(Circulation. 2001;103:196.)
© 2001 American Heart Association, Inc.
Clinical Investigation and Reports |
Mutations in the Cardiac Ryanodine Receptor Gene (hRyR2) Underlie Catecholaminergic Polymorphic Ventricular Tachycardia
From the Molecular Cardiology Laboratories, IRCCS Fondazione Salvatore Maugeri, Pavia, Italy (S.G.P., C.N., M.M., R.B.); Department of Cardiology, University of Pavia, Pavia, Italy (S.G.P.); Laboratory of Human Genetics, Department of Biology, University of Padova, Padova, Italy (N.T., G.A.D.); Cardiology Department A De Gasperis, Niguarda Hospital, Milan, Italy (G.V.); DIBIT, Scientific Institute San Raffaele, Milan, Italy (V.S.); and the Molecular Medicine Section, Department of Neuroscience, University of Siena, Italy (V.S).
Correspondence to Silvia G. Priori, MD, PhD, Director of Molecular Cardiology, Fondazione Salvatore Maugeri, Associate Professor of Cardiology, University of Pavia, Via Ferrata 8, 27100 Pavia, Italy. E-mail spriori{at}fsm.it
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Background—Catecholaminergic polymorphic ventricular tachycardia is a genetic arrhythmogenic disorder characterized by stress-induced, bidirectional ventricular tachycardia that may degenerate into cardiac arrest and cause sudden death. The electrocardiographic pattern of this ventricular tachycardia closely resembles the arrhythmias associated with calcium overload and the delayed afterdepolarizations observed during digitalis toxicity. We speculated that a genetically determined abnormality of intracellular calcium handling might be the substrate of the disease; therefore, we considered the human cardiac ryanodine receptor gene (hRyR2) a likely candidate for this genetically transmitted arrhythmic disorder.
Methods and Results—Twelve patients presenting with typical catecholaminergic polymorphic ventricular tachycardia in the absence of structural heart abnormalities were identified. DNA was extracted from peripheral blood lymphocytes, and single-strand conformation polymorphism analysis was performed on polymerase chain reaction–amplified exons of the hRyR2 gene. Four single nucleotide substitutions leading to missense mutations were identified in 4 probands affected by the disease. Genetic analysis of the asymptomatic parents revealed that 3 probands carried de novo mutations. In 1 case, the identical twin of the proband died suddenly after having suffered syncopal episodes. The fourth mutation was identified in the proband, in 4 clinically affected family members, and in none of 3 nonaffected family members in a kindred with 2 sudden deaths that occurred at 16 and 14 years, respectively, in the sisters of the proband.
Conclusions—We demonstrated that, in agreement with our hypothesis, hRyR2 is a gene responsible for catecholaminergic polymorphic ventricular tachycardia.
Key Words: arrhythmia • genetics • tachycardia • ryanodine receptor calcium release channel
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Catecholaminergic ventricular tachycardia (VT) occurring in the structurally intact heart was described by Coumel et al in 19781 and by Leenhardt et al in 19952 as a distinct clinical entity of unknown origin with manifestations in childhood and adolescence. Affected individuals present with syncopal events and with a distinctive pattern of highly reproducible, stress-related, bidirectional VT in the absence of both structural heart disease and a prolonged QT interval. A family history of juvenile sudden death and stress-induced syncope is present in approximately one third of cases. Recently, Swan et al3 showed a linkage of the disease to chromosome 1q42-q43 in 2 affected families.
On the basis of both the typical electrocardiographic pattern and on the hypothesis that delayed afterdepolarizations underlie arrhythmias in this disease, we hypothesized that mutations of the human cardiac ryanodine receptor gene (hRyR2)4 mapped to 1q42-q435 6 may be associated with catecholaminergic polymorphic VT. We detected 4 missense mutations cosegregating with the clinical phenotype. These data suggest that hRyR2 is a gene for catecholaminergic VT.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Study Population
The study included 12 probands presenting with bidirectional VT that was reproducibly induced by exercise stress testing and/or isoproterenol infusion in the absence of structural heart abnormalities. All probands had a clinical diagnosis of catecholaminergic polymorphic VT.1 2 A familial history of syncope and sudden death was present in 5 of the 12 patients (41%). All patients had a normal ECG at enrollment, normal atrioventricular conduction, and a normal QT interval.
All patients gave informed consent to the clinical and genetic study; the study was approved by the internal ethics committee of Fondazione Salvatore Maugeri.
Mutation Screening
Mutation screening was performed on genomic DNA
samples that were extracted from peripheral blood lymphocytes using
standard methods,7 and the
genomic structure of the hRyR2
gene was obtained (by N.T. and
G.A.D.).8 Intronic primers
that amplify 90 of 103 exons, including those corresponding to the
protein domain involved in interactions with
FKBP12.6,9
were used for polymerase chain reaction
amplifications.4 Polymerase
chain reaction products ranging from 120 to 300 bp were analyzed by
single-strand conformation polymorphisms (SSCP) on nondenaturing
polyacrylamide gels. All abnormal conformers were sequenced using a
ABI310 genetic analyzer. A control group of 400 healthy and unrelated
subjects (800 alleles) was used to exclude the possibility of the
detected mutations being DNA polymorphisms. Additionally, for all
patients included in the present study, the entire coding sequences of
the KCNQ1, KCNH2, SCN5A,
KCNE1, and KCNE2 genes were screened using
previously described primer pairs10 to exclude the
possibility of atypical variants of long-QT
syndrome.11
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Clinical Findings
Family A
The proband for family A (III-2 in Figure 1
) is an 8-year-old boy who was referred (to S.G.P.)
for clinical evaluation of recurrent syncopal events that had occurred
since he was 3 years old. Events were invariably induced by exercise,
and they never required resuscitation. No family history of sudden
death or of syncopal episodes was present, and the parents had normal
hearts and no exercise-induced arrhythmias.. The resting ECG of the
proband showed normal sinus rhythm, normal atrioventricular conduction,
and normal QT duration. Ventricular arrhythmias (isolated premature
ventricular beats, couplets, and runs of bidirectional VT) could be
reproducibly induced during exercise testing and progressively worsened
as the workload increased. Echocardiograms and right ventricular
angiography demonstrated an entirely normal heart. No repetitive
arrhythmias were induced during programmed electrical
stimulation (maximum of 3 extrastimuli on driving cycle lengths
from 600 ms to 350 ms), but isoproterenol infusion (2 µg/min) induced
the spontaneous onset of bidirectional VT. The arrhythmia had a cycle
length of 300 ms and a morphology resembling that of the clinically
observed VT, and it spontaneously terminated after 2 minutes when
isoproterenol infusion was discontinued The patient was treated with
nadolol (2
mg · kg–1 · d–1),
and an implantable cardiac defibrillator (ICD) was implanted. No
further syncopal episodes have occurred during 2 years of follow up,
but short runs of nonsustained polymorphic VT were recorded by the
ICD.
|
Family B
The proband of family B is an 8-year-old boy
(II-1 in
Figure 1
) who was referred (to G.V.) because of the
occurrence of repeated syncopal episodes. The identical twin of the
index case had a history of repeated syncopal events and died suddenly
at 7 years of age; autopsy failed to demonstrate abnormal findings, and
death was attributed to cardiac arrest. The parents of the twins are
asymptomatic, with normal hearts and no exercise-induced arrhythmias.
The baseline ECG of the proband is unremarkable, with normal PR and QT
intervals and no abnormalities of ventricular repolarization.
Nonsustained, bidirectional VT was reproducibly induced during exercise
stress testing. No structural and functional abnormalities were
detected with MRI or during right and left ventriculography. The
patient was treated with atenolol (2
mg · kg–1 · d–1),
and adequate control of the arrhythmias was achieved with no
recurrences of syncope after 6 years of
follow-up.
Family C
The proband of family C is a 14-year-old boy (II-1 in
Figure 1) who was referred (to G.V.) because of frequent
episodes of loss of consciousness during exercise, which began at 7
years of age. No family history of sudden cardiac death and/or syncopal
episodes was present. The parents are asymptomatic, with normal hearts
and no exercise-induced arrhythmias. Baseline ECG of the proband was
normal, and nonsustained, bidirectional VT was reproducibly elicited by
exercise stress testing. No cardiac abnormalities were identified with
echocardiography, MRI, or right and left ventriculography. The patient
was treated with atenolol (2
mg · kg–1 · d–1),
which prevented recurrences of syncope and the onset of repetitive
exercise-induced ventricular arrhythmias during 9 years of
follow-up.
Family D
The proband of family D (III-3 in
Figure 2) underwent cardiac evaluation at 30 years when she
experienced palpitations. Her family history included the sudden
cardiac death of 2 sisters, which occurred when they were 14 and 16
years old, respectively. One of the 2 girls died while being tested at
school and the second while climbing stairs. The Holter
recording demonstrated nonsustained, bidirectional, polymorphic VT
(maximum of 15 beats). Because of the family history of cardiac arrest,
an ICD was implanted. The family was then referred (to S.G.P.) for
clinical and genetic evaluation.
|
Clinical evaluation of family members across 4 generations
demonstrated that the proband (III-3 in
Figure 2), her mother (II-1 in
Figure 2; age, 59 years), 2 of her sisters (III-2 and III-4
in
Figure 2; ages, 28 and 36 years), and her brother (III-1 in
Figure 2; age, 23 years) developed bidirectional VT during
exercise stress testing. None of them had structural abnormalities of
the heart. Six additional family members (II-2, II-3, III-5, III-6,
IV-1, and IV-2 in
Figure 2) underwent clinical evaluation, and none developed
ventricular arrhythmias during exercise stress testing. The 92-year-old
grandfather of the proband (I-1 in
Figure 2) did not carry the genetic defect. He was
asymptomatic for syncopal events and had no arrhythmias at Holter
recording, but he could not perform exercise stress testing because of
severe arthritis.
During 1 year of follow-up after ICD implantation, the proband experienced 2 appropriate shocks that successfully terminated ventricular fibrillation. On both occasions, emotional stress preceded the events: the first episode occurred while the patient was being fired by her boss; the second while she was acting in a play at the local school.
Identification of
hRyR2 Mutations
Four different single nucleotide substitutions leading
to hRyR2 missense mutations
(nonconservative amino acid changes) were identified in the 4 probands
with catecholaminergic VT. A Ser to Leu substitution at position 2246
(exon 44) was identified in the proband of family A
(Figure 1), an Arg to Ser substitution at position 2474 (exon
49) in the proband of family B
(Figure 1), an Asn to Lys substitution at position 4104 (exon
90) in the proband of family C
(Figure 1), and a Arg to Cys substitution at position 4497
(exon 93) in the proband of family D
(Figure 2).
The primer pairs used to amplify the mutated exons were as follows: Exon 44: 44F, GTTACAGCACGATCCAGGTT; 44R, GAGAAAACCGTGAAAAAGCA Exon 49: 49F, ACAGCCATTGACACCAAAAT; 49R, AGAGAGGAGGAAGTCCATCG Exon 90: 90bF, GAGCCATAAGCACTACACGC; 90bR, ATAGACCCTCTCGATGCGTT Exon 94: 93F, AGGTTTCAAGCCTGTTGATTC; 93R, GCCTAGGCACCAGTATTTCA
In 3 cases, the mutations were de novo and they were not inherited from the parents (biological paternity was confirmed by DNA analysis). The last hRyR2 mutation was present in all 5 individuals with the clinical phenotype (II-1, III-1, III-2, III-3, and III-4) and in none of the 6 with a negative clinical phenotype (100% concordance between clinical and genetic diagnosis; 100% penetrance). None of the mutations was present in the DNA obtained from 400 normal subjects (800 alleles).
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
We demonstrated that mutations in hRyR2 cause catecholaminergic VT. Several lines of evidence support this conclusion. First, catecholaminergic VT has been linked with chromosome 1q42-q43,3 where RyR2 maps. Second, RyR2 is responsible for calcium release from the sarcoplasmic reticulum in response to calcium entry from the dihydropyridine receptor12 (voltage-dependent calcium channel). A dysfunction in this protein, which is pivotal in controlling calcium homeostasis, is compatible with the presumed mechanisms of bidirectional VT, which likely involve calcium overload–mediated, delayed afterdepolarizations.13 14 Third, intragenic mutations leading to nonconservative amino acid substitutions have been identified in highly conserved regions of the gene and were cosegregated with the clinical phenotype. Finally, hRyR2 mutations are located in functionally important regions of the gene, in locations where mutations were identified in the RyR1 gene (the skeletal muscle homologue of hRyR2) and are associated with malignant hyperthermia (MH) and central core disease (CCD).15 Finally, the evidence that in 3 probands hRyR2 mutations occurred de novo support the concept that these missense mutations are sufficient to cause the disease.
Background
In 1995, Leenhardt et
al2 described a series of
patients with a remarkably uniform pattern of stress-induced,
bidirectional, polymorphic VT in the absence of structural heart
disease. Approximately one third of the cases had a family history of
juvenile sudden death and/or stress-related syncope. Of interest, most
of the patients were the only affected individual in their family, thus
suggesting either the existence of incomplete penetrance of the genetic
defect or the occurrence of de novo mutations. The presence of
bidirectional VT and the reproducible pattern of adrenergic-induced
ventricular ectopic activity are very important distinguishing features
of this disease and its pathogenesis. In contrast with patients who
have long-QT syndrome, the patients described by Coumel et
al1 and Leenhardt et
al2 have a normal QT
interval, they do not develop VT with a pattern of torsade des pointes,
and their VT is easily inducible during exercise stress testing. In
their study, Leenhardt et al2
stated that the bidirectional arrhythmias observed in their patients
had an "ECG pattern most commonly described in digitalis
toxicity."16 This
observation points to delayed afterdepolarizations as a likely
arrhythmogenic mechanism in these
patients.13 Delayed
afterdepolarizations are caused by intracellular calcium overload, as
occurs with digitalis
toxicity,17 and abnormal
calcium release from the sarcoplasmic reticulum; they are enhanced by
adrenergic
stimulation13 14
and are blocked by the in vitro administration of
ryanodine.13 Thus, the human
cardiac ryanodine receptor gene seemed to be a good candidate for this
form of idiopathic ventricular arrhythmia.
Mutations in the
hRyR2 Gene in Patients With
Catecholaminergic VT
We identified mutations in the
hRyR2 gene in 4 of 12 probands.
Two of the 4 genotyped probands had a family history of juvenile sudden
cardiac death. In one case (family B), the identical twin of the
proband, who had history of stress-related syncopal events since he was
3 years old, died suddenly (negative autopsy) at 7 years of age while
running on the beach. In the second case (family D), 2 sisters of the
proband (both with negative autopsy) died suddenly at 14 years (while
being tested at school) and 16 years (while climbing stairs). A
clinical evaluation of the family members of the proband in family D
demonstrated that the 5 gene carriers presented with bidirectional VT
when performing even a moderate degree of exercise. The pattern of
arrhythmias was identical in the proband and the other 4 carriers
(Figure 3). The mutation identified in this 4-generation
family clearly cosegregates with the clinical phenotype. In this
family, cardiac arrest occurred during adolescence in the 2 sisters who
died suddenly but several years later (30 years) in the
proband, suggesting a variable age-related manifestation of the
disease.
|
On the basis of the published amino acid sequence of hRyR2,4 all 4 mutations involve highly conserved residues among the hRyR homologues and RyR proteins from other animal species, thus reinforcing the hypothesis that these mutations are associated with functional changes in the hRyR2 gene product. Some interesting observations stem from the comparison of the mutations identified here and those found in the RYR1 gene (skeletal muscle homologue of RyR2) that are associated with 2 human diseases affecting skeletal muscle, MH and CCD. MH is a pharmacogenetic disorder of skeletal muscle triggered by common anesthetics and depolarizing muscle relaxants and, in some susceptible individuals, by severe exercise. CCD is a nonprogressive myopathy characterized by hypotonia and proximal muscle weakness. CCD is usually closely associated with MH.15
Mutations in MH and CCD patients are clustered in 3 regions of the RYR1 gene: region 1 corresponds to the first 614 amino acids (aa); region 2 corresponds to a region between aa and 2162 to 2458; and region 3 corresponds to the C-terminal region of the RYR1-encoded protein, where mutations have been found in the pore-forming region of the encoded channel between aa and 4800 to 4900.15 An alignment of the mutations Ser 2246 Leu and Arg 2474 Ser, which was found in families A and B, with the corresponding aa sequence in the RYR1 protein locates these 2 mutations: one is in the center of the second cluster of MH/CCD mutations and the second is very close to the same region. However, Asn 4104 Lys is very close to and Arg 4497 Cys lies within the "D1" region (divergent region 1),18 19 20 which is one of the most investigated region of the RYR1 protein because it appears to contain important sites for regulating channel functions.15 18 19 20 21
Marx et al22 recently reported that adrenergic stimulation of cardiomyocytes results in the hyperphosphorylation of RyR2 through PKA, which results in FKBP12.6 displacement and altered channel activity and, thus, cardiac dysfunction. Mutations found in MH/CCD patients increase the sensitivity of the mutant RYR1 channels to activating concentrations of Ca2+.15 18 19 In analogy, it is reasonable to envision that patients with catecholaminergic VT, as a consequence of the observed mutations in the hRyR2 gene, have an increased sensitivity to Ca2+; therefore, intense adrenergic stimulation due to emotional stress and/or increased physical activity may lead to calcium overload and precipitate severe tachyarrhythmias.
We identified hRyR2 mutations in 4 of 12 patients with catecholaminergic VT. This may be due to the fact that we have not yet completed the screening of this very large gene or to incomplete sensitivity of the screening techniques. We favor the hypothesis that, in analogy with other arrhythmogenic disorders, genetic heterogeneity underlies catecholaminergic VT. The finding of hRyR2 mutations in ARVD2,8 mapped to 1q42-q43,23 raises the question of the possible allelism of ARVD2 and catecholaminergic VT.
In summary, we present evidence suggesting that mutations in RyR2 are likely to cause catecholaminergic VT. This finding suggests cardiac intracellular calcium release channels may have a role in the genesis of human arrhythmogenic disorders.
|
Acknowledgments |
|---|
This study was partially supported by a Research Grant from the Leducq Foundation and by Telethon grant 1058. We acknowledge the skillful contributions of Dr Donata Cappelletti and Dr Barbara Colombi to the molecular screening of the families.
|
Footnotes |
|---|
This article originally appeared Online on December 11, 2000. (Circulation. 2000;102:r49–r53.)
Received November 10, 2000; revision received November 29, 2000; accepted November 29, 2000.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Coumel P, Fidelle J, Lucet V, et al. Catecholaminergic-induced severe ventricular arrhythmias with Adams-Stokes syndrome in children: report of four cases. Br Heart J. 1978;40(suppl):28–37.
2.
Leenhardt A, Lucet
V, Denjoy I, et al. Catecholaminergic polymorphic ventricular
tachycardia in children: a 7-year follow-up of 21 patients.
Circulation. 1995;91:1512–1519.
3.
Swan H, Piippo K,
Viitasalo M, et al. Arrhythmic disorder mapped to chromosome 1q42-q43
causes malignant polymorphic ventricular tachycardia in structurally
normal hearts. J Am Coll
Cardiol. 1999;34:2035–2042.
4. Tunwell RE, Wickenden C, Bertrand BM, et al. The human cardiac muscle ryanodine receptor-calcium release channel: identification, primary structure, and topological analysis. Biochem J. 1996;318:477–487.
5. Otsu K, Fujii J, Periasamy M, et al. Chromosome mapping of five human cardiac and skeletal muscle sarcoplasmic reticulum protein genes. Genomics. 1993;17:507–509.[Medline] [Order article via Infotrieve]
6.
Otsu K, Willard HF,
Khanna VK, et al. Molecular cloning of cDNA encoding the Ca2+ release
channel (ryanodine receptor) of rabbit cardiac muscle sarcoplasmic
reticulum. J Biol Chem. 1990;265:13472–13483.
7. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989.
8. Tiso N, Stephan DA, Nava A, et al. Identification of mutations in the cardiac Ryanodine receptor gene in families affected with arrhythmogenic right ventricular cardiomyopathy type 2 (ARVD2). Hum Mol Genet. In press.
9.
Marks AR. Cardiac
intracellular calcium release channels: role in heart failure.
Circ Res. 2000;87:8–11.
10.
Splawski I, Shen
J, Timothy KW, et al. Spectrum of mutations in long-QT syndrome genes:
KVLQT1,
HERG,
SCN5A,
KCNE1, and
KCNE2.
Circulation. 2000;102:1178–1185.
11.
Priori SG,
Napolitano C, Schwartz PJ. Low penetrance in the long-QT syndrome:
clinical impact. Circulation. 1999;99:529–533.
12.
Fabiato A.
Calcium induced release of calcium from cardiac sarcoplasmic reticulum.
Am J Physiol. 1983;245:C1–C14.
13.
Priori SG, Corr
PB. Mechanisms underlying early and delayed afterdepolarizations
induced by catecholamines. Am J
Physiol. 1990;258:H1796–H805.
14.
Priori SG,
Mantica M, Schwartz PJ. Delayed afterdepolarizations elicited in vivo
by left stellate ganglion stimulation.
Circulation. 1988;78:178–185.
15. McCarthy TV, Quane KA, Lynch PJ. Ryanodine receptor mutations in malignant hyperthermia and central core disease. Hum Mutat. 2000;15:410–417.[Medline] [Order article via Infotrieve]
16. Wellens HJJ. The electrocardiogram in digitalis intoxication. In: Yu PN, Goodwin JF, eds. Progress In Cardiology. Philadelphia: Lea & Febiger; 1976:271–290.
17.
Rosen MR, Danilo
P Jr. Effects of tetrodotoxin, lidocaine, verapamil and AHR-2666 on
oubain-induced delayed after depolarizations in canine Purkinje fibers.
Circ Res. 1980;46:117–124.
18.
Lynch PJ, Tong J,
Lehane M, et al. A mutation in the transmembrane luminal domain of the
ryanodine receptor is associated with abnormal calcium release channel
function and severe central core disease.
Proc Natl Acad Sci
U S A. 1999;96:4164–4169.
19.
Brown RL, Pollock
AN, Couchman KG, et al. A novel ryanodine receptor mutation and
genotype-phenotype correlation in a large malignant hyperthermia New
Zealand Maori Pedigree. Hum Mol
Genet. 2000;9:1515–1524.
20. Sorrentino V, Volpe P. Ryanodine receptors: how many, where and why? Trends Pharmacol Sci. 1993;14:98–105.[Medline] [Order article via Infotrieve]
21. Sorrentino V, Barone V, Rossi D. Intracellular Ca2+ release channels in evolution. Curr Opin Genet Dev. In press.
22. Marx SO, Reiken S, Hisamatsu Y, et al. PKA phosphorylation dissociates FKBP12.6 from the calcium release channel (ryanodine receptor): defective regulation in failing hearts. Cell. 2000;101:365–376.[Medline] [Order article via Infotrieve]
23.
Rampazzo A, Nava
A, Erne P, et al. A new locus for arrhythmogenic right ventricular
cardiomyopathy (ARVD2) maps to chromosome 1q42-q43.
Hum Mol Genet. 1995;4:2151–2154.
This article has been cited by other articles:
 |
|
 |
|
  N. Mathur, S. Sood, S. Wang, R. J. van Oort, S. Sarma, N. Li, D. G. Skapura, J. H. Bayle, M. Valderrabano, and X. H.T. Wehrens Sudden Infant Death Syndrome in Mice With an Inherited Mutation in RyR2 Circ Arrhythm Electrophysiol, December 1, 2009; 2(6): 677 - 685. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Medeiros-Domingo, Z. A. Bhuiyan, D. J. Tester, N. Hofman, H. Bikker, J. P. van Tintelen, M. M.A.M. Mannens, A. A.M. Wilde, and M. J. Ackerman The RYR2-Encoded Ryanodine Receptor/Calcium Release Channel in Patients Diagnosed Previously With Either Catecholaminergic Polymorphic Ventricular Tachycardia or Genotype Negative, Exercise-Induced Long QT Syndrome A Comprehensive Open Reading Frame Mutational Analysis. J. Am. Coll. Cardiol., November 24, 2009; 54(22): 2065 - 2074. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. C.W. Stevens, D. Terentyev, A. Kalyanasundaram, M. Periasamy, and S. Györke Intra-sarcoplasmic reticulum Ca2+ oscillations are driven by dynamic regulation of ryanodine receptor function by luminal Ca2+ in cardiomyocytes J. Physiol., October 15, 2009; 587(20): 4863 - 4872. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. D. den Haan, B. Y. Tan, M. N. Zikusoka, L. I. Llado, R. Jain, A. Daly, C. Tichnell, C. James, N. Amat-Alarcon, T. Abraham, et al. Comprehensive Desmosome Mutation Analysis in North Americans With Arrhythmogenic Right Ventricular Dysplasia/Cardiomyopathy Circ Cardiovasc Genet, October 1, 2009; 2(5): 428 - 435. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M Borjesson and A Pelliccia Incidence and aetiology of sudden cardiac death in young athletes: an international perspective Br. J. Sports Med., September 1, 2009; 43(9): 644 - 648. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. A. Beery, M. J. Shah, and D. W. Benson Genetic Characterization of Familial CPVT After 30 Years Biol Res Nurs, July 1, 2009; 11(1): 66 - 72. [Abstract] [PDF]
|
|
|
|
|
|
F. Protasi, C. Paolini, and M. Dainese Calsequestrin-1: a new candidate gene for malignant hyperthermia and exertional/environmental heat stroke J. Physiol., July 1, 2009; 587(13): 3095 - 3100. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Dainese, M. Quarta, A. D. Lyfenko, C. Paolini, M. Canato, C. Reggiani, R. T. Dirksen, and F. Protasi Anesthetic- and heat-induced sudden death in calsequestrin-1-knockout mice FASEB J, June 1, 2009; 23(6): 1710 - 1720. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Hayashi, I. Denjoy, F. Extramiana, A. Maltret, N. R. Buisson, J.-M. Lupoglazoff, D. Klug, M. Hayashi, S. Takatsuki, E. Villain, et al. Incidence and Risk Factors of Arrhythmic Events in Catecholaminergic Polymorphic Ventricular Tachycardia Circulation, May 12, 2009; 119(18): 2426 - 2434. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. A. Koplan and W. G. Stevenson Ventricular Tachycardia and Sudden Cardiac Death Mayo Clin. Proc., March 1, 2009; 84(3): 289 - 297. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Tateishi, M. Yano, M. Mochizuki, T. Suetomi, M. Ono, X. Xu, H. Uchinoumi, S. Okuda, T. Oda, S. Kobayashi, et al. Defective domain-domain interactions within the ryanodine receptor as a critical cause of diastolic Ca2+ leak in failing hearts Cardiovasc Res, February 15, 2009; 81(3): 536 - 545. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Yield of genetic screening in inherited cardiac channelopathies: how to prioritize access to genetic testing. Circ Arrhythm Electrophysiol, February 1, 2009; 2(1): 6 - 15.
|
|
|
|
 |
|
 M. Fernandez-Velasco, A. Rueda, N. Rizzi, J.-P. Benitah, B. Colombi, C. Napolitano, S. G. Priori, S. Richard, and A. M. Gomez Increased Ca2+ Sensitivity of the Ryanodine Receptor Mutant RyR2R4496C Underlies Catecholaminergic Polymorphic Ventricular Tachycardia Circ. Res., January 30, 2009; 104(2): 201 - 209. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. G. Priori, C. Napolitano, S. E. Humphries, and J. Skipworth CHAPTER 9 Genetics of Cardiovascular Diseases ESC Textbook of Cardiovascular Medicine, January 1, 2009; 2(1): med-9780199566990-chapter - med-9780199566990-chapter. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Atallah, F. Fynn-Thompson, F. Cecchin, D. J. DiBardino, E. P. Walsh, and C. I. Berul Video-Assisted Thoracoscopic Cardiac Denervation: A Potential Novel Therapeutic Option for Children With Intractable Ventricular Arrhythmias Ann. Thorac. Surg., November 1, 2008; 86(5): 1620 - 1625. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. A. Schoonderwoerd and I. van Gelder A patient with long QT, sinus bradycardia, and ventricular ectopy: part II Europace, November 1, 2008; 10(11): 1353 - 1354. [Full Text] [PDF]
|
|
|
|
 |
|
 D. A. Arvanitis, D. Sanoudou, F. Kolokathis, E. Vafiadaki, V. Papalouka, A. Kontrogianni-Konstantopoulos, G. N. Theodorakis, I. A. Paraskevaidis, S. Adamopoulos, G. W. Dorn II, et al. The Ser96Ala variant in histidine-rich calcium-binding protein is associated with life-threatening ventricular arrhythmias in idiopathic dilated cardiomyopathy Eur. Heart J., October 2, 2008; 29(20): 2514 - 2525. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. A. Venetucci and D. A. Eisner Calsequestrin Mutations and Sudden Death: A Case of Too Little Sarcoplasmic Reticulum Calcium Buffering? Circ. Res., August 1, 2008; 103(3): 223 - 225. [Full Text] [PDF]
|
|
|
|
|
|
N. Rizzi, N. Liu, C. Napolitano, A. Nori, F. Turcato, B. Colombi, S. Bicciato, D. Arcelli, A. Spedito, M. Scelsi, et al. Unexpected Structural and Functional Consequences of the R33Q Homozygous Mutation in Cardiac Calsequestrin: A Complex Arrhythmogenic Cascade in a Knock In Mouse Model Circ. Res., August 1, 2008; 103(3): 298 - 306. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. R. Behr, C. Dalageorgou, M. Christiansen, P. Syrris, S. Hughes, M. T. Tome Esteban, E. Rowland, S. Jeffery, and W. J. McKenna Sudden arrhythmic death syndrome: familial evaluation identifies inheritable heart disease in the majority of families Eur. Heart J., July 1, 2008; 29(13): 1670 - 1680. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Kurebayashi, H. Nishizawa, Y. Nakazato, H. Kurihara, S. Matsushita, H. Daida, and Y. Ogawa Aberrant cell-to-cell coupling in Ca2+-overloaded guinea pig ventricular muscles Am J Physiol Cell Physiol, June 1, 2008; 294(6): C1419 - C1429. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. A.M. Wilde, Z. A. Bhuiyan, L. Crotti, M. Facchini, G. M. De Ferrari, T. Paul, C. Ferrandi, D. R. Koolbergen, A. Odero, and P. J. Schwartz Left Cardiac Sympathetic Denervation for Catecholaminergic Polymorphic Ventricular Tachycardia N. Engl. J. Med., May 8, 2008; 358(19): 2024 - 2029. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. M. Beckmann, A. A.M. Wilde, and S. Kaab Dual Inheritance of Sudden Death from Cardiovascular Causes N. Engl. J. Med., May 8, 2008; 358(19): 2077 - 2078. [Full Text] [PDF]
|
|
|
|
 |
|
 Heart Rhythm UK Familial Sudden Death Syndromes St Clinical indications for genetic testing in familial sudden cardiac death syndromes: an HRUK position statement Heart, April 1, 2008; 94(4): 502 - 507. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Yamamoto, M. Yano, X. Xu, H. Uchinoumi, H. Tateishi, M. Mochizuki, T. Oda, S. Kobayashi, N. Ikemoto, and M. Matsuzaki Identification of Target Domains of the Cardiac Ryanodine Receptor to Correct Channel Disorder in Failing Hearts Circulation, February 12, 2008; 117(6): 762 - 772. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Liu and S. G. Priori Disruption of calcium homeostasis and arrhythmogenesis induced by mutations in the cardiac ryanodine receptor and calsequestrin Cardiovasc Res, January 15, 2008; 77(2): 293 - 301. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. A. Venetucci, A. W. Trafford, S. C. O'Neill, and D. A. Eisner The sarcoplasmic reticulum and arrhythmogenic calcium release Cardiovasc Res, January 15, 2008; 77(2): 285 - 292. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Gyorke and D. Terentyev Modulation of ryanodine receptor by luminal calcium and accessory proteins in health and cardiac disease Cardiovasc Res, January 15, 2008; 77(2): 245 - 255. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Jiang, W. Chen, R. Wang, L. Zhang, and S. R. W. Chen Loss of luminal Ca2+ activation in the cardiac ryanodine receptor is associated with ventricular fibrillation and sudden death PNAS, November 13, 2007; 104(46): 18309 - 18314. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. E. Lehnart, M. J. Ackerman, D. W. Benson Jr, R. Brugada, C. E. Clancy, J. K. Donahue, A. L. George Jr, A. O. Grant, S. C. Groft, C. T. January, et al. Inherited Arrhythmias: A National Heart, Lung, and Blood Institute and Office of Rare Diseases Workshop Consensus Report About the Diagnosis, Phenotyping, Molecular Mechanisms, and Therapeutic Approaches for Primary Cardiomyopathies of Gene Mutations Affecting Ion Channel Function Circulation, November 13, 2007; 116(20): 2325 - 2345. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Cerrone, S. F. Noujaim, E. G. Tolkacheva, A. Talkachou, R. O'Connell, O. Berenfeld, J. Anumonwo, S. V. Pandit, K. Vikstrom, C. Napolitano, et al. Arrhythmogenic Mechanisms in a Mouse Model of Catecholaminergic Polymorphic Ventricular Tachycardia Circ. Res., November 9, 2007; 101(10): 1039 - 1048. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. A. Bhuiyan, M. P. van den Berg, J. P. van Tintelen, M. T.E. Bink-Boelkens, A. C.P. Wiesfeld, M. Alders, A. V. Postma, I. van Langen, M. M.A.M. Mannens, and A. A.M. Wilde Expanding Spectrum of Human RYR2-Related Disease: New Electrocardiographic, Structural, and Genetic Features Circulation, October 2, 2007; 116(14): 1569 - 1576. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. J. Mohler and X. H. T. Wehrens Mechanisms of Human Arrhythmia Syndromes: Abnormal Cardiac Macromolecular Interactions Physiology, October 1, 2007; 22(5): 342 - 350. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Antzelevitch Role of spatial dispersion of repolarization in inherited and acquired sudden cardiac death syndromes Am J Physiol Heart Circ Physiol, October 1, 2007; 293(4): H2024 - H2038. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Meng, B. Xiao, S. Cai, X. Huang, F. Li, J. Bolstad, R. Trujillo, J. Airey, S. R. W. Chen, T. Wagenknecht, et al. Three-Dimensional Localization of Serine 2808, a Phosphorylation Site in Cardiac Ryanodine Receptor J. Biol. Chem., August 31, 2007; 282(35): 25929 - 25939. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. A. Stephenson and C. I. Berul Electrophysiological Interventions for Inherited Arrhythmia Syndromes Circulation, August 28, 2007; 116(9): 1062 - 1080. [Full Text] [PDF]
|
|
|
|
|
|
N. H. Robin, P. B. Tabereaux, R. Benza, and B. R. Korf Genetic Testing in Cardiovascular Disease J. Am. Coll. Cardiol., August 21, 2007; 50(8): 727 - 737. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Morita, D. P. Zipes, S. T. Morita, and J. Wu Mechanism of U wave and polymorphic ventricular tachycardia in a canine tissue model of Andersen-Tawil syndrome Cardiovasc Res, August 1, 2007; 75(3): 510 - 518. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. P. Dirksen, V. A. Lacombe, M. Chi, A. Kalyanasundaram, S. Viatchenko-Karpinski, D. Terentyev, Z. Zhou, S. Vedamoorthyrao, N. Li, N. Chiamvimonvat, et al. A mutation in calsequestrin, CASQ2D307H, impairs Sarcoplasmic Reticulum Ca2+ handling and causes complex ventricular arrhythmias in mice Cardiovasc Res, July 1, 2007; 75(1): 69 - 78. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Paavola, M. Viitasalo, P. J. Laitinen-Forsblom, M. Pasternack, H. Swan, I. Tikkanen, L. Toivonen, K. Kontula, and M. Laine Mutant ryanodine receptors in catecholaminergic polymorphic ventricular tachycardia generate delayed afterdepolarizations due to increased propensity to Ca2+ waves Eur. Heart J., May 1, 2007; 28(9): 1135 - 1142. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E R Behr, A Casey, M Sheppard, M Wright, T J Bowker, M J Davies, W J McKenna, and D A Wood Sudden arrhythmic death syndrome: a national survey of sudden unexplained cardiac death Heart, May 1, 2007; 93(5): 601 - 605. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. P. Katra, T. Oya, G. S. Hoeker, and K. R. Laurita Ryanodine receptor dysfunction and triggered activity in the heart Am J Physiol Heart Circ Physiol, May 1, 2007; 292(5): H2144 - H2151. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. A. Werdich, F. Baudenbacher, I. Dzhura, L. H. Jeyakumar, P. J. Kannankeril, S. Fleischer, A. LeGrone, D. Milatovic, M. Aschner, A. W. Strauss, et al. Polymorphic ventricular tachycardia and abnormal Ca2+ handling in very-long-chain acyl-CoA dehydrogenase null mice Am J Physiol Heart Circ Physiol, May 1, 2007; 292(5): H2202 - H2211. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. E. D. J. ter Keurs and P. A. Boyden Calcium and Arrhythmogenesis Physiol Rev, April 1, 2007; 87(2): 457 - 506. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Iyer, R. J. Hajjar, and A. A. Armoundas Mechanisms of Abnormal Calcium Homeostasis in Mutations Responsible for Catecholaminergic Polymorphic Ventricular Tachycardia Circ. Res., February 2, 2007; 100(2): e22 - e31. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. A. Venetucci, A. W. Trafford, and D. A. Eisner Increasing Ryanodine Receptor Open Probability Alone Does Not Produce Arrhythmogenic Calcium Waves: Threshold Sarcoplasmic Reticulum Calcium Content Is Required Circ. Res., January 5, 2007; 100(1): 105 - 111. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Schulze-Bahr Arrhythmia Predisposition: Between Rare Disease Paradigms and Common Ion Channel Gene Variants J. Am. Coll. Cardiol., October 27, 2006; 48(9_Suppl_A): A67 - A78. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. P. Zaloga, K. A. Harvey, W. Stillwell, and R. Siddiqui Trans Fatty Acids and Coronary Heart Disease Nutr Clin Pract, October 1, 2006; 21(5): 505 - 512. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Yang, N. E. Bowles, S. E. Scherer, M. D. Taylor, D. L. Kearney, S. Ge, V. V. Nadvoretskiy, G. DeFreitas, B. Carabello, L. I. Brandon, et al. Desmosomal Dysfunction due to Mutations in Desmoplakin Causes Arrhythmogenic Right Ventricular Dysplasia/Cardiomyopathy Circ. Res., September 15, 2006; 99(6): 646 - 655. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Developed in Collaboration With the European Heart, D. P. Zipes, A. J. Camm, M. Borggrefe, A. E. Buxton, B. Chaitman, M. Fromer, G. Gregoratos, G. Klein, A. J. Moss, et al. ACC/AHA/ESC 2006 Guidelines for Management of Patients With Ventricular Arrhythmias and the Prevention of Sudden Cardiac Death: A Report of the American College of Cardiology/American Heart Association Task Force and the European Society of Cardiology Committee for Practice Guidelines (Writing Committee to Develop Guidelines for Management of Patients With Ventricular Arrhythmias and the Prevention of Sudden Cardiac Death) J. Am. Coll. Cardiol., September 5, 2006; 48(5): e247 - e346. [Full Text] [PDF]
|
|
|
|
|
|
M. R. di Barletta, S. Viatchenko-Karpinski, A. Nori, M. Memmi, D. Terentyev, F. Turcato, G. Valle, N. Rizzi, C. Napolitano, S. Gyorke, et al. Clinical Phenotype and Functional Characterization of CASQ2 Mutations Associated With Catecholaminergic Polymorphic Ventricular Tachycardia Circulation, September 5, 2006; 114(10): 1012 - 1019. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Writing Committee Members, D. P. Zipes, A. J. Camm, M. Borggrefe, A. E. Buxton, B. Chaitman, M. Fromer, G. Gregoratos, G. Klein, A. J. Moss, et al. ACC/AHA/ESC 2006 guidelines for management of patients with ventricular arrhythmias and the prevention of sudden cardiac death: A report of the American College of Cardiology/American Heart Association Task Force and the European Society of Cardiology Committee for Practice Guidelines (Writing Committee to Develop Guidelines for Management of Patients With Ventricular Arrhythmias and the Prevention of Sudden Cardiac Death) Developed in collaboration with the European Heart Rhythm Association and the Heart Rhythm Society Europace, September 1, 2006; 8(9): 746 - 837. [Full Text] [PDF]
|
|
|
|
|
|
J. Kockskamper and B. Pieske Phosphorylation of the Cardiac Ryanodine Receptor by Ca2+/Calmodulin-Dependent Protein Kinase II: The Dominating Twin of Protein Kinase A? Circ. Res., August 18, 2006; 99(4): 333 - 335. [Full Text] [PDF]
|
|
|
|
|
|
P. J. Kannankeril, B. M. Mitchell, S. A. Goonasekera, M. G. Chelu, W. Zhang, S. Sood, D. L. Kearney, C. I. Danila, M. De Biasi, X. H. T. Wehrens, et al. Mice with the R176Q cardiac ryanodine receptor mutation exhibit catecholamine-induced ventricular tachycardia and cardiomyopathy PNAS, August 8, 2006; 103(32): 12179 - 12184. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D.A. Eisner, L.A. Venetucci, and A.W. Trafford Life, Sudden Death, and Intracellular Calcium Circ. Res., August 4, 2006; 99(3): 223 - 224. [Full Text] [PDF]
|
|
|
|
|
|
N. Liu, B. Colombi, M. Memmi, S. Zissimopoulos, N. Rizzi, S. Negri, M. Imbriani, C. Napolitano, F. A. Lai, and S. G. Priori Arrhythmogenesis in Catecholaminergic Polymorphic Ventricular Tachycardia: Insights From a RyR2 R4496C Knock-In Mouse Model Circ. Res., August 4, 2006; 99(3): 292 - 298. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Milting, N. Lukas, B. Klauke, R. Korfer, A. Perrot, K.-J. Osterziel, J. Vogt, S. Peters, R. Thieleczek, and M. Varsanyi Composite polymorphisms in the ryanodine receptor 2 gene associated with arrhythmogenic right ventricular cardiomyopathy Cardiovasc Res, August 1, 2006; 71(3): 496 - 505. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Yang, N. Ikemoto, G. D. Lamb, and D. S. Steele The RyR2 central domain peptide DPc10 lowers the threshold for spontaneous Ca2+ release in permeabilized cardiomyocytes Cardiovasc Res, June 1, 2006; 70(3): 475 - 485. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. E. Lehnart, C. Terrenoire, S. Reiken, X. H. T. Wehrens, L.-S. Song, E. J. Tillman, S. Mancarella, J. Coromilas, W. J. Lederer, R. S. Kass, et al. Stabilization of cardiac ryanodine receptor prevents intracellular calcium leak and arrhythmias PNAS, May 16, 2006; 103(20): 7906 - 7910. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Terentyev, A. Nori, M. Santoro, S. Viatchenko-Karpinski, Z. Kubalova, I. Gyorke, R. Terentyeva, S. Vedamoorthyrao, N. A. Blom, G. Valle, et al. Abnormal Interactions of Calsequestrin With the Ryanodine Receptor Calcium Release Channel Complex Linked to Exercise-Induced Sudden Cardiac Death Circ. Res., May 12, 2006; 98(9): 1151 - 1158. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L Eckardt, G Breithardt, and P Kirchhof Approach to wide complex tachycardias in patients without structural heart disease. Heart, May 1, 2006; 92(5): 704 - 711. [Full Text] [PDF]
|
|
|
|
|
|
D. J. Tester, M. L. Will, C. M. Haglund, and M. J. Ackerman Effect of Clinical Phenotype on Yield of Long QT Syndrome Genetic Testing J. Am. Coll. Cardiol., February 21, 2006; 47(4): 764 - 768. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Creighton, R. Virmani, R. Kutys, and A. Burke Identification of Novel Missense Mutations of Cardiac Ryanodine Receptor Gene in Exercise-Induced Sudden Death at Autopsy J. Mol. Diagn., February 1, 2006; 8(1): 62 - 67. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Roberts Genomics and Cardiac Arrhythmias J. Am. Coll. Cardiol., January 3, 2006; 47(1): 9 - 21. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. D. Langenbacher, Y. Dong, X. Shu, J. Choi, D. A. Nicoll, J. I. Goldhaber, K. D. Philipson, and J.-N. Chen Mutation in sodium-calcium exchanger 1 (NCX1) causes cardiac fibrillation in zebrafish PNAS, December 6, 2005; 102(49): 17699 - 17704. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Yano, S. Okuda, T. Oda, T. Tokuhisa, H. Tateishi, M. Mochizuki, T. Noma, M. Doi, S. Kobayashi, T. Yamamoto, et al. Correction of Defective Interdomain Interaction Within Ryanodine Receptor by Antioxidant Is a New Therapeutic Strategy Against Heart Failure Circulation, December 6, 2005; 112(23): 3633 - 3643. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. G. Priori and C. Napolitano Intracellular Calcium Handling Dysfunction and Arrhythmogenesis: A New Challenge for the Electrophysiologist Circ. Res., November 25, 2005; 97(11): 1077 - 1079. [Full Text] [PDF]
|
|
|
|
|
|
Z. Liu, R. Wang, J. Zhang, S. R. W. Chen, and T. Wagenknecht Localization of a Disease-associated Mutation Site in the Three-dimensional Structure of the Cardiac Muscle Ryanodine Receptor J. Biol. Chem., November 11, 2005; 280(45): 37941 - 37947. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A V Postma, I Denjoy, J Kamblock, M Alders, J-M Lupoglazoff, G Vaksmann, L Dubosq-Bidot, P Sebillon, M M A M Mannens, P Guicheney, et al. Catecholaminergic polymorphic ventricular tachycardia: RYR2 mutations, bradycardia, and follow up of the patients J. Med. Genet., November 1, 2005; 42(11): 863 - 870. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Shah, F. G. Akar, and G. F. Tomaselli Molecular Basis of Arrhythmias Circulation, October 18, 2005; 112(16): 2517 - 2529. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N.A. M. Estes III Sudden Cardiac Arrest From Primary Electrical Diseases: Provoking Concealed Arrhythmogenic Syndromes Circulation, October 11, 2005; 112(15): 2220 - 2221. [Full Text] [PDF]
|
|
|
|
|
|
A. D. Krahn, M. Gollob, R. Yee, L. J. Gula, A. C. Skanes, B. D. Walker, and G. J. Klein Diagnosis of Unexplained Cardiac Arrest: Role of Adrenaline and Procainamide Infusion Circulation, October 11, 2005; 112(15): 2228 - 2234. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Balasubramaniam, S. Chawla, A. A. Grace, and C. L.-H. Huang Caffeine-induced arrhythmias in murine hearts parallel changes in cellular Ca2+ homeostasis Am J Physiol Heart Circ Physiol, October 1, 2005; 289(4): H1584 - H1593. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Shimizu The long QT syndrome: Therapeutic implications of a genetic diagnosis Cardiovasc Res, August 15, 2005; 67(3): 347 - 356. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Kontula, P. J. Laitinen, A. Lehtonen, L. Toivonen, M. Viitasalo, and H. Swan Catecholaminergic polymorphic ventricular tachycardia: Recent mechanistic insights Cardiovasc Res, August 15, 2005; 67(3): 379 - 387. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Kaab and E. Schulze-Bahr Susceptibility genes and modifiers for cardiac arrhythmias Cardiovasc Res, August 15, 2005; 67(3): 397 - 413. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. J. Milan and C. A. MacRae Animal models for arrhythmias Cardiovasc Res, August 15, 2005; 67(3): 426 - 437. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Burke, W. Creighton, E. Mont, L. Li, S. Hogan, R. Kutys, D. Fowler, and R. Virmani Role of SCN5A Y1102 Polymorphism in Sudden Cardiac Death in Blacks Circulation, August 9, 2005; 112(6): 798 - 802. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. E. Lehnart, X. H.T. Wehrens, and A. R. Marks Defective Ryanodine Receptor Interdomain Interactions May Contribute to Intracellular Ca2+ Leak: A Novel Therapeutic Target in Heart Failure Circulation, June 28, 2005; 111(25): 3342 - 3346. [Full Text] [PDF]
|
|
|
|
|
|
T. Oda, M. Yano, T. Yamamoto, T. Tokuhisa, S. Okuda, M. Doi, T. Ohkusa, Y. Ikeda, S. Kobayashi, N. Ikemoto, et al. Defective Regulation of Interdomain Interactions Within the Ryanodine Receptor Plays a Key Role in the Pathogenesis of Heart Failure Circulation, June 28, 2005; 111(25): 3400 - 3410. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G.-B. Nam, A. Burashnikov, and C. Antzelevitch Cellular Mechanisms Underlying the Development of Catecholaminergic Ventricular Tachycardia Circulation, May 31, 2005; 111(21): 2727 - 2733. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. R. Houser Can Novel Therapies for Arrhythmias Caused by Spontaneous Sarcoplasmic Reticulum Ca2+ Release be Developed Using Mouse Models? Circ. Res., May 27, 2005; 96(10): 1031 - 1032. [Full Text] [PDF]
|
|
|
|
|
|
M. Cerrone, B. Colombi, M. Santoro, M. R. di Barletta, M. Scelsi, L. Villani, C. Napolitano, and S. G Priori Bidirectional Ventricular Tachycardia and Fibrillation Elicited in a Knock-In Mouse Model Carrier of a Mutation in the Cardiac Ryanodine Receptor Circ. Res., May 27, 2005; 96(10): e77 - e82. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. J. Tester, L. J. Kopplin, W. Creighton, A. P. Burke, and M. J. Ackerman Pathogenesis of Unexplained Drowning: New Insights From a Molecular Autopsy Mayo Clin. Proc., May 1, 2005; 80(5): 596 - 600. [Abstract] [PDF]
|
|
|
|
|
|
T. T. Beery The Genetics of Cardiac Arrhythmias Biol Res Nurs, April 1, 2005; 6(4): 249 - 261. [Abstract] [PDF]
|
|
|
|
|
|
D. Terentyev, S. E. Cala, T. D. Houle, S. Viatchenko-Karpinski, I. Gyorke, R. Terentyeva, S. C. Williams, and S. Gyorke Triadin Overexpression Stimulates Excitation-Contraction Coupling and Increases Predisposition to Cellular Arrhythmia in Cardiac Myocytes Circ. Res., April 1, 2005; 96(6): 651 - 658. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||