(Circulation. 2000;102:2197.)
© 2000 American Heart Association, Inc.
Clinical Investigation and Reports |
Common Cholesteryl Ester Transfer Protein Mutations, Decreased HDL Cholesterol, and Possible Decreased Risk of Ischemic Heart Disease
The Copenhagen City Heart Study
From the Department of Clinical Biochemistry, Herlev University Hospital (B.A.-L., B.G.N.), The Copenhagen City Heart Study, Bispebjerg University Hospital (A.T.-H., P.S., B.G.N.), and the Department of Clinical Biochemistry (A.T.-H.) and the Department of Medicine B, Division of Cardiology (R.S.), Copenhagen University Hospital, University of Copenhagen, Copenhagen, Denmark.
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Background—Cholesteryl ester transfer protein (CETP) mediates the transfer of cholesteryl ester from HDL in exchange for triglycerides in apolipoprotein B–containing lipoproteins.
Methods and Results—We studied 2 common mutations in CETP, A373P and R451Q, in 8467 healthy women and men from the Danish general population and in 1636 Danish women and men with ischemic heart disease. The prevalence of 373P and 451Q was 0.10 and 0.07, respectively, for heterozygous carriers and 0.003 and 0.002, respectively, for homozygous carriers. All carriers of the 451Q allele also carried the 373P allele. HDL cholesterol in female noncarriers, heterozygotes, and homozygotes of 373P was 1.74±0.01 (mean±SE), 1.62±0.02, and 1.38±0.09 mmol/L, respectively (ANOVA, P<0.001). In men, equivalent values were 1.40±0.01, 1.26±0.02, and 1.19±0.09 mmol/L, respectively (ANOVA, P<0.001). HDL cholesterol decreased similarly as a function of 451Q genotypes and all 373P/451Q genotype combinations. Furthermore, apolipoprotein AI and the HDL cholesterol/apolipoprotein AI ratio was also lower in carriers of either of these mutations for both sexes. Finally, the CETP genotype was not associated with risk of ischemic heart disease unless we adjusted for HDL cholesterol: female heterozygous and homozygous carriers versus noncarriers had 36% lower risk of ischemic heart disease (95% CI 4% to 57%); in male carriers, we observed a similar trend.
Conclusions—The A373P/R451Q polymorphism in CETP is associated with decreases in HDL cholesterol of 0.12 to 0.36 mmol/L in women and 0.14 to 0.21 mmol/L in men and possibly with a paradoxical 36% decrease in the risk of ischemic heart disease in women.
Key Words: epidemiology • lipids • heart diseases • ischemia
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Ischemic heart disease (IHD) is the most common cause of death in affluent parts of the world. Low plasma levels of HDL cholesterol are associated with increased risk of IHD.1 It is still questionable, however, whether low HDL cholesterol per se causes IHD or is merely a marker for other causative factors.
Cholesteryl ester transfer protein (CETP) exchanges cholesteryl ester in HDL particles for triglycerides in apolipoprotein B–containing lipoproteins.2 3 Consequently, mutations in CETP may influence HDL cholesterol levels and thereby the risk of IHD.2
We examined whether the A373P and R451Q substitutions4 5 in CETP influence the plasma levels of HDL cholesterol and other lipids, lipoproteins, and apolipoproteins and the risk of IHD. We genotyped 8467 healthy women and men drawn from the Danish general population (the Copenhagen City Heart Study) and 1636 Danish women and men with IHD.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Subjects
We studied 5064 women and 4102 men drawn randomly from the Danish general population, the Copenhagen City Heart Study.6 7 8 9 Of these subjects, 270 women and 428 men had IHD. These patients together with another 245 female and 693 male patients with IHD6 7 8 9 were compared with subjects without IHD in the Copenhagen City Heart Study by use of a case-control design. Of all subjects, 99% were white and of Danish descent. The study was approved by Danish ethic committees (Nos. 100.2039/91 and KA 93125).
Because healthy subjects from the general population and patients were sampled in 1991 to 1994 before publication of the Scandinavian Simvastatin Survival Study,10 only 0.3% of healthy subjects and 7% of patients with IHD were on cholesterol-lowering therapy. There was no difference in genotype frequencies between subjects receiving cholesterol-lowering therapy and untreated subjects.
DNA Analyses
A G
C mutation at codon 373 in exon 12 of CETP
leads to a proline for alanine substitution (A373P), and a GA
mutation at codon 451 in exon 15 of CETP leads to a
substitution of glutamine for arginine (R451Q).4 5
Exon 12 was amplified by use of a primer overlapping the intron 11/exon
12 splice site (5' GTTTCTCTCCCCAGGATATCGTGAC 3') and a primer at the 3'
end of exon 12 (5' GTCAAGTTGGAAACAGTCTTTGGTG 3'); exon 15 was amplified
by use of a primer overlapping the intron 14/exon 15 splice site (5'
TCGCCCAGGGCTCGAGGTAGTGTTT '3) and a primer 
150 bp upstream from exon
16 (5' ACCCAACTTCCACCACGCTG 3'). For the A373P mutation, the
restriction enzyme digestion by StuI resulted in a common
band (on 3% agarose) of 206 bp plus bands of 36 and 281 bp for the
alanine allele and a band of 317 bp for the proline allele. For
the R451Q mutation, the result of digestion with the restriction enzyme
XhoI was a common band of 11 bp plus bands of 62 and 362 bp
for the arginine allele and a band of 424 bp for the glutamine
allele.
Inconsistency was found between observed and predicted bands for exon and intron 12 (GenBank accession Nos. AC:M32997 and ID:HSCETP6); therefore, we sequenced exon and intron 12. Compared with the GenBank HSCETP6 sequence, a 13-bp DNA deletion from position 643 to 655 in intron 12 and an insertion of 97 bp were found at this position by us; the following sequence was as follows: 5' A G G G C C T G G C A G G A G G A G A G C G C T G C C C G A G C A A A G G C C T G G C C G C C A G A A T A G C A A A T C T C A A G G G A A T A G C A A A T C T C A A G A G A G T G C C C C A A A G 3' (GenBank accession No. AF210631).
Other Analyses
Plasma levels of total cholesterol, HDL
cholesterol, apolipoprotein AI, apolipoprotein B,
lipoprotein(a), and triglycerides were measured by
enzymatic and turbidimetric assays.6
Statistical Analyses
SPSS release 8.5 was used. A value of P<0.05 was
considered significant. We used the Student t test,
Mann-Whitney U test, ANOVA, Kruskal-Wallis ANOVA, ANCOVA (to
test for interaction between genotype and
cardiovascular risk factors on lipoprotein levels),
likelihood ratio test, and 
2 test.
Multifactorial logistic regression analysis examined the association between CETP genotype and the risk of IHD. Models were adjusted for (1) age, (2) age, body mass index, total cholesterol, triglycerides, cholesterol-lowering treatment, smoking habits, diabetes mellitus, and hypertension, or (3) all above-mentioned variables plus HDL cholesterol. We also tested for interaction between genotype and cardiovascular risk factors on IHD.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
HDL cholesterol was lower, and age, triglycerides, cholesterol, apolipoprotein B, lipoprotein(a), body mass index, and the relative frequencies of hypertension, diabetes mellitus, and former smoking status were higher in female and male patients with IHD than in women and men from the general population without IHD (Table 1
). Female patients had slightly lower
apolipoprotein AI than did healthy women from the general population,
and fewer male patients were active smokers than were healthy men from
the general population (patients often become exsmokers).
|
Genotype Frequencies
The numbers of subjects with A373P and R451Q CETP
genotypes in the general population are shown in Table 2. Observed frequencies of A373P
genotypes were consistent with those predicted by the
Hardy-Weinberg equilibrium (2,
P>0.60), as were observed frequencies of R451Q
genotypes (2, P>0.30).
There was deviation between observed and expected numbers of the 9
possible combinations of the 2 mutations (Pearson
2, P<0.001). Whenever a subject
carried the 451Q allele, the 373P allele was also present,
except for one subject, whereas the 373P mutation was observed in 282
subjects who did not carry the 451Q variant (Table 2). The one
subject with the 451Q variant without the 373P variant was confirmed by
sequencing.
|
HDL Cholesterol
Plasma levels of HDL cholesterol differed as a
function of A373P genotypes in both women and men (both ANOVAs,
P<0.001; Figure 1); there was
no interaction between A373P genotype and sex for HDL
cholesterol (ANCOVA, P=0.40). On post hoc tests,
heterozygous carriers of the 373P allele had lower levels of HDL
cholesterol than did noncarriers for both sexes
(P<0.001). HDL cholesterol also differed as a
function of R451Q genotypes in both women and men (both ANOVAs,
P<0.001; Figure 1). On post hoc tests, heterozygous
carriers of the 451Q allele had lower levels than did noncarriers
for both sexes (P<0.001).
|
HDL cholesterol levels also differed as a function of
genotype in both women and men when both A373P and R451Q
genotypes were considered together (both ANOVAs,
P<0.001; Figure 1
). Post hoc tests showed that
double heterozygous carriers of the 451Q and 373P alleles (AP and
RQ) had even lower HDL cholesterol than did single
heterozygous carriers of the 373P allele (AP and RR) for women
(P<0.05) but not for men.
The association between genotype and HDL
cholesterol in women was also observed in premenopausal
women and in postmenopausal women not treated with hormonal replacement
therapy (HRT) but not in postmenopausal women treated with HRT (Figure 2). However, the test of interaction
between HRT and A373P genotype was not statistically
significant (ANCOVA, P=0.77).
|
Other Lipids, Lipoproteins, and Apolipoproteins
Plasma levels of apolipoprotein AI and the ratio of HDL
cholesterol to apolipoprotein AI differed as a function of
A373P and R451Q genotypes in both women and men (all ANOVAs,
P<0.001; Table 3). Post hoc
tests showed that heterozygous carriers of 373P or 451Q versus
noncarriers had lower levels of apolipoprotein AI and HDL
cholesterol/apolipoprotein AI ratios in both women and men
(P<0.001). Levels of plasma triglycerides,
cholesterol, apolipoprotein B, and lipoprotein(a) were
statistically unaffected; however, there was a trend toward a
genotype-dependent decrease in cholesterol in men
for both mutations and in women for the A373P mutation (Table 3). Although the CETP genotype was associated
with different levels of HDL cholesterol and not with
different levels of triglycerides, HDL
cholesterol and plasma triglycerides were, as
expected, inversely correlated in the cohort (data not shown).
|
We also performed 504 tests of interaction on total cholesterol, triglycerides, HDL cholesterol, and apolipoprotein AI for each sex separately between genotypes (A373P, R451Q, or combination) and age, total cholesterol, apolipoprotein B, lipoprotein(a), triglycerides, HDL cholesterol, apolipoprotein AI, fibrinogen, body mass index, waist/hip ratio, glucose, alcohol consumption, smoking, physical activity, blood pressure, hypertension, diabetes mellitus, menopausal status (women), HRT (women), diuretic medication, heart medication, and medication against high blood pressure. The vast majority of these tests were not statistical significant, and among variables with a value of P<0.05, plots of stratified data did not reveal monotonic and consistent associations but revealed different irregular patterns suggesting chance findings rather than plausible interactions. Furthermore, when correction for multiple comparison was done, none of the tests of interaction were significant.
Risk of IHD
Because stratified analysis suggested that risk of IHD was
associated with CETP genotype in untreated women but
not in treated women (in accordance with associations with HDL
cholesterol, Figure 2), results are shown separately
for untreated premenopausal and postmenopausal women and postmenopausal
women treated with HRT (Figure 3).
However, the test of interaction between HRT and A373P genotype
on IHD risk was not statistically significant (likelihood ratio test,
P=0.17).
|
When we adjusted for age alone or a group of risk factors,
CETP genotype was not significantly associated with
the risk of IHD (Figure 3). When we adjusted for a group of risk
factors plus HDL cholesterol, untreated women carrying
CETP 451Q and/or 373P had a 36% lower risk of IHD compared
with noncarriers (odds ratio 0.64, 95% CI 0.43 to 0.96; Figure 3). There was a similar trend in male carriers compared with
noncarriers (odds ratio 0.86, 95% CI 0.67 to 1.12) but not in female
carriers on HRT (odds ratio 1.51, 95% CI 0.63 to 3.62). Sex did not
interact with genotype for the risk of IHD (likelihood ratio
test, P=0.28).
In addition, we tested for interaction between genotype and age, total cholesterol, triglycerides, body mass index, smoking, physical activity, hypertension, diabetes mellitus, menopausal status (women), and cholesterol-lowering medication on the risk of IHD for each sex separately. None of these tests reached statistical significance. This means that the association between CETP genotype and IHD risk does not depend on the presence or absence of these risk factors.
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
In this sample from the Danish general population, the relative allele frequency of CETP 373P was 5.6%, and that of CETP 451Q was 3.8%. The present data suggest linkage of the 451Q allele with the 373P allele, not documented previously. This linkage is most likely because the 451Q mutation occurred on an existent 373P allele. One subject was heterozygous for the 451Q allele without carrying the 373P allele; ie, there was a haplotype frequency of 1/(2x9166)= 5.5x10-5 in the population at large.
HDL Cholesterol
Our data suggest that the 373P mutation alone is associated with
lower HDL cholesterol levels. Furthermore, it is possible
that the 373P and 451Q mutations combined versus 373P alone are
associated with even lower HDL cholesterol levels,
particularly in women. We cannot exclude that the lower HDL
cholesterol associated with the 451Q mutation is due to
linkage disequilibrium with 373P. Homozygous subjects with either or
both mutations may have lower HDL cholesterol levels than
heterozygous subjects, although in most instances, this was not
statistically significant, most likely because of a lack of power due
to the relatively few homozygous subjects (4 to 13 homozygous subjects
per group, Figure 1).
The fact that carriers of mutant alleles versus noncarriers had lower HDL cholesterol, apolipoprotein AI, and HDL cholesterol/apolipoprotein AI ratios indicates that carriers compared with noncarriers have fewer HDL particles, with each carrying less cholesterol. A biologically plausible explanation for such an association could be that the mutation at position 373 (and/or 451) induces higher CETP activity, transferring more cholesteryl esters out of HDL particles in carriers than in noncarriers. We were not able to test this hypothesis in the Copenhagen City Heart Study; however, a previous Finnish study of 21 noncarriers and 7 heterozygous carriers of the R451Q variant suggested that plasma CETP activity was higher by 26% in male carriers compared with noncarriers (P<0.01).5 This would reduce the amount of cholesteryl ester within each HDL particle and perhaps also stimulate downregulation of the total number of HDL particles. This hypothesis also implies that fewer HDL particles would be available for reverse cholesterol transport, a potentially deleterious effect, which could be counteracted by a faster turnover of cholesterol in HDL particles due to the increased CETP activity, and would thereby induce the decrease in risk of IHD that we have observed in untreated women. This hypothesis is supported by in vitro studies showing that interaction of HDL with CETP promotes the generation of small pre-ß migrating HDL particles, which are the preferred acceptors of cell cholesterol promoting reverse cholesterol transport.11
The A373P and R451Q variants are situated 2000 bp apart in the
CETP gene and 78 amino acids apart in the terminal region of
the 476 amino acid CETP protein.12 13
Structure-function studies of CETP have shown that insertion
mutagenesis at codon 373-379 in exon 12 resulted in impaired CETP
activity,13 suggesting that an amino acid substitution at
position 373 may in fact affect CETP activity. Codon 451 in exon 15 is
located in the putative lipid-binding region.12 13 14 An
amino acid substitution such as the present (resulting in loss of
positive charge at this position) could therefore influence the binding
of CETP to HDL cholesteryl ester and thereby indirectly affect the
efficiency of the protein transferring cholesteryl ester out of HDL
particles. Therefore, it seems plausible that these 2 substitutions may
affect the activity of CETP and, through this effect, decrease the
levels of HDL cholesterol. Further studies of structure and
function of CETP in carriers of these genetic variants may help explain
the apparent paradoxical association of the CETP
genotypes with HDL cholesterol and IHD risk.
Risk of IHD
This is the first study to present data suggesting that
CETP mutations increasing CETP activity lead to decreased
HDL cholesterol and possibly a lower risk of IHD in
carriers. However, the association with a lower risk of IHD was found
only in untreated women and not in those treated with HRT, whereas in
men, there was only a similar trend. Furthermore, this association was
seen only after we adjusted for a group of risk factors and HDL
cholesterol. Therefore, our findings on the risk of IHD
should be interpreted with caution until confirmed by another
independent group.
Nevertheless, our results are indirectly supported by the opposite observation: low plasma CETP activity is associated with high HDL cholesterol and possibly with high risk of IHD.2 9 15 16 17 18 The finding that the B1 versus B2 CETP allele was associated with higher CETP concentrations, lower HDL cholesterol, and the progression of coronary atherosclerosis may seem to contradict this idea19 ; however, this intron variant probably is not the causative mutation, and the end points studied in this19 and other 2 9 15 16 17 18 studies differ. Taken together, CETP mutations leading to increased HDL cholesterol levels may increase the risk of IHD, whereas the present study suggests that CETP mutations associated with low HDL cholesterol possibly may lead to the opposite situation, namely, a low risk of IHD.
Mutations that increase CETP activity may increase reverse
cholesterol transport and thus slow the progression of
atherosclerosis, ultimately leading to a reduced risk
of IHD.2 Altered CETP activity could also lead to altered
hepatic production of apolipoprotein B,20 which is
likewise of importance in the development of
atherosclerosis; however, in our sample,
CETP genotype was not associated with a variation in
plasma apolipoprotein B levels (Table 3). Furthermore, the
association between CETP genotype and reduced risk
of IHD was not influenced by differences in apolipoprotein B levels
(data not shown).
Interaction With HRT and Sex
An interaction between CETP genotype and HRT in
predicting HDL cholesterol and IHD risk seems plausible,
because as reported in other studies, HRT raises HDL
cholesterol in women (Copenhagen City Heart Study) and
thereby may override the effect of CETP genotype.
However, it should be emphasized that statistical tests could not
document the interaction between CETP genotype and
HRT on either HDL cholesterol levels or risk of IHD, most
likely because of the relatively few women in the postmenopausal group
(see Figure 2).
The association between CETP genotype and HDL
cholesterol levels was similar for the 2 sexes, but it was
largest in women, whereas IHD risk was lower in untreated female
carriers versus noncarriers but was statistically unaffected in male
carriers. Nevertheless, we cannot exclude that the association with IHD
risk may indeed be similar in men and women, because (1) when HDL
cholesterol was adjusted for, we observed a trend toward
lower risk in male carriers (see Figure 3), and (2)
genotype and sex did not interact in predicting IHD risk with
statistical significance. On the other hand, because CETP levels appear
higher in women than in men,21 22 it is not unlikely
that mutations in CETP could influence IHD risk differently in women
and men.
Interaction With Other Covariates
CETP mutations may be particularly important in
mediating lipoprotein-related risk of IHD in patients with diabetes
mellitus. However, we had only 122 women and 184 men with diabetes
mellitus in the Copenhagen City Heart Study. Therefore, although we
were not able to show interaction between genotype and diabetes
mellitus on HDL cholesterol or risk of IHD, we cannot fully
exclude such interactions.
Alcohol intake may also influence associations between CETP genotype and lipoproteins and risk of IHD.23 We did not observe an interaction between CETP genotype and alcohol intake on HDL cholesterol in the present study, and we were not able to test for the interaction on IHD risk because we lacked information on alcohol intake among patients with IHD.
Conclusions
We demonstrate that CETP 373P/451Q alleles are
associated with decreases in HDL cholesterol of 0.12 to
0.36 mmol/L (7% to 21%) in women and 0.14 to 0.21 mmol/L
(10% to 15%) in men and possibly with a paradoxical 36% lower risk
of IHD in women. These data support the hypothesis that it may not be
the low HDL cholesterol per se that explains the strong
inverse association between HDL cholesterol levels and IHD
risk observed in prospective epidemiological population
studies.1 This also implies that some individuals
with low HDL cholesterol may have a reduced rather than an
increased risk of IHD and vice versa for some individuals with high HDL
cholesterol. Finally, the data suggest that genotyping for
CETP mutations may improve cardiovascular
risk assessment in the future.
|
Acknowledgments |
|---|
This study was supported by The Danish Heart Foundation, The Danish Medical Research Council, The Danish Research Academy, Copenhagen County, Johann and Hanne Weimann’s Fund, and Chief Physician Johan Boserup and Lise Boserup’s Fund. We appreciate the technical assistance of Charlotte Worm, Anne-Merete Bengtson, and Hanne Damm.
|
Footnotes |
|---|
Reprint requests to Børge G. Nordestgaard, MD, DMSc, Department of Clinical Biochemistry, Herlev University Hospital, Herlev Ringvej 75, DK-2730 Herlev, Denmark.
Received February 22, 2000; revision received June 9, 2000; accepted June 14, 2000.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Gordon DJ, Probstfield JL, Garrison RJ, et al. High-density lipoprotein cholesterol and cardiovascular disease: four prospective American studies. Circulation. 1989;79:8–15.
2. Yamashita S, Sakai N, Hirano K, et al. Molecular genetics of plasma cholesteryl ester transfer protein. Curr Opin Lipidol. 1997;8:101–110.[Medline] [Order article via Infotrieve]
3. Barter P, Rye KA. Cholesteryl ester transfer protein: its role in plasma lipid transport. Clin Exp Pharmacol Physiol. 1994;21:663–672.[Medline] [Order article via Infotrieve]
4. Hill SA, Nazir DJ, Jayaratne P, et al. Mutations in cholesteryl ester transfer protein and hepatic lipase in a North American population. Clin Biochem. 1997;30:413–418.[Medline] [Order article via Infotrieve]
5. Kakko S, Tamminen M, Kesäniemi YA, et al. R451Q mutation in the cholesteryl ester transfer protein (CETP) gene is associated with high plasma CETP activity. Atherosclerosis. 1998;136:233–240.[Medline] [Order article via Infotrieve]
6.
Agerholm-Larsen B, Nordestgaard BG, Steffensen R, et
al. ACE gene polymorphism, ischemic heart disease and
longevity in 10,150 individuals: a case-referent and retrospective
cohort study based on the Copenhagen City Heart Study.
Circulation. 1997;95:2358–2367.
7.
Nordestgaard BG, Abildgaard S, Wittrup HH, et al.
Heterozygous lipoprotein lipase deficiency, frequency in the general
population, effect on plasma lipid levels, and risk of ischemic
heart disease. Circulation. 1997;96:1737–1744.
8.
Tybjaerg-Hansen A, Steffensen R, Meinertz H, et al.
Association of mutations in the apolipoprotein B gene with
hypercholesterolemia and the risk of
ischemic heart disease. N Engl J Med. 1998;338:1577–1584.
9.
Agerholm-Larsen B, Nordestgaard BG, Steffensen R, et
al. Elevated HDL cholesterol is a risk factor for
ischemic heart disease in white women when caused by a common
mutation in the cholesteryl ester transfer protein gene.
Circulation. 2000;101:1907–1912.
10. The Scandinavian Simvastatin Survival Study Group. Randomised trial of cholesterol lowering in 4444 patients with coronary heart disease: the Scandinavian Simvastatin Survival Study (4S). Lancet. 1999;344:1383–1389.
11. Barter PJ, Rye KA. High density lipoproteins and coronary heart disease. Atherosclerosis. 1996;121:1–12.[Medline] [Order article via Infotrieve]
12. Agellon LB, Quinet EM, Gillette TG, et al. Organization of the human cholesteryl ester transfer protein gene. Biochemistry.. 1990;29:1372–1376.[Medline] [Order article via Infotrieve]
13. Drayna D, Jarnagin AS, McLean, et al. Cloning and sequencing of human cholesteryl ester transfer protein cDNA. Nature.. 1987;327:632–634.[Medline] [Order article via Infotrieve]
14.
Wang S, Deng L, Milne RW, Tall AR. Identification of a
sequence within the C-terminal 26 amino acids of cholesteryl ester
transfer protein responsible for binding a neutralizing monoclonal
antibody and necessary for neutral lipid transfer activity.
J Biol Chem. 1992;267:17487–17490.
15.
Hirano K, Yamashita S, Nakajima N, et al. Genetic
cholesteryl ester transfer protein deficiency is extremely frequent in
the Omagari area of Japan: marked hyperalphalipoproteinemia caused by
CETP gene mutation is not associated with longevity. Arterioscler
Thromb Vasc Biol. 1997;17:1053–1059.
16. Zhong S, Sharp DS, Grove JS, et al. Increased coronary heart disease in Japanese-American men with mutation in the cholesteryl ester transfer protein gene despite increased HDL levels. J Clin Invest. 1996;97:2917–2923.[Medline] [Order article via Infotrieve]
17.
Bruce C, Sharp DS, Tall AR. Relationship of HDL and
coronary heart disease to a common amino acid polymorphism
in the cholesteryl ester transfer protein in men with and without
hypertriglyceridemia. J Lipid
Res. 1998;39:1071–1078.
18. Tenkanen H, Koshinen P, Kontula K, et al. Polymorphisms of the gene encoding cholesterol ester transfer protein and serum lipoprotein levels in subjects with and without coronary heart disease. Hum Genet. 1991;87:574–578.[Medline] [Order article via Infotrieve]
19.
Kuivenhoven JA, Jukema JW, Zwinderman AH, et al. The
role of a common variant of the cholesteryl ester transfer protein gene
in the progression of coronary atherosclerosis:
the Regression Growth Evaluation Statin Study Group. N Engl
J Med. 1998;338:86–93.
20.
Watts GF, Riches FM, Humphries SE, et al. Genotypic
associations of the hepatic secretion of VLDL apolipoprotein B-100 in
obesity. J Lipid Res.. 2000;41:481–488.
21. Marcel YL, McPherson R, Hogue M, et al. Distribution and concentration of cholesteryl ester transfer protein in plasma of normolipemic subjects. J Clin Invest. 1990;85:10–17.
22. Buckler HM, McElhone K, Durrington PN, et al. The effects of low-dose testosterone treatment on lipid metabolism, clotting factors and ultrasonographic ovarian morphology in women. Clin Endocrinol. 1998;49:173–178.[Medline] [Order article via Infotrieve]
23. Fumeron F, Betoulle D, Behague I, et al. Alcohol intake modulates the effect of a polymorphism of the cholesteryl ester transfer protein gene on plasma high density lipoprotein and the risk of myocardial infarction. J Clin Invest. 1995;96:1664–1671.
This article has been cited by other articles:
 |
|
 |
|
  M. Y. Tsai, N. Li, A. R. Sharrett, S. Shea, D. R. Jacobs Jr, R. Tracy, D. Arnett, V. Arends, and W. Post Associations of Genetic Variants in ATP-Binding Cassette A1 and Cholesteryl Ester Transfer Protein and Differences in Lipoprotein Subclasses in the Multi-Ethnic Study of Atherosclerosis Clin. Chem., March 1, 2009; 55(3): 481 - 488. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Thompson, E. Di Angelantonio, N. Sarwar, S. Erqou, D. Saleheen, R. P. F. Dullaart, B. Keavney, Z. Ye, and J. Danesh Association of Cholesteryl Ester Transfer Protein Genotypes With CETP Mass and Activity, Lipid Levels, and Coronary Risk JAMA, June 18, 2008; 299(23): 2777 - 2788. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. K. Jensen, K. J. Mukamal, K. Overvad, and E. B. Rimm Alcohol consumption, TaqIB polymorphism of cholesteryl ester transfer protein, high-density lipoprotein cholesterol, and risk of coronary heart disease in men and women Eur. Heart J., January 1, 2008; 29(1): 104 - 112. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. G. Nordestgaard, M. Benn, P. Schnohr, and A. Tybjaerg-Hansen Nonfasting Triglycerides and Risk of Myocardial Infarction, Ischemic Heart Disease, and Death in Men and Women JAMA, July 18, 2007; 298(3): 299 - 308. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. D. Horne, N. J. Camp, J. L. Anderson, C. P. Mower, J. L. Clarke, M. J. Kolek, J. F. Carlquist, and for the Intermountain Heart Collaborative Study Gr Multiple Less Common Genetic Variants Explain the Association of the Cholesteryl Ester Transfer Protein Gene With Coronary Artery Disease J. Am. Coll. Cardiol., May 22, 2007; 49(20): 2053 - 2060. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. B. Lloyd, M. E. Lira, L. S. Wood, L. K. Durham, T. B. Freeman, G. M. Preston, X. Qiu, E. Sugarman, P. Bonnette, A. Lanzetti, et al. Cholesteryl Ester Transfer Protein Variants Have Differential Stability but Uniform Inhibition by Torcetrapib J. Biol. Chem., April 15, 2005; 280(15): 14918 - 14922. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S.M. Boekholdt, F.M. Sacks, J.W. Jukema, J. Shepherd, D.J. Freeman, A.D. McMahon, F. Cambien, V. Nicaud, G.J. de Grooth, P.J. Talmud, et al. Cholesteryl Ester Transfer Protein TaqIB Variant, High-Density Lipoprotein Cholesterol Levels, Cardiovascular Risk, and Efficacy of Pravastatin Treatment: Individual Patient Meta-Analysis of 13 677 Subjects Circulation, January 25, 2005; 111(3): 278 - 287. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. L. Wolfe and D. J. Rader Cholesteryl Ester Transfer Protein and Coronary Artery Disease: An Observation With Therapeutic Implications Circulation, September 14, 2004; 110(11): 1338 - 1340. [Full Text] [PDF]
|
|
|
|
 |
|
 J. D. Curb, R. D. Abbott, B. L. Rodriguez, K. Masaki, R. Chen, D. S. Sharp, and A. R. Tall A prospective study of HDL-C and cholesteryl ester transfer protein gene mutations and the risk of coronary heart disease in the elderly J. Lipid Res., May 1, 2004; 45(5): 948 - 953. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. E. Bojesen, K. Juul, P. Schnohr, A. Tybjaerg-Hansen, and B.o. G. Nordestgaard Platelet glycoprotein IIb/IIIa PlA2/PlA2 homozygosity associated with risk of ischemic cardiovascular disease and myocardial infarction in young men: The Copenhagen City Heart Study J. Am. Coll. Cardiol., August 20, 2003; 42(4): 661 - 667. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. M. Boekholdt and J. F. Thompson Natural genetic variation as a tool in understanding the role of CETP in lipid levels and disease J. Lipid Res., July 1, 2003; 44(6): 1080 - 1093. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. V. Andersen, H. H. Wittrup, A. Tybjaerg-Hansen, R. Steffensen, P. Schnohr, and B.o. G. Nordestgaard Hepatic lipase mutations,elevated high-density lipoprotein cholesterol, and increased risk of ischemic heart disease: The Copenhagen City Heart Study J. Am. Coll. Cardiol., June 4, 2003; 41(11): 1972 - 1982. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. L. Anderson and J. F. Carlquist Genetic polymorphisms of hepatic lipase and cholesteryl ester transfer protein, intermediate phenotypes, and coronary risk: Do they add up yet? J. Am. Coll. Cardiol., June 4, 2003; 41(11): 1990 - 1993. [Full Text] [PDF]
|
|
|
|
 |
|
 A. M. Lottenberg, V. S. Nunes, E. R. Nakandakare, M. Neves, M. Bernik, L. Lagrost, J. E. dos Santos, and E. Quintao The Human Cholesteryl Ester Transfer Protein I405V Polymorphism Is Associated with Plasma Cholesterol Concentration and Its Reduction by Dietary Phytosterol Esters J. Nutr., June 1, 2003; 133(6): 1800 - 1805. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. J. Barter, H. B. Brewer Jr, M. J. Chapman, C. H. Hennekens, D. J. Rader, and A. R. Tall Cholesteryl Ester Transfer Protein: A Novel Target for Raising HDL and Inhibiting Atherosclerosis Arterioscler. Thromb. Vasc. Biol., February 1, 2003; 23(2): 160 - 167. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. G. Brown, M. C. Cheung, A. C. Lee, X.-Q. Zhao, and A. Chait Antioxidant Vitamins and Lipid Therapy: End of a Long Romance? Arterioscler. Thromb. Vasc. Biol., October 1, 2002; 22(10): 1535 - 1546. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. E. Brousseau, J. J. O'Connor Jr, J. M. Ordovas, D. Collins, J. D. Otvos, T. Massov, J. R. McNamara, H. B. Rubins, S. J. Robins, and E. J. Schaefer Cholesteryl Ester Transfer Protein TaqI B2B2 Genotype Is Associated With Higher HDL Cholesterol Levels and Lower Risk of Coronary Heart Disease End Points in Men With HDL Deficiency: Veterans Affairs HDL Cholesterol Intervention Trial Arterioscler. Thromb. Vasc. Biol., July 1, 2002; 22(7): 1148 - 1154. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||