the Atherosclerotic Human Aorta Am. J. Pathol., October 1, 2003; 163(4): 1329 - 1339. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Watanabe, M. Akishita, T. Nakaoka, K. Kozaki, Y. Miyahara, H. He, Y. Ohike, T. Ogita, S. Inoue, M. Muramatsu, et al. Estrogen receptor {beta} mediates the inhibitory effect of estradiol on vascular smooth muscle cell proliferation Cardiovasc Res, September 1, 2003; 59(3): 734 - 744. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. M Steinberg, N. L Guthrie, A. C Villablanca, K. Kumar, and M. J Murray Soy protein with isoflavones has favorable effects on endothelial function that are independent of lipid and antioxidant effects in healthy postmenopausal women Am. J. Clinical Nutrition, July 1, 2003; 78(1): 123 - 130. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. C. W. Wu and A. von Eckardstein Androgens and Coronary Artery Disease Endocr. Rev., April 1, 2003; 24(2): 183 - 217. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. K. Mukherjee, L. Nathan, H. Dinh, S. T. Reddy, and G. Chaudhuri 17-Epiestriol, an Estrogen Metabolite, Is More Potent Than Estradiol in Inhibiting Vascular Cell Adhesion Molecule 1 (VCAM-1) mRNA Expression J. Biol. Chem., March 28, 2003; 278(14): 11746 - 11752. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Liew, J. K. Williams, P. Collins, and K. T. MacLeod Soy-Derived Isoflavones Exert Opposing Actions on Guinea Pig Ventricular Myocytes J. Pharmacol. Exp. Ther., March 1, 2003; 304(3): 985 - 993. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Tatchum-Talom, C. Martel, F. Labrie, and A. Marette Acute vascular effects of the selective estrogen receptor modulator EM-652 (SCH 57068) in the rat mesenteric vascular bed Cardiovasc Res, February 1, 2003; 57(2): 535 - 543. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Bracamonte, M. Jayachandran, K. S. Rud, and V. M. Miller Acute effects of 17beta -estradiol on femoral veins from adult gonadally intact and ovariectomized female pigs Am J Physiol Heart Circ Physiol, December 1, 2002; 283(6): H2389 - H2396. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E. Gargett, M. Zaitseva, K. Bucak, S. Chu, P. J. Fuller, and P. A. W. Rogers 17{beta}-Estradiol Up-Regulates Vascular Endothelial Growth Factor Receptor-2 Expression in Human Myometrial Microvascular Endothelial Cells: Role of Estrogen Receptor-{alpha} and -{beta} J. Clin. Endocrinol. Metab., September 1, 2002; 87(9): 4341 - 4349. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. F. Verdu, Y. Deng, P. Bercik, and S. M. Collins Modulatory effects of estrogen in two murine models of experimental colitis Am J Physiol Gastrointest Liver Physiol, July 1, 2002; 283(1): G27 - G36. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Barchiesi, E. K. Jackson, D. G. Gillespie, L. C. Zacharia, J. Fingerle, and R. K. Dubey Methoxyestradiols Mediate Estradiol-Induced Antimitogenesis in Human Aortic SMCs Hypertension, April 1, 2002; 39(4): 874 - 879. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. S Mikkola and T. B Clarkson Estrogen replacement therapy, atherosclerosis, and vascular function Cardiovasc Res, February 15, 2002; 53(3): 605 - 619. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. V. Pham and M. R. Rosen Sex, hormones, and repolarization Cardiovasc Res, February 15, 2002; 53(3): 740 - 751. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. G. Geary, A. M. McNeill, J. A. Ospina, D. N. Krause, K. S. Korach, and S. P. Duckles Genome and Hormones: Gender Differences in Physiology: Selected Contribution: Cerebrovascular NOS and cyclooxygenase are unaffected by estrogen in mice lacking estrogen receptor-alpha J Appl Physiol, November 1, 2001; 91(5): 2391 - 2399. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. K. Dubey and E. K. Jackson Estrogen-induced cardiorenal protection: potential cellular, biochemical, and molecular mechanisms Am J Physiol Renal Physiol, March 1, 2001; 280(3): F365 - F388. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Jankowski, G. Rachelska, W. Donghao, S. M. McCann, and J. Gutkowska Estrogen receptors activate atrial natriuretic peptide in the rat heart PNAS, September 25, 2001; 98(20): 11765 - 11770. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2000 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |