Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 2001;103:1509-1514

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liuzzo, G.
Right arrow Articles by Weyand, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liuzzo, G.
Right arrow Articles by Weyand, C. M.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Related Collections
Right arrow Acute coronary syndromes
Right arrow Pathophysiology
Right arrow Risk Factors
Right arrow Cell signalling/signal transduction
Right arrow Growth factors/cytokines

(Circulation. 2001;103:1509.)
© 2001 American Heart Association, Inc.


Clinical Investigation and Reports

Molecular Fingerprint of Interferon-{gamma} Signaling in Unstable Angina

Giovanna Liuzzo, MD, PhD; Abbe N. Vallejo, PhD; Stephen L. Kopecky, MD; Robert L. Frye, MD; David R. Holmes, MD; Jörg J. Goronzy, MD; Cornelia M. Weyand, MD

From the Department of Medicine, Mayo Clinic and Foundation, Rochester, Minn.

Correspondence to C.M. Weyand, MD, Mayo Clinic, 200 First St SW, Rochester, MN 55905. E-mail weyand.cornelia{at}mayo.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background—Activation of circulating monocytes in patients with acute coronary syndromes may reflect exposure to bacterial products or stimulation by cytokines such as IFN-{gamma}. IFN-{gamma} induces phosphorylation and nuclear translocation of transcription factor STAT-1, which initiates a specific program of gene induction. To explore whether monocyte activation is IFN-{gamma} driven, patients with unstable (UA) or stable angina (SA) were compared for nuclear translocation of STAT-1 complexes and upregulation of IFN-{gamma}–inducible genes CD64 and IP-10.

Methods and Results—Peripheral blood mononuclear cells were stained for expression of CD64 on CD14+ monocytes and analyzed by PCR for transcription of IP-10. Expression of CD64 was significantly increased in patients with UA. Monocytes from UA patients remained responsive to IFN-{gamma} in vitro, with accelerated transcriptional competency of CD64. IP-10–specific sequences were spontaneously detectable in 82% of the UA patients and 15% of SA patients (P<0.001). Most importantly, STAT-1 complexes were found in nuclear extracts prepared from freshly isolated monocytes of patients with UA, which provides compelling evidence for IFN-{gamma} signaling in vivo.

Conclusions—Monocytes from UA patients exhibit a molecular fingerprint of recent IFN-{gamma} triggering, such as nuclear translocation of STAT-1 complexes and upregulation of IFN-{gamma}–inducible genes CD64 and IP-10, which suggests that monocytes are activated, at least in part, by IFN-{gamma}. IFN-{gamma} may derive from stimulated T lymphocytes, which implicates specific immune responses in the pathogenesis of acute coronary syndromes.


Key Words: plaque • coronary disease • lymphocytes • immune system • inflammation


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
The pathogenesis of atherosclerosis is complex and includes contributions from multiple risk factors.1 Among these, chronic inflammation is an important determinant.2 3 Monocytes/macrophages participate in several critical aspects of coronary artery disease. Macrophages phagocytose lipids and differentiate into foam cells, a process that has been implicated in subendothelial deposition of lipoproteins and plaque generation.4 Macrophages also are known to be a component of cellular infiltrate in disrupted plaques that precipitate acute coronary thrombosis5 6 and may mediate tissue injury in unstable plaques through production of metalloproteinases.7 8 Circulating monocytes also have been found to be activated, particularly in patients with unstable angina (UA), which indicates a broader role of the innate immune system.9 These monocytes are characterized by upregulation of adhesion molecules10 11 and increased production of cytokines12 13 and procoagulant substances.14 15 Through production of inflammatory mediators, activated monocytes contribute to the acute-phase response as reflected in laboratory tests such as that for elevated C-reactive protein.16 17

Mechanisms that lead to activation of circulating monocytes in patients with acute coronary syndromes are not known. Because these activated cells might contribute directly to the disease process, identification of stimulatory signals could provide clues to underlying processes and to the precise relationship between coronary events and inflammation.

Monocytes can be activated by a variety of stimuli; the most powerful activator is interferon (IFN)-{gamma}.18 Because the major sources of IFN-{gamma} are activated natural killer and T lymphocytes, inflammation in coronary artery disease may be a downstream effect of ongoing immune responses. We recently reported that the functional T-cell repertoire is altered in patients with UA.19 Specifically, patients with unstable disease have an overrepresentation of CD4 T cells with high levels of intracellular IFN-{gamma}, most which lack the costimulatory molecule CD28. CD4+CD28null T cells are infrequent in patients with stable disease and in healthy controls but have undergone clonal proliferation in UA and infiltrate selectively into "culprit" coronary lesions.19

The present study examined whether monocyte activation in patients with UA is triggered by IFN-{gamma}. Binding of IFN-{gamma} to its receptor elicits a specific program of gene induction that targets genes with an IFN-{gamma}–response element in the promoter region.20 Triggering of the IFN-{gamma} receptor initiates a rapid signaling pathway in which Janus kinases (JAK) phosphorylate signal transducer and activator of transcription-1 (STAT-1) proteins.21 22 Homodimers of phosphorylated STAT-1 translocate to the nucleus and upregulate transcription of IFN-{gamma}–responsive genes. Nuclear translocation of STAT-1 homodimers is characteristic of IFN-{gamma} triggering and is not seen with other activating stimuli or other cytokine receptors. STAT-1–regulated genes include CD64, the high-affinity receptor for IgG involved in phagocytosis and antigen capture,23 and chemokine IP-10, which is chemotactic and stimulatory for T cells, natural killer cells, and monocytes.24 Therefore, nuclear presence of STAT-1 and transcription of IP-10 and CD64 in monocytes of UA patients indicate IFN-{gamma} activity in vivo.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Population
Thirty-six patients with stable angina (SA); 33 patients admitted to the Mayo Clinic Coronary Care Unit with a diagnosis of recent-onset UA, Braunwald class IIIB (TableDown); and 20 healthy age-matched individuals were included. Protocol was approved by the Mayo Clinic Internal Review Board, and all patients gave written informed consent.


View this table:
[in this window]
[in a new window]
 
Table 1. Demographic and Clinical Characteristics

SA patients had no acute events or worsening of symptoms during the prior 6 months and no anginal episodes during the week preceding enrollment. UA patients had experienced >=2 episodes of angina at rest or 1 episode lasting >20 minutes during the preceding 48 hours, ST-segment shift diagnostic for myocardial ischemia during angina attacks, and no elevation in serum creatinine kinase on admission and during the first 24 hours of hospitalization. Patients with acute or chronic inflammatory diseases or a recent (<6 months) myocardial infarction, angioplasty, or heart failure were excluded.

Peripheral Blood Mononuclear Cell and Monocyte Isolation
Blood samples were drawn immediately on hospital admission. Monocytes were isolated from peripheral blood mononuclear cells (PBMC) by negative selection with a cocktail of hapten-conjugated antibodies and magnetic microbeads coupled to an anti-hapten monoclonal antibody (No-Touch monocyte isolation kit, Miltenyi Biotec) and depletion on a column in a magnetic field (VarioMACS, Miltenyi Biotec). In selected experiments, 1x106 PBMC were incubated for 18 hours at 37°C with or without 200 U/mL IFN-{gamma} (BioSource International).

Flow Cytometry
PBMC were stained with phycoerythrin-conjugated anti-CD28 and fluorescein isothiocyanate-conjugated anti-CD4 (both Becton Dickinson) or with phycoerythrin-conjugated anti-CD14 (Becton Dickinson) and fluorescein isothiocyanate-conjugated anti-CD64 (Beckman Coulter) monoclonal antibodies. Stained cells were analyzed on a FACSCalibur flow cytometer (Becton Dickinson).

Reverse-Transcription PCR Analysis of IP-10 Expression
Total RNA of 5x105 PBMC was extracted (TriZol, Life Technologies), and cDNA was amplified by reverse-transcription–polymerase chain reaction (RT-PCR). Nucleotide sequences (annealing temperature, amplification cycles) for 5' and 3' IP-10 primers, respectively, were as follows (GenBank NM_001565): GGAACCTCCAGTCTCAGCACC and CAGCCTCTGTGTGGTCCATCC (53°C, 25 cycles). As a positive control, we used cDNA from 5x105 PBMC stimulated for 90 minutes with increasing doses of IFN-{gamma} (100, 500, and 1000 U/mL). As an amplification control, ß-actin was amplified with the following primers: 5'-ATCATGTTTGAGACCTTCAACA- CCCC and 3'-CAGGAGGAGCAATGATCTTGAT (GenBank M10277 and NM_001101, respectively).

Nuclear Extracts and Mobility-Shift Assay
Nuclear extracts from 1x107 PBMC or 1x106 monocytes were prepared by use of a high-salt extraction protocol, and electrophoretic mobility shift assays were performed as described.25 Nuclear extract (5 µg) was combined with 15 µL of binding buffer, 1.5 µg of poly(dI-dC) (Sigma Chemical Co), and 1.5 µg of nonspecific oligonucleotide (5'-TCGAAGTACTCAATTGCTCGAGATCGAT- AGATCTGAATTCAGTACTCC-3').26 In supershift assays, 1 µg of a STAT-1{alpha}–specific antibody (Transduction Laboratories) or irrelevant mouse IgG1 (Sigma) was added to the reaction. Total volume of reaction mixture was adjusted to 25 µL, and mixture was left on ice for 30 minutes. Specific double-stranded oligonucleotide probe corresponding to sis-inducible element (CGCCATTTCCCGTAAATC)26 27 was radiolabeled with [{gamma}-32P]ATP (NEN) by standard end-labeling reaction. Annealed probes at a final concentration of 40 fmol/µL were added to the reaction and incubated at room temperature for 30 minutes. Protein-DNA complexes were resolved on 6% nondenaturing polyacrylamide gels and were detected by autoradiography. As a positive control, we used nuclear extracts from 1x107 PBMC incubated for 30 minutes with 500 U/mL IFN-{gamma}.

Statistical Analysis
Mann-Whitney U test (2 groups) and Kruskal-Wallis 1-way ANOVA (>2 groups) were used to compare expression of CD64 on monocytes between groups. Pairwise comparisons were performed with the Wilcoxon rank sum test. Correlations were determined with Spearman’s rank correlation test. Remaining variables were compared by use of Student’s t test for paired and unpaired variables or the Fisher Exact Test, as appropriate. All statistical analysis was performed with SigmaStat software (SPSS).


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Spontaneous Upregulation of CD64 on Circulating Monocytes of Patients With UA
CD64 expression on normal unstimulated monocytes is low but is highly responsive to IFN-{gamma}. Figure 1Down shows that CD64 expression on CD14+ cells from patients with SA was indistinguishable from that of healthy age-matched controls. Median fluorescence intensities for CD64 surface expression in controls and SA patients were 71.8 and 67.4, respectively. In contrast, CD14+ monocytes from patients with UA expressed significantly higher levels of CD64, with median fluorescence intensity of 105.1 (P=0.003, UA versus SA; P=0.008, UA versus controls). This result confirmed that circulating monocytes from patients with UA are activated and have upregulated CD64, which suggests in vivo exposure to IFN-{gamma}.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 1. Expression of the IFN-{gamma}–induced gene CD64 on circulating CD14+ monocytes. Freshly isolated PBMC from patients with UA and SA and from age-matched healthy donors were immunostained with antibodies to CD14 and CD64 and analyzed by flow cytometry. For each donor, peak fluorescence of CD64 expression on CD14+ monocytes was determined. Data are presented as box plots displaying 25th and 75th percentiles as boxes and 10th and 90th percentiles as whiskers. CD64 levels on circulating monocytes were spontaneously upregulated in UA (peak fluorescence intensity, 105.1) vs SA (peak fluorescence intensity, 67.4; P=0.003) and controls (peak fluorescence intensity, 71.8; P=0.008).

Hyperresponsiveness of Monocytes from UA Patients to IFN-{gamma} Stimulation
To examine responsiveness of monocytes to IFN-{gamma}, we incubated PBMC with IFN-{gamma} for 18 hours. Induction of CD64 by IFN-{gamma} was a rapid process, and maximal surface levels were detected after 12 to 18 hours. Titration experiments demonstrated that 200 U/mL of IFN-{gamma} was optimal (data not shown). As shown in Figure 2Down, exposure of PBMC to IFN-{gamma} promptly induced CD64 surface expression on monocytes from healthy controls and SA patients. Median fluorescence intensities increased to 99.9 and 112.5, respectively, equivalent to levels seen on unstimulated monocytes from patients with UA (Figure 1Up). Surprisingly, monocytes from patients with UA were not maximally stimulated. Once in vitro stimulation with IFN-{gamma} was administered, CD64 expression levels more than doubled, to a median fluorescence intensity of 266.6 (Figure 2Down). Differences in IFN-{gamma}–induced CD64 expression were highly significant (P=0.003, UA versus SA; P<0.001, UA versus controls). Baseline CD64 levels were strongly predictive of increased surface expression of CD64 induced by in vitro IFN-{gamma} (Figure 3Down), which suggests that CD64 gene transcription has been previously induced by in vivo IFN-{gamma} in UA patients and that this priming effect has led to enhanced responsiveness of the promoter on reexposure to in vitro IFN-{gamma}.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 2. Responsiveness of CD14+ monocytes to IFN-{gamma} stimulation. PBMC from patients and control donors were isolated and incubated with 200 U/mL recombinant human IFN-{gamma} for 18 hours. Cells were immunostained with anti-CD64 and anti-CD14 and analyzed by flow cytometry. Results are shown as box plots with medians, 25th and 75th percentiles as boxes, and 10th and 90th percentiles as whiskers. Baseline levels of CD64 expression are shown in Figure 1Up. In all study cohorts, CD64 expression increased significantly after IFN-{gamma} stimulation. IFN-{gamma}–induced CD64 expression was higher in UA (peak fluorescence intensity after IFN-{gamma} stimulation, 266.6) than in SA (112.5; P=0.003) and controls (99.9; P<0.001).



View larger version (20K):
[in this window]
[in a new window]
 
Figure 3. Correlation of spontaneous and IFN-{gamma}–induced expression of CD64 on CD14+ monocytes. Cell surface densities of CD64 on monocytes/macrophages measured in fresh (Figure 1Up) and in vitro IFN-{gamma}–stimulated PBMC (Figure 2Up) were plotted. Response to recombinant human IFN-{gamma} directly correlated with baseline expression (R=0.73; P<0.001), which suggests priming for higher transcriptional competency of the CD64 gene in monocytes with in vivo upregulation of CD64.

Spontaneous Production of the IFN-{gamma}–Induced Chemokine IP-10 in UA Patients
IP-10, an early-response gene of the CXC chemokine superfamily, is rapidly induced on signaling through the IFN-{gamma} receptor.24 Freshly harvested PBMC from patients with UA or SA and from age-matched controls were assessed for transcription of IP-10 by RT-PCR. A strong signal for IP-10 was detected in 18 of 22 patients with UA, whereas only 3 of 20 patients with SA transcribed detectable amounts of IP-10 (P<0.001; Figure 4Down). No IP-10–specific transcripts could be amplified from PBMC from healthy controls. Culture of these PBMC in presence of increasing amounts of IFN-{gamma} induced IP-10 gene activation; 1000 U/mL IFN-{gamma} was required to generate a signal equivalent to that spontaneously expressed by freshly isolated PBMC from patients with UA. These results demonstrated that both CD64 and IP-10 were transcriptionally activated in patients with UA.



View larger version (67K):
[in this window]
[in a new window]
 
Figure 4. Spontaneous transcription of the IFN-{gamma}–inducible chemokine IP-10 in patients with UA. cDNA generated from freshly isolated PBMC was amplified by RT-PCR with IP-10–specific primers. IP-10 was detectable in 18 of 22 UA and 3 of 20 SA patients (P<0.001). Representative results for 10 UA and 10 SA patients are shown. A total of 5x105 PBMC incubated for 90 minutes with increasing doses of IFN-{gamma} (100, 500, and 1000 U/mL) served as positive control.

STAT-1 Complexes in Nuclei of Freshly Isolated Monocytes From UA Patients
The link between IFN-{gamma} binding to its receptor on the cell surface and selective gene activation is phosphorylation and nuclear translocation of STAT-1.21 Nuclear presence of STAT-1 complexes can be demonstrated in mobility shift assays. As shown in Figure 5Down, nuclear extracts from UA patients contained proteins that formed complexes with the sis-inducible element oligonucleotide, which contains an IFN-{gamma}–response element,26 27 and produced a characteristic gel-shift pattern. To confirm that proteins bound to the sis-inducible element probe were indeed STAT-1, gel supershifts with monoclonal antibodies to STAT-1{alpha} were performed. Shift in band migration was almost complete, which indicates that complexes consisted mostly, if not entirely, of STAT-1{alpha} homodimers. STAT-1 complexes were found exclusively in nuclear extracts from patients with UA. In 9 of 12 patients with UA, activated STAT-1 was detected. None of 11 patients with SA had nuclear translocated STAT-1. To identify the cell population with activated STAT-1, we separated monocytes from PBMC by a negative selection procedure, which avoids artificial activation of monocytes. Unseparated PBMC and negatively selected peripheral blood monocytes gave identical results for nuclear translocation of STAT-1 (data not shown). These findings provided additional support to the notion that in patients with UA, circulating monocytes had been exposed to in vivo IFN-{gamma} and had received a biologically relevant signal.



View larger version (58K):
[in this window]
[in a new window]
 
Figure 5. Detection of STAT-1 proteins translocated to the nucleus. Nuclear presence of STAT-1 protein was assessed by mobility shift assays in the presence of anti-STAT-1 monoclonal antibodies or isotype-matched control IgG antibodies. As a control, nuclear extracts were generated from 1x107 PBMC incubated for 30 minutes with 500 U/mL IFN-{gamma}. STAT-1 homodimers were detected in 9 of 12 UA patients (75%) but none of the SA patients (P<0.001). Data shown were reproducible in >=3 independent experiments with nuclei from either unseparated PBMC or negatively isolated monocytes.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
Monocytes and macrophages are critical players in pathogenesis of atherosclerosis, particularly in patients with acute coronary syndromes. In the arterial wall lesion, they can mediate tissue injury and serve as accessory cells for T lymphocytes. Circulating monocytes that have upregulated cell surface receptors and produce proinflammatory mediators may contribute to plaque instability by increased cell adhesiveness and procoagulant activity and by influencing the functional state of endothelial cells. The most important outcome of the present study is that these activated monocytes have upregulated expression of IFN-{gamma}–inducible genes and have translocated IFN-{gamma}–specific transcription factor STAT-1. These findings led to the conclusion that monocyte/macrophage activation in UA results, at least in part, from IFN-{gamma} signaling, which suggests a central role of T lymphocytes and adaptive immune responses.

Monocytes/macrophages are cells of the innate immune system that provide immediate host responses against infections. Cell activation can be directly triggered by invading microorganisms, eg, by releasing cell wall component lipopolysaccharide,28 29 30 or can be induced by tissue injury or by several cytokines.31 Tissue necrosis is an obvious candidate of monocyte activation in acute coronary syndromes. UA patients were selected to not have an elevated CK; however, 8 of 27 UA patients had elevated troponin levels, which indicated myonecrosis. Comparison of these 8 patients with the troponin-negative UA patients did not show any difference in monocyte activation markers IP-10 and CD64 (data not shown), which suggests that myonecrosis was not a major determinant in inducing these genes.

Among cytokines, IFN-{gamma}, a product of T cells and natural killer cells, is a powerful stimulator for macrophages, driving them to maximal phagocytic capability, tissue invasiveness, and monokine release. The search for a molecular fingerprint of IFN-{gamma} action in freshly isolated monocytes was facilitated by accumulated knowledge of intracellular events after IFN-{gamma} stimulation.22 Binding of IFN-{gamma} to its receptor activates a JAK-STAT signaling pathway involving JAK1, JAK2, and STAT-1. STAT-1 binds to the ligand-activated cytoplasmic portion of the IFN-{gamma} receptor, is phosphorylated by JAK, forms homodimers, and travels to the nucleus specifically to interact with regulatory elements referred to as IFN-{gamma} activation sites. Two genes that carry IFN-{gamma} activation site elements, CD64 and IP-10, were examined in the present study. Both genes were transcribed in monocytes freshly isolated from patients with UA, which suggests that these monocytes had been exposed to IFN-{gamma} in vivo. However, expression of these genes can be modified by the cytokines that could be active in vivo. Therefore, demonstration of nuclear translocation of STAT-1 complexes provided additional support to the interpretation that IFN-{gamma} was driving monocyte activation in vivo.

Level of upregulation of CD64 on the surface of monocytes in patients with UA was not maximal; in vitro culture with IFN-{gamma} further enhanced surface expression of CD64, which indicates that IFN-{gamma} stimulation in vivo was biologically significant but still could be increased. Interestingly, in vitro response to IFN-{gamma} was amplified in monocytes/macrophages of UA patients, which suggests a priming effect of in vivo IFN-{gamma} receptor triggering. In in vitro systems, combinatorial signals directed to the STAT-1 pathway have been demonstrated.32 33 One could find plausible that the primed state of circulating macrophages in UA makes them rapidly responsive to minor stimuli derived from additional IFN-{gamma} or other stimuli. These cells then easily would achieve maximal tissue-injurious capabilities. In such a setting, minor infections could precipitate a wave of monocyte/macrophage activity and possibly plaque instability. In essence, monocyte/macrophage preactivation itself could represent a risk factor. Baseline activation state of the monocyte/macrophage system would determine degree to which the host reacts to an infectious stimulus, and patients with preactivated monocytes/macrophages would be at higher risk of overshooting inflammatory processes.

IFN-{gamma} can be produced by natural killer or T cells with stimulation. We recently have shown that IFN-{gamma} production by CD4 and CD8 T cells is increased in UA.19 In particular, CD4+CD28null T cells, known to produce large amounts of IFN-{gamma} without requirements for costimulation,34 are expanded in UA. In vivo, CD64 expression correlated with frequencies of CD4+CD28null T cells (R=0.48; P=0.006). Frequencies of CD4+CD28null T cells also were predictive of IFN-{gamma}–induced CD64 expression in vitro (R=0.53; P=0.002). Therefore, one could propose that macrophage activation in UA is a downstream effect of immune stimulation and is ultimately under T-cell control. Expansion of CD4+CD28null T cells is not sufficient to explain monocyte activation, but T cells must be activated to generate IFN-{gamma}. Although we recently have shown that expansion of CD4+CD28null T cells is stable, activation may be intermittent, depending on antigenic exposure, and correlate with flares of monocyte activation and increased risk of instability.

Numerous activation markers for circulating monocytes from patients with UA have been reported.10 35 Additional knowledge is gained by adding CD64 and IP-10 to that list. CD64 binds IgG with high affinity. By capturing immunocomplexes, CD64 is involved in antigen presentation; by facilitating antibody-dependent cytotoxicity, it participates in cytolytic effector functions. Macrophages with high levels of CD64 have maximal capacity to ingest and kill microbes.36 Also, CD64 has been identified as the predominant receptor for uptake of LDL by human macrophages.37 Expression of IP-10 by macrophages conveys the ability to recruit T cells and monocytes actively into inflammatory lesions.24 Recent reports have demonstrated tissue expression of IP-10 in human atherosclerotic plaque,38 39 which implicates this chemokine in regulation of plaque inflammation.

In conclusion, the present study provides evidence that patients with UA have circulating monocytes with a molecular fingerprint of IFN-{gamma} signaling in vivo. STAT-1 complexes were present in nucleus, and IFN-{gamma}–inducible genes were upregulated. In addition, monocytes were primed for higher transcriptional competence of IFN-{gamma}-responsive genes. Mechanisms bringing about maximal activation of macrophages may serve the host well when used to generate optimal responses against infectious agents. However, optimization of macrophage activation may pose a risk, because it amplifies tissue-destructive potential. Also, IFN-{gamma}–primed monocytes may contribute directly to plaque injury. Correlation between presence of IFN-{gamma}–producing CD4+CD28null T cells and in vivo monocyte/macrophage activation points toward immune dysregulation as a primary disease mechanism in coronary artery disease.


*    Acknowledgments
 
This work was supported by the Mayo Foundation; the "Fondazione Internazionale di Ricerca per il Cuore," Rome, Italy; grants from the National Institutes of Health (RO1-AR41974, RO1-AR42527, and RO1-EY11916); the American Heart Association (MHA 161); and the Dr M. Lee Pearce Foundation. We thank Kristi H. Monahan, RN, and Kathleen E. Kenny, RN, for assistance in patient enrollment and Tammy J. Dahl and James W. Fulbright for manuscript preparation and data abstraction.

Received November 8, 2000; revision received November 28, 2000; accepted November 29, 2000.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 

  1. Schaper W, Buschmann I. Arteriogenesis, the good and bad of it. Cardiovasc Res. 1999;43:835–837.[Free Full Text]
  2. Ross R. Atherosclerosis is an inflammatory disease. Am Heart J. 1999;138:S419–S420.[Medline] [Order article via Infotrieve]
  3. Shah PK. Plaque disruption and thrombosis: potential role of inflammation and infection. Cardiol Clin. 1999;17:271–281. Review.[Medline] [Order article via Infotrieve]
  4. O’Brien KD, Gordon D, Deeb S, et al. Lipoprotein lipase is synthesized by macrophage-derived foam cells in human coronary atherosclerotic plaques. J Clin Invest. 1992;89:1544–1550.
  5. Libby P, Geng YJ, Aikawa M, et al. Macrophages and atherosclerotic plaque stability. Curr Opin Lipidol. 1996;7:330–335.[Medline] [Order article via Infotrieve]
  6. Buja LM, Willerson JT. Role of inflammation in coronary plaque disruption. Circulation. 1994;89:503–505.[Free Full Text]
  7. Mach F, Schonbeck U, Bonnefoy JY, et al. Activation of monocyte/macrophage functions related to acute atheroma complication by ligation of CD40: induction of collagenase, stromelysin, and tissue factor. Circulation. 1997;96:396–399.[Abstract/Free Full Text]
  8. Rajavashisth TB, Xu XP, Jovinge S, et al. Membrane type 1 matrix metalloproteinase expression in human atherosclerotic plaques: evidence for activation by proinflammatory mediators. Circulation. 1999;99:3103–3109.[Abstract/Free Full Text]
  9. Jude B, Agraou B, McFadden EP, et al. Evidence for time-dependent activation of monocytes in the systemic circulation in unstable angina but not in acute myocardial infarction or in stable angina. Circulation. 1994;90:1662–1668.[Abstract/Free Full Text]
  10. Mazzone A, de Servi S, Ricevuti G, et al. Increased expression of neutrophil and monocyte adhesion molecules in unstable coronary artery disease. Circulation. 1993;88:358–363.[Abstract/Free Full Text]
  11. de Servi S, Mazzone A, Ricevuti G, et al. Expression of neutrophil and monocyte CD11b/CD18 adhesion molecules at different sites of the coronary tree in unstable angina pectoris. Am J Cardiol. 1996;78:564–568.[Medline] [Order article via Infotrieve]
  12. Biasucci LM, Vitelli A, Liuzzo G, et al. Elevated levels of interleukin-6 in unstable angina. Circulation. 1996;94:874–877.[Abstract/Free Full Text]
  13. Schumacher M, Halwachs G, Tatzber F, et al. Increased neopterin in patients with chronic and acute coronary syndromes. J Am Coll Cardiol. 1997;30:703–707.[Abstract]
  14. Falciani M, Gori AM, Fedi S, et al. Elevated tissue factor and tissue factor pathway inhibitor circulating levels in ischaemic heart disease patients. Thromb Haemost. 1998;79:495–499.[Medline] [Order article via Infotrieve]
  15. Manten A, de Winter RJ, Minnema MC, et al. Procoagulant and proinflammatory activity in acute coronary syndromes. Cardiovasc Res. 1998;40:389–395.[Abstract/Free Full Text]
  16. Liuzzo G, Biasucci LM, Gallimore JR, et al. The prognostic value of C-reactive protein and serum amyloid a protein in severe unstable angina. N Engl J Med. 1994;331:417–424.[Abstract/Free Full Text]
  17. Ridker PM. Novel risk factors and markers for coronary disease. Adv Intern Med. 2000;45:391–418.[Medline] [Order article via Infotrieve]
  18. Arai KI, Lee F, Miyajima A, et al. Cytokines: coordinators of immune and inflammatory responses. Annu Rev Biochem. 1990;59:783–836.[Medline] [Order article via Infotrieve]
  19. Liuzzo G, Kopecky SL, Frye RL, et al. Perturbation of the T-cell repertoire in patients with unstable angina. Circulation. 1999;100:2135–2139.[Abstract/Free Full Text]
  20. Schindler C, Strehlow I. Cytokines and STAT signaling. Adv Pharmacol. 2000;47:113–174. Review.
  21. Leonard WJ, O’Shea JJ. Jaks and STATs: biological implications. Annu Rev Immunol. 1998;16:293–322.[Medline] [Order article via Infotrieve]
  22. Darnell JEJ. STATs and gene regulation. Science. 1997;277:1630–1635.[Abstract/Free Full Text]
  23. McKenzie SE, Schreiber AD. Fc gamma receptors in phagocytes. Curr Opin Hematol. 1998;5:16–21.[Medline] [Order article via Infotrieve]
  24. Neville LF, Mathiak G, Bagasra O. The immunobiology of interferon-gamma inducible protein 10 kD (IP-10): a novel, pleiotropic member of the C-X-C chemokine superfamily. Cytokine Growth Factor Rev. 1997;8:207–219.[Medline] [Order article via Infotrieve]
  25. Vallejo AN, Nestel AR, Schirmer M, et al. Aging-related deficiency of CD28 expression in CD4+ T cells is associated with the loss of gene-specific nuclear factor binding activity. J Biol Chem. 1998;273:8119–8129.[Abstract/Free Full Text]
  26. Vallejo AN, Pease LR. The locus-specific enhancer activity of the class I major histocompatibility complex interferon-responsive element is associated with a gamma-interferon (IFN)-inducible factor distinct from STAT1alpha, p48, and IFN regulatory factor-1. J Biol Chem. 1996;271:29813–29821.[Abstract/Free Full Text]
  27. Wagner BJ, Hayes TE, Hoban CJ, et al. The SIF binding element confers sis/PDGF inducibility onto the c-fos promoter. EMBO J. 1990;9:4477–4484.[Medline] [Order article via Infotrieve]
  28. Kielian TL, Blecha F. CD14 and other recognition molecules for lipopolysaccharide: a review. Immunopharmacology. 1995;29:187–205.[Medline] [Order article via Infotrieve]
  29. Valtonen VV. Role of infections in atherosclerosis. Am Heart J. 1999;138:S431–S433.[Medline] [Order article via Infotrieve]
  30. Gupta S. Chlamydia pneumoniae, monocyte activation, and azithromycin in coronary heart disease. Am Heart J. 1999;138:S539–S541.[Medline] [Order article via Infotrieve]
  31. Nacy CA, Meltzer MS. T-cell-mediated activation of macrophages. Curr Opin Immunol. 1991;3:330–335.[Medline] [Order article via Infotrieve]
  32. Pine R. Convergence of TNF{alpha} and IFN{gamma} signalling pathways through synergistic induction of IRF-1/ISGF-2 is mediated by a composite GAS/{kappa}B promoter element. Nucleic Acids Res. 1997;25:4346–4354. Review.[Abstract/Free Full Text]
  33. Kovarik P, Stoiber D, Novy M, et al. Stat1 combines signals derived from IFN-{gamma} and LPS receptors during macrophage activation. EMBO J. 1998;17:3660–3668.[Medline] [Order article via Infotrieve]
  34. Park W, Weyand CM, Schmidt D, et al. Co-stimulatory pathways controlling activation and peripheral tolerance of human CD4+CD28- T cells. Eur J Immunol. 1997;27:1082–1090.[Medline] [Order article via Infotrieve]
  35. Neri SG, Abbate R, Gensini GF, et al. Monocyte activation and increased procoagulant activity in unstable angina. Lancet. 1990;336:1444–1445.
  36. Schiff DE, Rae J, Martin TR, et al. Increased phagocyte Fc {gamma}RI expression and improved Fc gamma-receptor-mediated phagocytosis after in vivo recombinant human interferon-gamma treatment of normal human subjects. Blood. 1997;90:3187–3194.[Abstract/Free Full Text]
  37. Lopes-Virella MF, Binzafar N, Rackley S, et al. The uptake of LDL-IC by human macrophages: predominant involvement of the Fc gamma RI receptor. Atherosclerosis. 1997;135:161–170.[Medline] [Order article via Infotrieve]
  38. Wang X, Yue TL, Ohlstein EH, et al. Interferon-inducible protein-10 involves vascular smooth muscle cell migration, proliferation, and inflammatory response. J Biol Chem. 1996;271:24286–24293.[Abstract/Free Full Text]
  39. Mach F, Sauty A, Iarossi AS, et al. Differential expression of three T lymphocyte-activating CXC chemokines by human atheroma-associated cells. J Clin Invest. 1999;104:1041–1050. [Medline] [Order article via Infotrieve]



This article has been cited by other articles:


Home page
J Am Coll CardiolHome page
G. Liuzzo, L. M. Biasucci, G. Trotta, S. Brugaletta, M. Pinnelli, G. Digianuario, V. Rizzello, A. G. Rebuzzi, C. Rumi, A. Maseri, et al.
Unusual CD4+CD28null T Lymphocytes and Recurrence of Acute Coronary Events
J. Am. Coll. Cardiol., October 9, 2007; 50(15): 1450 - 1458.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
P. Aukrust, A. Yndestad, W. J. Sandberg, L. Gullestad, and J. K. Damas
T Cells in Coronary Artery Disease: Different Effects of Different T-Cell Subsets
J. Am. Coll. Cardiol., October 9, 2007; 50(15): 1459 - 1461.
[Full Text] [PDF]


Home page
CirculationHome page
K. K. Ray, D. A. Morrow, M. S. Sabatine, A. Shui, N. Rifai, C. P. Cannon, and E. Braunwald
Long-Term Prognostic Value of Neopterin: A Novel Marker of Monocyte Activation in Patients With Acute Coronary Syndrome
Circulation, June 19, 2007; 115(24): 3071 - 3078.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
Y.-C. Tsai, H.-J. Hsieh, F. Liao, C.-W. Ni, Y.-J. Chao, C.-Y. Hsieh, and D. L. Wang
Laminar flow attenuates interferon-induced inflammatory responses in endothelial cells
Cardiovasc Res, June 1, 2007; 74(3): 497 - 505.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
A. Niessner, K. Sato, E. L. Chaikof, I. Colmegna, J. J. Goronzy, and C. M. Weyand
Pathogen-Sensing Plasmacytoid Dendritic Cells Stimulate Cytotoxic T-Cell Function in the Atherosclerotic Plaque Through Interferon-{alpha}
Circulation, December 5, 2006; 114(23): 2482 - 2489.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
D. Walcher, A. Kummel, B. Kehrle, H. Bach, M. Grub, R. Durst, V. Hombach, and N. Marx
LXR Activation Reduces Proinflammatory Cytokine Expression in Human CD4-Positive Lymphocytes
Arterioscler. Thromb. Vasc. Biol., May 1, 2006; 26(5): 1022 - 1028.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
E. W. Raines
Antigen-Independent Targeting of Long-Lived CD4+ Cytolytic T Effector Cells to Lesions of Atherosclerosis
Circ. Res., March 3, 2006; 98(4): 434 - 436.
[Full Text] [PDF]


Home page
J. Exp. Med.Home page
K. Sato, A. Niessner, S. L. Kopecky, R. L. Frye, J. J. Goronzy, and C. M. Weyand
TRAIL-expressing T cells induce apoptosis of vascular smooth muscle cells in the atherosclerotic plaque
J. Exp. Med., January 23, 2006; 203(1): 239 - 250.
[Abstract] [Full Text] [PDF]


Home page
J. Epidemiol. Community HealthHome page
V. Culic
Excess in cardiovascular events on Mondays: could atherosclerotic plaques be more vulnerable after the weekend because of alcohol related cytokine dysregulation?
J. Epidemiol. Community Health, October 1, 2005; 59(10): 911 - 911.
[Full Text] [PDF]


Home page
LupusHome page
G Liuzzo, G Giubilato, and M Pinnelli
T cells and cytokines in atherogenesis
Lupus, September 1, 2005; 14(9): 732 - 735.
[Abstract] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
G. Caligiuri, E. Groyer, J. Khallou-Laschet, A. A. H. Zen, J. Sainz, D. Urbain, A.-T. Gaston, M. Lemitre, A. Nicoletti, and A. Lafont
Reduced Immunoregulatory CD31+ T Cells in the Blood of Atherosclerotic Mice With Plaque Thrombosis
Arterioscler. Thromb. Vasc. Biol., August 1, 2005; 25(8): 1659 - 1664.
[Abstract] [Full Text] [PDF]


Home page
Ann Rheum DisHome page
C Turesson, A Jarenros, and L Jacobsson
Increased incidence of cardiovascular disease in patients with rheumatoid arthritis: results from a community based study
Ann Rheum Dis, August 1, 2004; 63(8): 952 - 955.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
Z. Mallat, A. Gojova, V. Brun, B. Esposito, N. Fournier, F. Cottrez, A. Tedgui, and H. Groux
Induction of a Regulatory T Cell Type 1 Response Reduces the Development of Atherosclerosis in Apolipoprotein E-Knockout Mice
Circulation, September 9, 2003; 108(10): 1232 - 1237.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
S.-P. Yang, L.-J. Ho, Y.-L. Lin, S.-M. Cheng, T.-P. Tsao, D.-M. Chang, Y.-L. Hsu, C.-Y. Shih, T.-Y. Juan, and J.-H. Lai
Carvedilol, a new antioxidative {beta}-blocker, blocks in vitro human peripheral blood T cell activation by downregulating NF-{kappa}B activity
Cardiovasc Res, September 1, 2003; 59(3): 776 - 787.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
T. Nakajima, O. Goek, X. Zhang, S. L. Kopecky, R. L. Frye, J. J. Goronzy, and C. M. Weyand
De Novo Expression of Killer Immunoglobulin-Like Receptors and Signaling Proteins Regulates the Cytotoxic Function of CD4 T Cells in Acute Coronary Syndromes
Circ. Res., July 25, 2003; 93(2): 106 - 113.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Benagiano, A. Azzurri, A. Ciervo, A. Amedei, C. Tamburini, M. Ferrari, J. L. Telford, C. T. Baldari, S. Romagnani, A. Cassone, et al.
T helper type 1 lymphocytes drive inflammation in human atherosclerotic lesions
PNAS, May 27, 2003; 100(11): 6658 - 6663.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
H. Soejima, A. Irie, S. Miyamoto, I. Kajiwara, S. Kojima, J. Hokamaki, T. Sakamoto, T. Tanaka, M. Yoshimura, Y. Nishimura, et al.
Preference Toward a T-Helper Type 1 Response in Patients With Coronary Spastic Angina
Circulation, May 6, 2003; 107(17): 2196 - 2200.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
N. Marx, B. Kehrle, K. Kohlhammer, M. Grub, W. Koenig, V. Hombach, P. Libby, and J. Plutzky
PPAR Activators as Antiinflammatory Mediators in Human T Lymphocytes: Implications for Atherosclerosis and Transplantation-Associated Arteriosclerosis
Circ. Res., April 5, 2002; 90(6): 703 - 710.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
C. Stollberger and J. Finsterer
Role of Infectious and Immune Factors in Coronary and Cerebrovascular Arteriosclerosis
Clin. Vaccine Immunol., March 1, 2002; 9(2): 207 - 215.
[Full Text] [PDF]


Home page
CirculationHome page
T. Nakajima, S. Schulte, K. J. Warrington, S. L. Kopecky, R. L. Frye, J. J. Goronzy, and C. M. Weyand
T-Cell-Mediated Lysis of Endothelial Cells in Acute Coronary Syndromes