(Circulation. 2001;103:2296.)
© 2001 American Heart Association, Inc.
Basic Science Reports |
B and Induces Neutrophil Infiltration Via Lipopolysaccharide-Induced CXC Chemokine
From the Department of Medicine, University of Texas Health Science Center at San Antonio, South Texas Veterans Healthcare System, Audie Murphy Division, San Antonio, Tex (B.C., G.L.F.), and the Department of Pediatrics, UCLA School of Medicine, Los Angeles, Calif (J.B.S.).
Correspondence to Bysani Chandrasekar, DVM, PhD, Medicine/Cardiology, The University of Texas Health Science Center, 7703 Floyd Curl Dr, San Antonio, TX 78229-3900. E-mail chandraseka{at}uthscsa.edu
| Abstract |
|---|
|
|
|---|
Methods and
ResultsMale Wistar-Kyoto rats underwent 45
minutes of ligation of the left anterior descending coronary
artery, followed by reperfusion for various periods. Compared with
sham-operated controls, myocardium from reperfused animals
had higher levels of free radicals, increased neutrophil infiltration
evidenced histologically and by elevated
myeloperoxidase activity, and increased nuclear factor (NF)-
B DNA
binding activity. Ischemia-reperfusion also induced the
expression of interleukin-1ß, tumor necrosis factor (TNF)-
, LIX,
KC, and MIP-2 mRNA and protein. LIX expression was localized to
resident myocardial cells, whereas KC and MIP-2 were expressed only in
infiltrating inflammatory cells. Neutralization of LIX inhibited 79%
of neutrophil infiltration into previously ischemic
myocardium. In contrast, neutralization of KC and MIP-2
reduced neutrophil infiltration by only 28% and 37%, respectively. In
cultured cardiomyocytes, LIX expression was induced by
oxidative stress or TNF-
and was blocked by the NF-
B
inhibitor
pyrrolidinedithiocarbamate.
ConclusionsLIX is
expressed by resident myocardial cells during
ischemia-reperfusion and is induced in cultured
cardiomyocytes by oxidative stress or TNF-
via NF-
B
activation. Although KC and MIP-2 are expressed by inflammatory cells
infiltrating the myocardium during reperfusion after
ischemia, neutrophil recruitment to reperfused rat
myocardium is mainly due to cardiomyocyte
expression of LIX.
Key Words: ischemia reperfusion chemokines inflammation
| Introduction |
|---|
|
|
|---|
B (NF-
B), and trigger the expression of
interleukin (IL)-1ß, tumor necrosis factor (TNF)-
, and other
inflammatory
mediators.2 3
IL-1ß and TNF-
themselves are potent inducers of NF-
B
activation.2 3 4 5 6
We have previously shown increased free radical generation,
activation of NF-
B, and induction of the
B-responsive
cytokines IL-1ß, IL-6, and TNF-
in reperfused rat
myocardium after 15 minutes of
ischemia.6 7 8
An ischemic episode of 15 minutes does not induce cell death
but results in myocardial dysfunction (stunning) that is reversed by
prolonged reperfusion.9 In
contrast, 45 minutes of ischemia is lethal to the
myocardium, and the injury is exacerbated by the
recruitment and activation of neutrophils during
reperfusion.10 11 12 13
Although the contribution of neutrophils to
ischemia-reperfusion injury is well established, the precise
mechanisms responsible for neutrophil recruitment during reperfusion
are incompletely understood.
The chemokines are a superfamily of cytokines with
diverse biological functions, including the selective recruitment of
specific leukocyte classes to sites of inflammation and
injury.14 15
Members of the CXC branch of the chemokine family have 4 invariant
cysteines, the first 2 of which are separated by 1 other amino acid
(X). Chemokines containing glutamic acidleucine-arginine (ELR)
immediately preceding the CXC motif are potent neutrophil
chemoattractants. In humans, 7 ELR+CXC chemokines are known: IL-8;
neutrophil activating peptide-2 (NAP-2); growth-related oncogenes
(GRO)-
, -ß, and -
; epithelial cellderived
neutrophil-activating peptide-78 (ENA-78); and granulocyte chemotactic
protein-2 (GCP-2). These chemokines are thought to play a major role in
the recruitment of neutrophils to tissue in a wide variety of
infectious and inflammatory
conditions.14 15
IL-8 has been shown to participate in neutrophil recruitment to
reperfused myocardium in humans, dogs, and
rabbits,16 17 18 19
but the potential roles of other ELR+CXC chemokines in
ischemia-reperfusion have not been evaluated.
Because rats lack an IL-8 homologue, they provide a good model for investigating the roles of other rat ELR+CXC chemokines, including cytokine-induced neutrophil chemoattractant (KC), macrophage inflammatory protein-2 (MIP-2), and lipopolysaccharide (LPS)-induced CXC chemokine (LIX).20 21 22 We found that although myocardial ischemia/reperfusion induced all 3 of these chemokines, neutrophil recruitment to reperfused rat myocardium was dependent primarily on LIX.
| Methods |
|---|
|
|
|---|
200
g) were used in these studies. Anesthesia (44 mg/kg
ketamine, 1 mg/kg acepromazine, and 8.5 mg/kg xylazine) and
surgery were performed as
described.6 7 8 23
After 45 minutes of ligation of the left anterior descending
coronary artery, the hearts were reperfused for specified times
(8 rats per group). Tissue from control animals (8 rats) was evaluated
after sham ischemia. The heart was rapidly excised after the
experimental period and rinsed in ice-cold
physiological saline. The right ventricle and atria
were trimmed away. The left ventricle was divided into ischemic
and nonischemic zones, which were snap-frozen in liquid
N2 for further analyses. In a separate experiment, normal rabbit IgG or rabbit anti-LIX, -KC, or MIP-2 antibodies (500 µg, PeproTech Inc) were injected intraperitoneally 1 hour before sham operation or 45 minutes of left anterior descending coronary artery ligation (4 rats per group). The ischemic zones were collected after 2 hours of reperfusion.
Lipid Peroxidation, NF-
B DNA Binding
Activity, and Myeloperoxidase Assays
Measurement of the generation of thiobarbituric
acidreactive substances (TBARS) in myocardial extracts was carried
out with a commercially available kit (Lipid peroxidation assay kit,
Calbiochem-Novabiochem Corp). Electrophoretic mobility shift assay for
NF-
B DNA binding activity and myeloperoxidase (MPO) assay were
performed as
described.8 23
Northern Blot Analysis
Isolation of total RNA, Northern blotting,
autoradiography, and densitometry were performed as
described.6 7 8 23
The cDNA probes used for IL-1ß and TNF-
were described
previously.6 23
MIP-2 message (GenBank X65647) was detected with an
oligonucleotide probe,
AAGGCAAGGCTAACTGACCTGGGAAGGAAGAACA-TGGGCTCCTGTACCTCAACGGGCAGAATC.
The probe for KC (GenBank M86536) was a reverse
transcriptionpolymerase chain reaction (RT-PCR) product generated
from rat cardiac-derived fibroblasts treated for 12 hours with 1
µg/mL LPS (Escherichia coli
055:B5, Sigma) with primers AAGATAGATTGCACCGATGGCG (nt 352 to 373) and
CTGAGACGAGAAGGAGCATT (nt 850 to 869). The probe for rat LIX (GenBank
U90448) was a 329-bp cDNA cloned in PCR-Script (Stratagene) from an
RT-PCR product generated with primers GGTCCTGCTCGTCATTCA (nt 41 to
58) and CAGTGCAAGTGCATTCCGCT (nt 350 to 369). A
40-nucleotide probe for h28S rRNA (Oncogene Science, Inc)
was used to control for variations in RNA
loading.
Protein Extraction and Western Blot
Analysis
Extraction of protein homogenates,
Western blotting, autoradiography, and densitometry
were performed as
described.6 7 8 23
Antibodies to murine IL-1ß and TNF-
, which cross-react with their
rat counterparts,6 were
obtained from R&D Systems. Affinity-purified rabbit anti-rat GRO/KC and
anti-mouse LIX antibodies were from PeproTech, Inc. Goat anti-mouse
MIP-2 antibodies were from Santa Cruz Biotechnology, Inc. The
antibodies were used at final concentrations of 2.5 µg/mL (KC and
LIX), 3.0 µg/mL (MIP-2), or 3.5 µg/mL (IL-1ß,
TNF-
).
Histology and Immunohistochemistry
Cryosections 6 µm thick were stained for
chemokines with the Vectastain Elite ABC-peroxidase kit (Vector
Laboratories, Inc).8 Primary
antibodies were used at a final concentration of either 1 µg/mL (KC
and LIX) or 2.5 µg/mL (MIP-2).
Cell Culture
Calcium-tolerant myocytes were isolated from rats by
the method of Piper et al.24
Cell preparations contained
70% rod-shaped, trypan blueexcluding
cells. After overnight incubation in M199 medium containing 4% FBS,
myocytes were replated at 250 000 cells/T25 flask in fresh M199 medium
containing 0.5% BSA and then were incubated for up to 48 hours with 10
ng/mL recombinant rat TNF-
(Biosource International) or with
H2O2 (100 µmol/L) for
up to 8 hours. The TNF-
stock solution contained <0.1 ng
endotoxin/µg TNF-
, as determined by the supplier.
Pyrrolidinedithiocarbamate (PDTC, 100 µmol/L) was added 1 hour before
TNF-
or
H2O2.
Statistical Analysis
Comparisons between sham-operated controls and each
of the 6 reperfusion time periods were performed for measures of MPO
activity and NF-
B DNA binding activity by ANOVA with post hoc
Dunnetts t tests. The
antibody neutralization studies were analyzed similarly. F
tests and Dunnetts t tests
with values of P<0.05 were
considered statistically significant. Because cytokine and
chemokine levels of mRNA and protein were undetectable in the controls,
the significance of expression in reperfused tissue was evaluated by
1-sample Students t tests.
Error bars in figures indicate the
SEM.
| Results |
|---|
|
|
|---|
B Binding Activity, and Induces Neutrophil
Infiltration
B binding
activity in myocardial nuclear protein extracts was assessed with a gel
mobility shift assay
(Figure 1B
B binding activity increased rapidly after
ischemia-reperfusion (5-fold at 15 minutes and 6.1-fold at 30
minutes compared with sham-operated controls), then gradually
decreased.
|
The recruitment of neutrophils into previously
ischemic myocardium was assessed by measurement of
the activity of MPO. Compared with sham-operated controls, MPO activity
increased by 30 minutes of reperfusion (2.9-fold,
P<0.01), peaked at 1 to 2
hours (17- to 20-fold,
P<0.0001), and then declined.
MPO activity remained elevated compared with controls, however, even at
6 hours (6.8-fold, P<0.01).
Neutrophil infiltration was also evaluated
histologically. Neutrophils were not visible in
sham-operated controls
(Figure 1D
) but were readily detected in previously
ischemic myocardium at 2 hours
(Figure 1E
).
Ischemia-Reperfusion Induces Myocardial
Expression of IL-1ß, TNF-
, LIX, KC, and MIP-2
Neither IL-1ß nor TNF-
mRNA was detected in
sham-operated animals
(Figure 2A
). In reperfused tissue, IL-1ß and TNF-
messages were induced within 30 minutes, remained elevated for 3 hours,
and then fell to undetectable levels by 6 hours. The protein levels of
both cytokines followed a similar time course
(Figure 2B
).
|
Ischemia-reperfusion induced the expression of LIX,
KC, and MIP-2, but the time courses of induction of these chemokines
differed
(Figure 3
). Message and protein for both LIX and MIP-2 were
induced by 1 hour of reperfusion. LIX protein levels then continued to
rise, peaking at 2 to 3 hours, and remained detectable at 6 hours. In
contrast to LIX, MIP-2 protein decreased after 1 hour and was
undetectable by 6 hours. Compared with both LIX and MIP-2, KC induction
during reperfusion was delayed. KC message and protein were first
detected at 2 hours, and then remained at the same levels through the
6-hour study period. The differences in induction kinetics between LIX,
KC, and MIP-2 indicate that they are regulated differently, which
suggests that their roles in the biological response to reperfusion
might differ.
|
Localization of LIX Expression in Reperfused
Myocardium Differs From That of KC and MIP-2
The differing kinetics of LIX, KC, and MIP-2 expression
in reperfused myocardium could be due, in part, to
differences in their cellular expression patterns. It is known that LIX
is induced by LPS in fibroblasts but not in macrophages,
whereas KC and MIP-2 are abundantly expressed by macrophages
stimulated with
LPS.22 25 26
Differential induction of LIX, KC, and MIP-2 in different cell types is
one mechanism by which these 3 neutrophil-chemoattractant chemokines
could manifest distinct functions in vivo. To localize the sites of
LIX, KC, and MIP-2 expression during reperfusion, we evaluated
previously ischemic myocardium by
immunohistochemistry
(Figure 4
). We performed the analysis at 2 hours of
reperfusion because all 3 chemokines were detectable by Western
analysis then, and MPO expression was maximal. In sham-operated
controls, no immunoreactivity was detected for LIX
(Figure 4A
) or for either KC or MIP-2 (not shown). After
ischemia-reperfusion, LIX immunoreactivity was readily detected
in resident myocardial cells, but not in infiltrating inflammatory
cells
(Figure 4B
). Blood vessel walls also had positive LIX
immunoreactivity
(Figure 4C
). In contrast, KC and MIP-2 immunoreactivity was
detected in inflammatory cells but not in resident myocardial cells
(Figure 4D
and 4E
). For each chemokine, no
immuno-reactivity was detected in controls (not shown) in which
(1) primary antibody was omitted, (2) primary antibody was
neutralized with the respective recombinant protein, or (3) nonspecific
preimmune serum was used in place of the primary
antibody.
|
Neutralization of LIX Markedly Attenuates
Neutrophil Accumulation During Reperfusion
The observation that LIX is induced in resident
myocardial cells after ischemia-reperfusion, whereas KC and
MIP-2 expression is associated with infiltrating inflammatory cells,
suggested that LIX may be particularly important for the initiation of
neutrophil recruitment during reperfusion. To test this hypothesis, we
administered neutralizing anti-LIX, -KC, or MIP-2 antibodies or
control IgG 1 hour before induction of ischemia. Neutrophil
accumulation (measured by MPO activity) was determined at 2 hours of
reperfusion, which was the time of maximal MPO activity
(Figure 1C
). The low levels of MPO detected in sham-operated
control tissue were not affected by either LIX, KC, MIP-2, or control
antibodies
(Figure 5
). In reperfused myocardium receiving no
antibody, MPO activity increased 21-fold
(P<0.0001). Normal rabbit IgG
did not affect the reperfusion-induced increase in MPO activity.
Anti-LIX antibodies inhibited the increase in MPO activity by 79%
(P<0.0001)
(Figure 5
). In contrast, antibodies to KC and MIP-2 were much
less effective, inhibiting the increase in MPO activity by 28% and
37%, respectively (P<0.05).
This indicates that although KC and MIP-2 also participate in the
process, neutrophil infiltration into reperfused myocardium
in this model is mainly dependent on LIX.
|
TNF-
and Oxidative Stress Induce LIX
Expression Via Activation of NF-
B
To evaluate the mechanisms of LIX induction that may
contribute to its expression in reperfused myocardium, we
investigated the effects of TNF-
and of oxidative stress
(H2O2) in cultured
cardiomyocytes. TNF-
produced a rapid increase in
NF-
B binding activity, which peaked at 30 minutes (2.8-fold) and
remained elevated for 48 hours compared with the low levels in
unstimulated control cells
(Figure 6A
). LIX mRNA and protein were induced within 1 hour
after TNF-
addition and remained elevated for 48 hours
(Figure 6B
and 6C
). A 1-hour pretreatment with PDTC, a
specific inhibitor of NF-
B activation, strongly
inhibited both TNF-
stimulated NF-
B DNA binding activity
(Figure 6D
) and LIX message and protein induction
(Figure 6E
and 6F
).
|
Compared with TNF-
, the effects of
H2O2 were delayed and
transient
(Figure 7
). NF-
B activity was induced 2 hours after
H2O2 addition, peaked at
4 hours, and then fell to basal levels by 8 hours
(Figure 7A
).
H2O2-induced LIX mRNA and
protein expression was maximal at 4 hours
(Figure 7B
and 7C
). PDTC pretreatment markedly attenuated
NF-
B activity
(Figure 7D
) and abrogated LIX mRNA and protein expression
(Figure 7E
and 7F
). The ability of PDTC to block LIX
induction by either TNF-
or
H2O2 indicates that
NF-
B activation is required for cardiomyocyte induction
of LIX by these agents.
|
| Discussion |
|---|
|
|
|---|
B and the
production of the inflammatory cytokines TNF-
and
IL-1ß. We found that ischemia-reperfusion also induces the
expression of the neutrophil chemoattractant chemokines LIX, KC, and
MIP-2. LIX was expressed by resident myocardial cells during
reperfusion and was induced in isolated cardiomyocytes by
oxidative stress or TNF-
. KC and MIP-2 were also expressed in
reperfused heart tissue but were localized to infiltrating inflammatory
cells. Neutralization of LIX blocked nearly 80% of neutrophil
recruitment to rat myocardium during reperfusion.
Neutralization of KC or MIP-2 had much smaller effects. Taken together,
our results show for the first time that neutrophil recruitment during
myocardial ischemia-reperfusion in rats is mediated primarily
by myocardial cell expression of LIX. LIX was initially cloned as an LPS-induced, glucocorticoid-attenuated response gene in fibroblasts.22 LIX was subsequently shown to be a potent neutrophil chemoattractant27 28 and to be abundantly induced in multiple organs during endotoxemia.29 Interestingly, the organ expressing LIX message most abundantly (per microgram of RNA) during endotoxemia was the heart.29 LIX is also induced in the lung during pneumonia.30 The human chemokines most similar to LIX are ENA-78 and GCP-2.31 32 Although LIX has been called murine GCP-2,27 28 this designation is potentially misleading. The human ENA-78 and GCP-2 peptides are much more closely related to each other than they are to LIX, and phylogenetic analysis confirms that human GCP-2 is no more closely related to LIX than is human ENA-78.31 32 Moreover, the ENA-78 and GCP-2 genes have very high nucleotide similarity in noncoding as well as coding regions, suggesting that they are the result of an evolutionarily recent gene duplication.32 Because of these and other differences between the rodent and human ELR+CXC chemokine systems, including the lack of an IL-8 homologue in rodents, results for LIX in rats cannot be directly extrapolated to either ENA-78 or GCP-2 in humans. Our findings strongly suggest, however, that the roles of ENA-78 and GCP-2 in human myocardial ischemia-reperfusion should be investigated.
A key observation in the present study is the
differential localization of the expression of LIX, KC, and MIP-2 in
previously ischemic myocardium. LIX
immunoreactivity was localized in cells resident to
myocardium, whereas KC and MIP-2 were found in infiltrating
inflammatory cells but not in myocardial cells
(Figure 4
). It has previously been reported that adult rat
cardiomyocytes do secrete MIP-2 after prolonged stimulation
with IL-1ß, TNF-
, or
LPS.33 We evaluated only
short-term expression, however, so these results are compatible with
our observations. The immunohistochemical localization of LIX to
resident myocardial cells in reperfused ischemic
myocardium is supported by our in vitro studies showing
that LIX message and protein are rapidly inducible in isolated
cardiomyocytes
(Figures 6
and 7
). Induction of LIX by TNF-
or
H2O2 was abrogated by
pretreatment with PDTC, indicating that NF-
B activation is required
for LIX induction by either agent. LIX induction by TNF-
was rapid
and persistent, however, whereas LIX induction by
H2O2 was delayed and
transient. These differences are consistent with other studies
indicating that TNF-
and
H2O2 activate
NF-
B through different
mechanisms.34 The relative
importance of cytokine- and free radicalmediated pathways for
LIX induction during reperfusion and their roles in LIX-dependent
neutrophil recruitment and reperfusion injury are subjects for future
study.
Selective targeting of neutrophil chemoattractant chemokines
(or their receptors) is an attractive strategy for reducing
neutrophil-mediated myocardial injury. We have found that a single
chemokine, LIX, is the principal neutrophil chemoattractant in a model
of reperfusion after lethal ischemia in rats. This suggests
that in addition to IL-8, the LIX homologues GCP-2 and ENA-78 might
have important roles in human myocardial ischemia-reperfusion.
It has previously been observed that many cytokines,
chemokines, and adhesion molecules expressed after reperfusion are
dependent on NF-
B
activation.2 3
Because NF-
B activation was required for induction of LIX by
oxidative stress or TNF-
in cardiomyocytes, our data
provide further support for the idea that targeted blunting of NF-
B
activation could also be an effective strategy for limiting myocardial
injury after
ischemia.
| Acknowledgments |
|---|
Received October 11, 2000; revision received November 30, 2000; accepted December 14, 2000.
| References |
|---|
|
|
|---|
2.
Bowie A, ONeill
LAJ. Oxidative stress and nuclear factor-
B activation: a
reassessment of the evidence in the light of recent discoveries.
Biochem Pharmacol. 2000;59:1323.[Medline]
[Order article via Infotrieve]
3. Mercurio F, Manning AM. NF-kappaB as a primary regulator of the stress response. Oncogene. 1999;18:61636171.[Medline] [Order article via Infotrieve]
4. Bonizzi G, Piette J, Merville M-P, et al. Cell type-specific role for reactive oxygen species in nuclear factor-kappaB activation by Interleukin-1. Biochem Pharmacol. 2000;59:711.[Medline] [Order article via Infotrieve]
5.
Mercurio F, Zhu H,
Murray BW, et al. IKK-1 and IKK-2: cytokine-activated
IkappaB kinases essential for NF-kappaB activation.
Science. 1997;278:860866.
6. Chandrasekar B, Streitman JE, Colston JT, et al. Inhibition of nuclear factor kappa B attenuates proinflammatory cytokine and inducible nitric-oxide synthase expression in postischemic myocardium. Biochim Biophys Acta. 1998;1406:91106.[Medline] [Order article via Infotrieve]
7. Chandrasekar B, Freeman GL. Induction of nuclear factor kappaB and activation protein 1 in postischemic myocardium. FEBS Lett. 1997;401:3034.[Medline] [Order article via Infotrieve]
8.
Chandrasekar B,
Mitchell DA, Colston JT, et al. Regulation of CCAAT/enhancer binding
protein, interleukin-6, interleukin-6 receptor, and gp130 expression
during myocardial ischemia/reperfusion.
Circulation. 1999;99:427433.
9.
Bolli R, Marban E.
Molecular and cellular mechanisms of myocardial stunning.
Physiol Rev. 1999;79:609634.
10.
Jordan JE, Zhao
Z-Q, Vinten-Johansen J. The role of neutrophils in myocardial
ischemia-reperfusion injury.
Cardiovasc Res. 1999;43:860878.
11.
Entman ML, Smith
CW. Postreperfusion inflammation: a model for reaction to injury in
cardiovascular disease.
Cardiovasc Res. 1994;28:13011311.
12. Youker KA, Birdsall HH, Frangogiannis NG, et al. Phagocytes in ischemia injury. Ann N Y Acad Sci. 1997;832:243265.[Medline] [Order article via Infotrieve]
13. Frangogiannis NG, Youker KA, Entman ML. The role of the neutrophil in myocardial ischemia and reperfusion. EXS. 1996;76:263284.[Medline] [Order article via Infotrieve]
14. Lukacs NW, Hogaboam C, Campbell E, et al. Chemokines: function, regulation and alteration of inflammatory responses. Chem Immunol. 1999;72:102120.[Medline] [Order article via Infotrieve]
15. Baggiolini M, Dewald B, Moser B. Interleukin-8 and related chemotactic chemokines: CXC and CC chemokines. Adv Immunol. 1994;55:97179.[Medline] [Order article via Infotrieve]
16. Kalfin RE, Engelman RM, Rousou JA, et al. Induction of interleukin-8 expression during cardiopulmonary bypass. Circulation. 1993;88(suppl I):II-401II-406.
17. Kukielka GL, Smith CW, LaRosa GJ, et al. Interleukin-8 gene induction in the myocardium after ischemia and reperfusion in vivo. J Clin Invest. 1995;95:89103.
18. Ivey CL, Williams FM, Collins PD, et al. Neutrophil chemoattractants generated in two phases during reperfusion of ischemic myocardium in the rabbit: evidence for a role for C5a and interleukin-8. J Clin Invest. 1995;95:27202728.
19. Atta-ur-Rahman, Harvey K, Siddiqui RA. Interleukin-8: an autocrine inflammatory mediator. Curr Pharm Des. 1999;5:241253.[Medline] [Order article via Infotrieve]
20. Frevert CW, Huang S, Danaee H, et al. Functional characterization of the rat chemokine KC and its importance in neutrophil recruitment in a rat model of pulmonary inflammation. J Immunol. 1995;154:335344.[Abstract]
21. Driscoll KE, Hassenbein DG, Howard BW, et al. Cloning, expression, and functional characterization of rat MIP-2: a neutrophil chemoattractant and epithelial cell mitogen. J Leukoc Biol. 1995;58:359364.[Abstract]
22.
Smith JB,
Herschman HR. Glucocorticoid-attenuated response genes encode
intercellular mediators, including a new C-X-C chemokine.
J Biol Chem. 1995;270:1675616765.
23.
Chandrasekar B,
Colston JT, Geimer J, et al. Induction of nuclear factor
B but not
B-responsive cytokine expression during myocardial
reperfusion injury after neutropenia. Free
Radic Biol Med. 2000;28:15791588.[Medline]
[Order article via Infotrieve]
24. Piper HM, Probst I, Schwartz P, et al. Culturing of calcium stable adult cardiac myocytes. J Mol Cell Cardiol. 1982;14:397412.[Medline] [Order article via Infotrieve]
25. Ohmori Y, Hamilton TA. IFN-gamma selectively inhibits lipopolysaccharide-inducible JE/monocyte chemoattractant protein-1 and KC/GRO/melanoma growth-stimulating activity gene expression in mouse peritoneal macrophages. J Immunol. 1994;153:22042212.[Abstract]
26.
Wolpe SD, Sherry
B, Juers D, et al. Identification and characterization of
macrophage inflammatory protein 2.
Proc Natl Acad Sci
U S A. 1989;86:612624.
27. Wuyts A, Haelens A, Proost P, et al. Identification of mouse granulocyte chemotactic protein-2 from fibroblasts and epithelial cells: functional comparison with natural KC and macrophage inflammatory protein-2. J Immunol. 1996;157:17361743.[Abstract]
28.
Wuyts A, DHaese
A, Cremers V, et al. NH2- and COOH-terminal
truncations of murine granulocyte chemotactic protein-2 augment the in
vitro and in vivo neutrophil chemotactic potency.
J Immunol. 1999;163:61556163.
29. Rovai LE, Herschman HR, Smith JB. The murine neutrophil-chemoattractant chemokines LIX, KC, and MIP-2 have distinct induction kinetics, tissue distributions, and tissue-specific sensitivities to glucocorticoid regulation in endotoxemia. J Leukoc Biol. 1998;64:494502.[Abstract]
30.
Tsai WC, Strieter
RM, Mehrad B, et al. CXC chemokine receptor CXCR2 is essential for
protective innate host response in murine
Pseudomonas aeruginosa
pneumonia. Infect Immun. 2000;68:42894296.
31. Rovai LE, Herschman HR, Smith JB. Cloning and characterization of the human granulocyte chemotactic protein-2 gene. J Immunol. 1997;158:52575266.[Abstract]
32. Smith JB, Rovai LE, Herschman HR. Sequence similarities of a subgroup of CXC chemokines related to murine LIX: implications for the interpretation of evolutionary relationships among chemokines. J Leukoc Biol. 1997;62:598603.[Abstract]
33.
Massey KD,
Strieter RM, Kunkel SL, et al. Cardiac myocytes release
leukocyte-stimulating factors. Am J
Physiol. 1995;269:H980H987.
34.
Bowie AG, Moynagh
PN, ONeill LAJ. Lipid peroxidation is involved in the activation of
NF-kappaB by tumor necrosis factor but not interleukin-1 in the human
endothelial cell line ECV304: lack of involvement of
H2O2 in NF-kappaB
activation by either cytokine in both primary and transformed
endothelial cells. J
Biol Chem. 1997;272:2594125950.
This article has been cited by other articles:
![]() |
T. Ogawa, J. P. Veinot, M. L. Kuroski de Bold, T. Georgalis, and A. J. de Bold Angiotensin II receptor antagonism reverts the selective cardiac BNP upregulation and secretion observed in myocarditis Am J Physiol Heart Circ Physiol, June 1, 2008; 294(6): H2596 - H2603. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. M. Speetjens, P. J.K. Kuppen, M. H. Sandel, A. G. Menon, D. Burg, C. J.H. van de Velde, R. A.E.M. Tollenaar, H. J.G.M. de Bont, and J. F. Nagelkerke Disrupted Expression of CXCL5 in Colorectal Cancer Is Associated with Rapid Tumor Formation in Rats and Poor Prognosis in Patients Clin. Cancer Res., April 15, 2008; 14(8): 2276 - 2284. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Liang, A. J. Long, F. Bennett, M. J. Whitters, R. Karim, M. Collins, S. J. Goldman, K. Dunussi-Joannopoulos, C. M. M. Williams, J. F. Wright, et al. An IL-17F/A Heterodimer Protein Is Produced by Mouse Th17 Cells and Induces Airway Neutrophil Recruitment J. Immunol., December 1, 2007; 179(11): 7791 - 7799. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Duchene, F. Lecomte, S. Ahmed, C. Cayla, J. Pesquero, M. Bader, M. Perretti, and A. Ahluwalia A Novel Inflammatory Pathway Involved in Leukocyte Recruitment: Role for the Kinin B1 Receptor and the Chemokine CXCL5 J. Immunol., October 1, 2007; 179(7): 4849 - 4856. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Uemura, M. Li, T. Tsutsumi, T. Yamazaki, T. Kawada, A. Kamiya, M. Inagaki, K. Sunagawa, and M. Sugimachi Efferent vagal nerve stimulation induces tissue inhibitor of metalloproteinase-1 in myocardial ischemia-reperfusion injury in rabbit Am J Physiol Heart Circ Physiol, October 1, 2007; 293(4): H2254 - H2261. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Natarajan, F. N. Salloum, B. J. Fisher, E. D. Ownby, R. C. Kukreja, and A. A. Fowler 3rd Activation of hypoxia-inducible factor-1 via prolyl-4 hydoxylase-2 gene silencing attenuates acute inflammatory responses in postischemic myocardium Am J Physiol Heart Circ Physiol, September 1, 2007; 293(3): H1571 - H1580. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Frantz, J. Tillmanns, P. J. Kuhlencordt, I. Schmidt, A. Adamek, C. Dienesch, T. Thum, S. Gerondakis, G. Ertl, and J. Bauersachs Tissue-Specific Effects of the Nuclear Factor {kappa}B Subunit p50 on Myocardial Ischemia-Reperfusion Injury Am. J. Pathol., August 1, 2007; 171(2): 507 - 512. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-X. Wang, L.-X. Qian, D. Liu, L.-L. Yao, Q. Jiang, Z. Yu, Y.-H. Gui, T. P. Zhong, and H.-Y. Song Bone morphogenetic protein-2 acts upstream of myocyte-specific enhancer factor 2a to control embryonic cardiac contractility Cardiovasc Res, May 1, 2007; 74(2): 290 - 303. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Keller, R. Hoffmann, R. Lang, S. Brandau, C. Hermann, and S. Ehlers Genetically Determined Susceptibility to Tuberculosis in Mice Causally Involves Accelerated and Enhanced Recruitment of Granulocytes Infect. Immun., July 1, 2006; 74(7): 4295 - 4309. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Lafontant, A. R. Burns, E. Donnachie, S. B. Haudek, C. W. Smith, and M. L. Entman Oncostatin M differentially regulates CXC chemokines in mouse cardiac fibroblasts Am J Physiol Cell Physiol, July 1, 2006; 291(1): C18 - C26. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Luo and Z. Xia A small dose of hydrogen peroxide enhances tumor necrosis factor-alpha toxicity in inducing human vascular endothelial cell apoptosis: reversal with propofol. Anesth. Analg., July 1, 2006; 103(1): 110 - 116. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhai, X.-d. Shen, W. W. Hancock, F. Gao, B. Qiao, C. Lassman, J. A. Belperio, R. M. Strieter, R. W. Busuttil, and J. W. Kupiec-Weglinski CXCR3+CD4+ T Cells Mediate Innate Immune Function in the Pathophysiology of Liver Ischemia/Reperfusion Injury J. Immunol., May 15, 2006; 176(10): 6313 - 6322. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Nahrendorf, K. Hu, S. Frantz, F. A. Jaffer, C.-H. Tung, K.-H. Hiller, S. Voll, P. Nordbeck, D. Sosnovik, S. Gattenlohner, et al. Factor XIII Deficiency Causes Cardiac Rupture, Impairs Wound Healing, and Aggravates Cardiac Remodeling in Mice With Myocardial Infarction Circulation, March 7, 2006; 113(9): 1196 - 1202. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Zhang, X. Xu, B. J. Potter, W. Wang, L. Kuo, L. Michael, G. J. Bagby, and W. M. Chilian TNF-{alpha} Contributes to Endothelial Dysfunction in Ischemia/Reperfusion Injury Arterioscler. Thromb. Vasc. Biol., March 1, 2006; 26(3): 475 - 480. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Kwon, A. C. Keates, P. M. Anton, M. Botero, J. D. Goldsmith, and C. P. Kelly Topical antisense oligonucleotide therapy against LIX, an enterocyte-expressed CXC chemokine, reduces murine colitis Am J Physiol Gastrointest Liver Physiol, December 1, 2005; 289(6): G1075 - G1083. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Tan, Z. Ma, L. Han, R. Du, L. Zhao, X. Wei, D. Hou, B. H. Johnstone, M. R. Farlow, and Y. Du Caffeic acid phenethyl ester possesses potent cardioprotective effects in a rabbit model of acute myocardial ischemia-reperfusion injury Am J Physiol Heart Circ Physiol, November 1, 2005; 289(5): H2265 - H2271. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Teske, A. A. Bohn, J. F. Regal, J. J. Neumiller, and B. P. Lawrence Activation of the aryl hydrocarbon receptor increases pulmonary neutrophilia and diminishes host resistance to influenza A virus Am J Physiol Lung Cell Mol Physiol, July 1, 2005; 289(1): L111 - L124. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Jeyaseelan, R. Manzer, S. K. Young, M. Yamamoto, S. Akira, R. J. Mason, and G. S. Worthen Induction of CXCL5 During Inflammation in the Rodent Lung Involves Activation of Alveolar Epithelium Am. J. Respir. Cell Mol. Biol., June 1, 2005; 32(6): 531 - 539. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Abonia, K. F. Austen, B. J. Rollins, S. K. Joshi, R. A. Flavell, W. A. Kuziel, P. A. Koni, and M. F. Gurish Constitutive homing of mast cell progenitors to the intestine depends on autologous expression of the chemokine receptor CXCR2 Blood, June 1, 2005; 105(11): 4308 - 4313. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Jeyaseelan, H. W. Chu, S. K. Young, and G. S. Worthen Transcriptional Profiling of Lipopolysaccharide-Induced Acute Lung Injury Infect. Immun., December 1, 2004; 72(12): 7247 - 7256. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Smith and H. R. Herschman Targeted Identification of Glucocorticoid-attenuated Response Genes: In Vitro and in Vivo Models Proceedings of the ATS, November 1, 2004; 1(3): 275 - 281. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Goren, J. Cuenca, P. Martin-Sanz, and L. Bosca Attenuation of NF-{kappa}B signalling in rat cardiomyocytes at birth restricts the induction of inflammatory genes Cardiovasc Res, November 1, 2004; 64(2): 289 - 297. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Ruddy, F. Shen, J. B. Smith, A. Sharma, and S. L. Gaffen Interleukin-17 regulates expression of the CXC chemokine LIX/CXCL5 in osteoblasts: implications for inflammation and neutrophil recruitment J. Leukoc. Biol., July 1, 2004; 76(1): 135 - 144. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. S. Madorin, T. Rui, N. Sugimoto, O. Handa, G. Cepinskas, and P. R. Kvietys Cardiac Myocytes Activated by Septic Plasma Promote Neutrophil Transendothelial Migration: Role of Platelet-Activating Factor and the Chemokines LIX and KC Circ. Res., April 16, 2004; 94(7): 944 - 951. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Pold, L. X. Zhu, S. Sharma, M. D. Burdick, Y. Lin, P. P. N. Lee, A. Pold, J. Luo, K. Krysan, M. Dohadwala, et al. Cyclooxygenase-2-Dependent Expression of Angiogenic CXC Chemokines ENA-78/CXC Ligand (CXCL) 5 and Interleukin-8/CXCL8 in Human Non-Small Cell Lung Cancer Cancer Res., March 1, 2004; 64(5): 1853 - 1860. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-i. Oyama, C. Blais Jr, X. Liu, M. Pu, L. Kobzik, R. A. Kelly, and T. Bourcier Reduced Myocardial Ischemia-Reperfusion Injury in Toll-Like Receptor 4-Deficient Mice Circulation, February 17, 2004; 109(6): 784 - 789. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. T. Tarzami, W. Miao, K. Mani, L. Lopez, S. M. Factor, J. W. Berman, and R. N. Kitsis Opposing Effects Mediated by the Chemokine Receptor CXCR2 on Myocardial Ischemia-Reperfusion Injury: Recruitment of Potentially Damaging Neutrophils and Direct Myocardial Protection Circulation, November 11, 2003; 108(19): 2387 - 2392. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. YELLON and J. M. DOWNEY Preconditioning the Myocardium: From Cellular Physiology to Clinical Cardiology Physiol Rev, October 1, 2003; 83(4): 1113 - 1151. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. de Vries, R. A. Matthijsen, A. A. J. H. M. van Bijnen, T. G. A. M. Wolfs, and W. A. Buurman Lysophosphatidic Acid Prevents Renal Ischemia-Reperfusion Injury by Inhibition of Apoptosis and Complement Activation Am. J. Pathol., July 1, 2003; 163(1): 47 - 56. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. G. Souza, R. Guabiraba, V. Pinho, A. Bristow, S. Poole, and M. M. Teixeira IL-1-Driven Endogenous IL-10 Production Protects Against the Systemic and Local Acute Inflammatory Response Following Intestinal Reperfusion Injury J. Immunol., May 1, 2003; 170(9): 4759 - 4766. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Chandrasekar, P. C. Melby, H. M. Sarau, M. Raveendran, R. P. Perla, F. M. Marelli-Berg, N. O. Dulin, and I. S. Singh Chemokine-Cytokine Cross-talk. THE ELR+ CXC CHEMOKINE LIX (CXCL5) AMPLIFIES A PROINFLAMMATORY CYTOKINE RESPONSE VIA A PHOSPHATIDYLINOSITOL 3-KINASE-NF-kappa B PATHWAY J. Biol. Chem., February 7, 2003; 278(7): 4675 - 4686. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. S. WAYMAN, Y. HATTORI, M. C. MCDONALD, H. MOTA-FILIPE, S. CUZZOCREA, B. PISANO, P. K. CHATTERJEE, and C. THIEMERMANN Ligands of the peroxisome proliferator-activated receptors (PPAR-{gamma} and PPAR-{alpha}) reduce myocardial infarct size FASEB J, July 1, 2002; 16(9): 1027 - 1040. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Christopher, T. F. Mueller, C. Ma, Y. Liang, and D. L. Perkins Analysis of the Innate and Adaptive Phases of Allograft Rejection by Cluster Analysis of Transcriptional Profiles J. Immunol., July 1, 2002; 169(1): 522 - 530. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. T. Colston, B. Chandrasekar, and G. L. Freeman A Novel Peroxide-induced Calcium Transient Regulates Interleukin-6 Expression in Cardiac-derived Fibroblasts J. Biol. Chem., June 21, 2002; 277(26): 23477 - 23483. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Xu, D. Kumar, J. R. B. Dyck, W. R. Ford, A. S. Clanachan, G. D. Lopaschuk, and B. I. Jugdutt AT1 and AT2 receptor expression and blockade after acute ischemia-reperfusion in isolated working rat hearts Am J Physiol Heart Circ Physiol, April 1, 2002; 282(4): H1206 - H1215. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Gao, T.-L. Yue, D.-W. Shi, T. A Christopher, B. L Lopez, E. H Ohlstein, F. C Barone, and X. L Ma p38 MAPK inhibition reduces myocardial reperfusion injury via inhibition of endothelial adhesion molecule expression and blockade of PMN accumulation Cardiovasc Res, February 1, 2002; 53(2): 414 - 422. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Sachidanandan, R. Sambasivan, and J. Dhawan Tristetraprolin and LPS-inducible CXC chemokine are rapidly induced in presumptive satellite cells in response to skeletal muscle injury J. Cell Sci., January 7, 2002; 115(13): 2701 - 2712. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2001 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |