(Circulation. 2001;103:351.)
© 2001 American Heart Association, Inc.
Clinical Investigation and Reports |
From the Institute of Medical Microbiology and Hygiene (J.G., H.F., W.S., M.M.), the Department of Internal Medicine II (J.J., K.D., H.A.K.), and the Institute of Anatomy (M.K.), Medical University of Lübeck, Lübeck, Germany.
Correspondence to Matthias Maass, MD, Institute of Medical Microbiology and Hygiene, Medical University of Lübeck, Ratzeburger Allee 160, D-23538 Lübeck, Germany. E-mail maass{at}hygiene.mu-luebeck.de
| Abstract |
|---|
|
|
|---|
Methods and ResultsBlood monocytes (CD14+) from 2 healthy volunteers were obtained before and after oral treatment with azithromycin or rifampin and then inoculated with a vascular C pneumoniae strain and continuously cultured in the presence of the respective antibiotic. Progress of infection and chlamydial viability was assessed by immunogold-labeling and detection of C pneumoniaespecific mRNA transcripts. Circulating monocytes from patients undergoing treatment with experimental azithromycin for coronary artery disease were examined for C pneumoniae infection by cell culture. Antibiotics did not inhibit chlamydial growth within monocytes. Electron microscopy showed development of chlamydial inclusion bodies. Reverse transcriptionpolymerase chain reaction demonstrated continuous synthesis of chlamydial mRNA for 10 days without lysis of the monocytes. The in vivo presence of viable pathogen not eliminated by azithromycin was shown by cultural recovery of C pneumoniae from the circulating monocytes of 2 patients with coronary artery disease.
ConclusionsC pneumoniae uses monocytes as a transport system for systemic dissemination and enters a persistent state not covered by an otherwise effective antichlamydial treatment. Prevention of vascular infection by antichlamydial treatment may be problematic: circulating monocytes carrying a pathogen with reduced antimicrobial susceptibility might initiate reinfection or promote atherosclerosis by the release of proinflammatory mediators.
Key Words: Chlamydia pneumoniae atherosclerosis infection azithromycin rifampin
| Introduction |
|---|
|
|
|---|
Systemic dissemination of C pneumoniae from the respiratory tract to the cells of the vascular wall requires a cellular transport system, because chlamydiae replicate exclusively within their host cells. The elementary body, the metabolically inactive extracellular life stage of chlamydiae, has never been found circulating free within the bloodstream. Circulating monocytes, which are pivotal to the development of atherosclerosis, are known to migrate into the vascular wall. Recent studies have described the in vitro infection of monocyte-derived macrophages with C pneumoniae9 and the presence of chlamydial DNA within peripheral blood mononuclear cells from patients with CAD.10 11 Furthermore, C pneumoniae resists digestion in monocytes for 3 days, at least under in vitro cell culture conditions.12 Thus, monocytes are a potential carrier system for C pneumoniae.
We were concerned that a persistent chlamydial infection with reduced antibiotic susceptibility might exist in monocytes in vivo and that it might interfere with the basic concept of antimicrobial treatment in coronary heart disease. If monocyte infection is not eliminated by therapeutic intervention, continuous transmission to vascular cells after a decline of the antibiotic tissue levels might affect long-term benefits. Therefore, we studied chlamydial growth and activity within monocytes in the presence of rifampin, the most effective antichlamydial drug in vitro,13 and azithromycin, a macrolide widely used in current treatment trials.5 To detect the pathogen, we used immunoelectron microscopy and Chlamydia-specific mRNA transcripts, which are markers of bacterial viability due to their short half-life. In addition, we attempted to culture C pneumoniae from monocytes of patients with unstable angina pectoris who were enrolled in a current trial on the benefit of azithromycin in CAD.
| Methods |
|---|
|
|
|---|
Antibiotics were added simultaneously with the chlamydiae. Two hours after inoculation, monocytes were washed once with PBS to remove nonphagocytized elementary bodies, and fresh medium with the respective antibiotic was added. For immunoelectron microscopy, cells were grown on Thermanox coverslips (Nalgene Nunc International) and collected at day 3. For reverse transcriptionpolymerase chain reaction (RT-PCR) detection of chlamydial mRNA synthesis, 104 cells were collected after 2 hours and 1, 3, and 10 days. Experiments were made in duplicate. The culture assay was repeated after oral treatment of the monocyte donors with azithromycin (Zithromax, Pfizer GmbH; 500 mg/d for 3 days) or rifampin (Rifa, Grünenthal GmbH; 600 mg/d for 6 days).
Serum drug concentrations were determined 2 hours after the last application by high-performance liquid chromatography (azithromycin, 0.2 µg/mL; rifampin, 18.7 µg/mL). Monocytes were collected 2 hours after the last dose, inoculated with CV-3, and cultivated for up to 10 days in the presence of azithromycin (10 µg/mL) or rifampin (10 µg/mL), as described above. Monocytes collected before the first application of the antibiotic and infected with CV-3 in the absence of any antibiotics served as positive controls; uninfected monocytes served as negative controls. After 2 hours and 1, 3, and 10 days, viability of monocytes in culture was proven by Trypan blue staining. Successful inoculation was controlled by immunofluorescence staining with an antiC pneumoniae antibody (Dako); 104 cells were collected for RT-PCR detection of chlamydial mRNA synthesis. Experiments were made in duplicate. In a control experiment, immortalized laryngeal epithelial cells (HEp-2, ATCC CLL 23) were infected with C pneumoniae with and without addition of azithromycin (10 µg/mL) or rifampin (10 µg/mL), as described previously.13 RT-PCR for chlamydial mRNA detection was performed 24 hours and 72 hours after infection.
Immunoelectron Microscopy
Cells grown on Thermanox slides were fixed with 2%
paraformaldehyde and 0.1% glutaraldehyde in PBS (pH 7.4) for 1 hour at
4°C and contrasted with 2% uranyl acetate in cacodylate buffer.
After dehydration in a graded acetone series, cells were embedded in LR
White (London Resin Co). Ultrathin sections were mounted on 300 mesh
nickel grids and were blocked for 30 minutes with 0.5% bovine serum
albumin (Sigma) in Tris-buffered saline (TBS). The sections were
incubated for 16 hours with chlamydia genusspecific mouse anti-HSP60
IgG (Affinity BioReagents) diluted 1:250 with TBS. After rinsing with
TBS, sections were incubated for 2 hours with donkey anti-mouse IgG
coupled to 12-nm gold particles (Jackson ImmunoResearch) diluted 1:100
with TBS. Sections were contrasted with uranyl acetate and lead citrate
and were examined for immunogold-stained chlamydial structures with a
Philips EM 400 electron microscope. In control incubations, normal
mouse serum was substituted for the primary
antibody.
Chlamydial mRNA Synthesis in the Presence
of Antibiotics
C
pneumoniaespecific mRNA was extracted by standard methods
using TRIZOL Reagent (Gibco/BRL). RT of RNA and cDNA amplification was
performed using the Access RT-PCR System (Promega) according to the
manufacturers instructions. cDNA synthesis was performed at 48°C
for 50 minutes. After 2 minutes of initial denaturation at 95°C, the
samples were subjected to 40 cycles of denaturation (95°C, 40
s), annealing (55°C, 90 s), and extension (70°C, 120 s),
followed by a final extension at 70°C for 10 minutes. Targets were
the genes of the major outer membrane protein (MOMP) and the 60-kDa
heat shock protein (HSP60). Primers for MOMP mRNA were Cpn 201
(5'TGGTCTCGAGCAACTTTTGATG3') and Cpn 202 (5'AGCTCCTACAGTAACTCCACA3'),
as originally described by Gaydos et
al.14 Primers for the HSP60
mRNA were GE-1 (5'AGCTCACGTAGTTATAGATAAGAG3') and GE-2
(5'AAGTAGCTGGAGAGGTATCCACGG3'), as described by Airenne et
al.12
As a control for the absence of DNA in the RNA preparation, each sample was additionally amplified without prior RT. PCR products were separated on a 2% agarose gel and transferred on a nitrocellulose membrane by vacuum blotting. For improved sensitivity and specificity, nonradioactive DNA hybridization was performed using probes 3'-tailed with digoxigenin-11 dUTP/dATP (Roche Diagnostics), according to the manufacturers instructions. Probes were designed according to the sequence of the amplicons and checked for genus-specificity in a BLAST 2.0 search (5'GCAATCTATAGCGAAGGTCT3' for HSP60 amplicons; 5'TAACATCCGCATTGCTCAGC3' for MOMP amplicons).
C
pneumoniae Culture From Monocytes of CAD Patients Under
Azithromycin Treatment
Two male patients (68 and 57 years) admitted to our
emergency room because of acute chest pain were diagnosed as having
unstable angina pectoris on the basis of coronary angiography,
electrocardiography, clinical presentation, and laboratory parameters.
The first patient was admitted with a myocardial infarction of the
inferior wall. Coronary angiography showed 2-vessel disease (right
coronary artery and left circumflex artery). The occluded right
coronary artery was reopened by PTCA. The patients risk factors were
diabetes mellitus, arterial hypertension, and smoking. The second
patient was admitted for a myocardial infarction of the anterior wall.
Two-vessel disease (left anterior descending artery and left circumflex
artery) was documented by coronary angiography, and the occluded left
anterior descending artery was reopened by PTCA. Risk factors in this
patient were arterial hypertension and obesity.
After informed consent was given, both patients were enrolled in an ongoing clinical trial on the benefit of azithromycin in CAD and received oral courses of 500 mg/d azithromycin on days 1 to 3 and on days 14 to 16 after coronary angiography. These patients yielded a positive result for C pneumoniae DNA in their peripheral blood mononuclear cells, which were collected at day 1, as determined in a previously described nested PCR technique.15 Thus, CD14-positive cells from 8 mL of blood were isolated on day 28, as described above, and subjected to C pneumoniae culture. Separated CD14-positive cells were disrupted with glass beads on a vortex and centrifuged onto HEp-2-cell monolayers in 6-well tissue culture plates and cultured in serial subcultures, as described previously for vascular materials.1 Productive infection was detected by immunofluorescence using a C pneumoniae monoclonal antibody (Syva, Dako).
| Results |
|---|
|
|
|---|
|
mRNA Synthesis in the Presence of Antibiotics
and After Prior Systemic Antibiotic Treatment
Chlamydiae within monocytes were metabolically active
and did not cause host cell lysis; thus, they were proven to persist.
Infected CD14-positive cells were viable until the end of the
experiment (10 days), as shown by Trypan blue and immunofluorescence
staining. RT-PCR demonstrated chlamydial HSP60 and MOMP mRNA synthesis,
which indicated the viability of the pathogen in the presence of
azithromycin or rifampin at 2 hours and 1, 3, and 10 days after
infection. Similarly, mRNA transcripts of HSP60 and MOMP were
continuously expressed from 2 hours to 10 days, despite of prior
systemic treatment of the monocyte donors with conventional courses of
the respective antibiotics and their permanent presence in the culture
medium
(Figure 2
). In a control experiment, synthesis of HSP60 and
MOMP mRNA ceased completely in infected HEp-2 cells treated with
azithromycin or rifampin within 72 hours, thus demonstrating the in
vitro efficiency of the antibiotics in epithelial cells in the same
setting
(Figure 3
).
|
|
Cultural Recovery of
C pneumoniae Under Azithromycin
Treatment
Viable C
pneumoniae was isolated and continuously cultured from
CD14-positive cells of both CAD patients who had undergone azithromycin
treatment. Prior treatment with azithromycin did not eradicate
C pneumoniae from circulating
monocytes. The minimal inhibitory concentration of azithromycin, as
determined in a standard system in laryngeal HEp-2
cells,13 was 0.08 µg/mL
for both strains. There was no evidence that the patients suffered from
a systemic inflammatory response syndrome, according to current
consensus
criteria.16
| Discussion |
|---|
|
|
|---|
In this study, we defined systemically circulating CD14-positive cells as hosts for C pneumoniae. This fills the current gap between the respiratory epithelium, the primary target of this pathogen, and the vascular wall, where the chlamydiae were detected by various techniques,1 17 18 19 although their origin remained unexplained. The recovery of C pneumoniae from monocytes now illustrates one method whereby the obligate intracellular organism may gain access to the vascular system. Other studies suggested that monocytes could be a potential vector system for chlamydial distribution on basis of DNA detection within peripheral blood mononuclear cells10 11 or CD14-positive cells,15 but these studies lacked evidence of viability. In the lung, C pneumoniae enters epithelial cells and alveolar macrophages,20 but the exact site of transmission of chlamydiae to blood monocytes remains to be defined. In vitro data indicate that monocytes may transmit C pneumoniae to vascular endothelial cells,21 but in vivo data are lacking. For initiation or promotion of atherogenesis, however, infection of the vascular wall does not seem mandatory because a release of proinflammatory mediators by circulating or transendothelially migrating infected monocytes might be sufficient.22
In acute infection, host cells disintegrate and release newly produced elementary bodies within 3 days. In monocytes, however, a persistent infection was established for the observation period of 10 days. This persistent state seems to be typical of chlamydiae ingested by human monocytes under in vitro culture conditions and is not induced by antibiotics, because it occurs without any antibiotic supplementation. In a previous study, C trachomatis serovar Kspecific mRNA was detected in monocytes for 10 days.23 Airenne et al12 showed that C pneumoniae was transcriptionally active for 3 days in vitro and did not develop infectious progeny in human monocytes. However, because we were able to culture the organism from monocytes from CAD patients, the data suggest that the ability to replicate is not lost within the monocytes. Interestingly, an establishment of the persistent infection could not be prevented by antichlamydial treatment. Although monocytes were subjected in vitro and in vivo to adequate amounts of antibiotic substance, they still promoted persistent infection with a vascular C pneumoniae strain. When tested under standard susceptibility testing conditions, the very same strain was highly sensitive to rifampin and azithromycin. This may explain the treatment failures seen in respiratory infections with strains that seemed susceptible in vitro.24 Current chlamydial susceptibility testing is focused on acute infection in epithelial cells and apparently does not apply to persistent infection.
The present study suggests that chlamydiae can survive an antichlamydial therapy within monocytes in vitro and in vivo. Optimal regimens for chlamydial eradication from monocytes are not known, but cultural recovery of the pathogen from circulating monocytes after 2 conventional courses of azithromycin treatment clearly indicates that a standard approach, as used in acute lung infection, may not be successful. Thus, endogenous reinfection of vascular cells after a decline of the antibiotic tissue levels cannot be excluded. In fact, this may seriously affect the current efforts made in large prospective trials to alleviate clinical CAD symptoms by antichlamydial treatment. This notion is supported by recent data from ongoing treatment trials. In the largest study on antimicrobial treatment in CAD patients published to date, azithromycin treatment had no significant effects on clinical events after 6 months and 2 years.25 A statistically significant benefit among roxithromycin-treated CAD patients seen after 30 days in the Roxithromycin Ischemic Syndromes (ROXIS) study was not reproduced after 6 months.26 Erythromycin or tetracycline treatment within the last 5 years had no effect on the risk of having a first myocardial infarction in a retrospective study.27 In contrast, another retrospective analysis of first-time myocardial infarction cases and controls reported a favorable effect of tetracycline and quinolone antibiotics but not macrolides.28 In a rabbit model on the acceleration of atherogenesis by chlamydial infection, azithromycin treatment had a documented protective effect. However, C pneumoniae antigen was still detected in the vessel walls after a 7-week azithromycin course, indicating persistence.29
It is important to note that antibiotics can inhibit chlamydial growth in the atherogenetically relevant endothelial and smooth muscle cells.6 Thus, chlamydial eradication from cells other than monocytes/macrophages is potentially feasible. However, there is evidence suggesting that persistence may be established in those cells, too. In a recently described in vitro model of continuous C pneumoniae infection, epithelial cells sustained infection for 2 years without an addition of fresh host cells or chlamydiae. Six-day courses of azithromycin or ofloxacin did not eliminate the infection.30 It is unknown if this corresponds to the in vivo situation in pulmonary or vascular tissue.
In vivo, chlamydial persistence has been observed in only
monocytes thus far, but it can be induced in endothelial and epithelial
cells in vitro by tryptophan depletion, interferon-
, or tumor
necrosis
factor-
.8 31
When a corresponding mechanism was studied for monocytes, growth
inhibition could not be neutralized by tryptophan or interferon-
antibodies.12 23
Apparently, the persistent state can be entered spontaneously in
monocytes/macrophages but is dependent on the cytokine network in other
cell populations. Nevertheless, the absence of essential nutrients in
the vacuole of the intracellular parasite may be the cause of growth
arrest. Persistence seems to be the result of a stress response, as
indicated by the prominent production of HSP60. We speculate that the
altered metabolic condition in this state is also the cause of the
ineffectiveness of the antimicrobial agents described in this study and
that this state is based on differentially displayed chlamydial genes
for cell differentiation, cytokinesis, and stress response. Therefore,
we suggest the use of infected monocytes as a model system for further
examination of the genetic background of chlamydial persistence and for
the definition of targets for the eradication of persisting
chlamydiae.
An infectious component in the chronic inflammatory condition of atherosclerosis may provide additional explanations for unclear phenomena of atherogenesis, such as mesenchymal cell proliferation and its distinct inflammatory component. The obvious appeal of treating a bacterial pathogen in this setting, the leading cause of death in the industrialized nations, has initiated a variety of prospective antimicrobial intervention studies with >10 000 patients enrolled.5 However, evidence is increasing that eradication may face enormous problems due to the chlamydial ability to enter a refractory state of persistent infection that seems unique to chlamydiae.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received October 24, 2000; revision received December 12, 2000; accepted December 14, 2000.
| References |
|---|
|
|
|---|
2.
Ramirez JA,
Chlamydia
pneumoniae/Atherosclerosis Study Group. Isolation of
Chlamydia pneumoniae from the
coronary artery of a patient with coronary arteriosclerosis.
Ann Intern Med. 1996;125:979982.
3. Libby P. Atheroma: more than mush. Lancet. 1996;348(suppl 1):47.
4.
Ross R.
Atherosclerosis: an inflammatory disease.
N Engl J Med. 1999;340:115126.
5.
Grayston JT.
Antibiotic treatment trials for secondary prevention of coronary artery
disease events. Circulation. 1999;99:15381539.
6. Gieffers J, Solbach W, Maass M. Activity of antibiotics in eliminating Chlamydia pneumoniae cardiovascular strains from cell types involved in the pathogenesis of arteriosclerosis. Clin Microbiol Infect. 1999;5(suppl 3):381. Abstract.
7. Ward ME. The immunobiology and immunopathology of chlamydial infections. APMIS. 1995;103:769796.[Medline] [Order article via Infotrieve]
8.
Beatty WL, Byrne
GI, Morrison RP. Morphologic and antigenetic characterization of
interferon gamma-mediated persistent
Chlamydia trachomatis infection
in vitro. Proc Nat Acad Sci
U S A. 1993;90:39984002.
9. Gaydos CA, Summersgill JT, Sahney NN, et al. Replication of Chlamydia pneumoniae in vitro in human macrophages, endothelial cells, and aortic artery smooth muscle cells. Infect Immun. 1996;64:16141620.[Abstract]
10. Boman J, Sonderberg S, Forsberg J, et al. High prevalence of Chlamydia pneumoniae DNA in peripheral blood mononuclear cells in patients with cardiovascular disease and in middle-aged blood donors. J Infect Dis. 1998;178:274277.[Medline] [Order article via Infotrieve]
11.
Wong YK, Dawkins
KD, Ward ME. Circulating Chlamydia
pneumoniae DNA as a predictor of coronary artery disease.
J Am Coll Cardiol. 1999;34:14351439.
12.
Airenne S, Surcel
HM, Alakärppä H, et al. Chlamydia
pneumoniae infection in human monocytes.
Infect Immun. 1999;67:14451449.
13.
Gieffers J,
Solbach W, Maass M. In vitro susceptibilities of
Chlamydia pneumoniae strains
recovered from atherosclerotic coronary arteries.
Antimicrob Agents Chemother. 1998;42:27622764.
14.
Gaydos CA, Quinn
CT, Bobo LD, et al. Similarity of
Chlamydia pneumoniae strains in
the variable domain IV region of the major outer membrane protein gene.
Infect Immun. 1992;60:53195323.
15. Maass M, Jahn J, Gieffers J, et al. Detection of Chlamydia pneumoniae within peripheral blood monocytes of patients with unstable angina or myocardial infarction. J Infect Dis. 2000;181(suppl 3):449451.
16.
The ACCP/SCCM
Consensus Conference Committee. American College of Chest
Physicians/Society of Crit Care
Med: definitions for sepsis and organ failure and guidelines
for the use of innovative therapies in sepsis.
Chest. 1992;101:16441655.
17. Muhlestein JB, Hammond EH, Carlquist JF, et al. Increased incidence of Chlamydia species within the coronary arteries of patients with symptomatic atherosclerotic versus other forms of cardiovascular diseases. J Am Coll Cardiol. 1996;27:15551561.[Abstract]
18. Kuo CC, Shor A, Campbell LA, et al. Demonstration of Chlamydia pneumoniae in atherosclerotic lesions of coronary arteries. J Infect Dis. 1993;167:841849.[Medline] [Order article via Infotrieve]
19. Shor A, Phillips JI, Ong G, et al. Chlamydia pneumoniae in atheroma: consideration of criteria for causality. J Clin Pathol. 1998;51:812817.[Abstract]
20.
Redecke V,
Dalhoff K, Bohnet S, et al. Interaction of
Chlamydia pneumoniae and human
alveolar macrophages: infection and inflammatory response.
Am J Respir Cell Mol Biol. 1998;19:721727.
21. Quinn TC, Gaydos CA. In vitro infection and pathogenesis of Chlamydia pneumoniae in endovascular cells. Am Heart J. 1999;138(suppl):507511.
22. Kol A, Libby P. Molecular mediators of arterial inflammation: a role for microbial products? Am Heart J. 1999;138(suppl):450452.
23. Koehler L, Nettelnbreker E, Hudson AP, et al. Ultrastructural and molecular analysis of the persistence of Chlamydia trachomatis (serovar K) in human monocytes. Microb Pathog. 1997;22:133142.[Medline] [Order article via Infotrieve]
24. Hammerschlag MR, Chirgwin K, Roblin PM, et al. Persistent infection with Chlamydia pneumoniae following acute respiratory illness. Clin Infect Dis. 1992;14:178182.[Medline] [Order article via Infotrieve]
25.
Muhlestein JB,
Anderson JL, Carlquist J, et al. Randomized secondary prevention trial
of azithromycin in patients with coronary artery disease: primary
clinical results of the ACADEMIC study.
Circulation. 2000;102:17551760.
26.
Gurfinkel E,
Bozovich G, Beck E, et al. Treatment with the antibiotic roxithromycin
in patients with acute non-Q-wave coronary syndromes.
Eur Heart J. 1999;20:121127.
27. Jackson LA, Smith NL, Heckbert SR, et al. Lack of association between first myocardial infarction and past use of erythromycin, tetracycline, or doxycycline. Emerg Infect Dis. 1999;5:281284.[Medline] [Order article via Infotrieve]
28.
Meier CR, Derby
LE, Jick SS, et al. Antibiotics and risk of subsequent first-time acute
myocardial infarction. JAMA. 1999;281:427431.
29.
Muhlestein J,
Jeffrey LA, Hammond EH, et al. Infection with
Chlamydia pneumoniae
accelerates the development of atherosclerosis and treatment with
azithromycin prevents it in a rabbit model.
Circulation. 1998;97:633636.
30.
Kutlin A, Roblin
PM, Hammerschlag MR. In vitro activities of azithromycin and ofloxacin
against Chlamydia pneumoniae in
a continuous-infection model. Antimicrob
Agents Chemother. 1999;43:22682272.
31.
Beatty WL,
Belanger TA, Desal AA, et al. Tryptophan depletion as a mechanism of
gamma interferon-mediated chlamydial persistence.
Infect Immun. 1994;62:37053711.
This article has been cited by other articles:
![]() |
A. Hogh, S. Vammen, L. Ostergaard, J. B. Joensen, E. W. Henneberg, and J. S. Lindholt Intermittent Roxithromycin for Preventing Progression of Small Abdominal Aortic Aneurysms: Long-Term Results of a Small Clinical Trial Vascular and Endovascular Surgery, October 1, 2009; 43(5): 452 - 456. [Abstract] [PDF] |
||||
![]() |
U. Ravnskov and K. S. McCully Vulnerable Plaque Formation from Obstruction of Vasa Vasorum by Homocysteinylated and Oxidized Lipoprotein Aggregates Complexed with Microbial Remnants and LDL Autoantibodies Ann. Clin. Lab. Sci., January 1, 2009; 39(1): 3 - 16. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Volanen, K. Kallio, M. Saarinen, M. J. Jarvisalo, R. Vainionpaa, T. Ronnemaa, J. Viikari, J. Marniemi, O. Simell, and O. T. Raitakari Arterial Intima-Media Thickness in 13-Year-Old Adolescents and Previous Antichlamydial Antimicrobial Use: A Retrospective Follow-up Study Pediatrics, September 1, 2008; 122(3): e675 - e681. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Yamaguchi, S. Kamiya, T. Uruma, T. Osaki, H. Taguchi, T. Hanawa, M. Fukuda, H. Kawakami, H. Goto, H. Friedman, et al. Chlamydia pneumoniae Growth Inhibition in Cells by the Steroid Receptor Antagonist RU486 (Mifepristone) Antimicrob. Agents Chemother., June 1, 2008; 52(6): 1991 - 1998. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bunk, I. Susnea, J. Rupp, J. T. Summersgill, M. Maass, W. Stegmann, A. Schrattenholz, A. Wendel, M. Przybylski, and C. Hermann Immunoproteomic Identification and Serological Responses to Novel Chlamydia pneumoniae Antigens That Are Associated with Persistent C. pneumoniae Infections J. Immunol., April 15, 2008; 180(8): 5490 - 5498. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Rey-Ladino, X. Jiang, B. R. Gabel, C. Shen, and R. C. Brunham Survival of Chlamydia muridarum within Dendritic Cells Infect. Immun., August 1, 2007; 75(8): 3707 - 3714. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Eickhoff, J. Thalmann, S. Hess, M. Martin, T. Laue, J. Kruppa, G. Brandes, and A. Klos Host Cell Responses to Chlamydia pneumoniae in Gamma Interferon-Induced Persistence Overlap Those of Productive Infection and Are Linked to Genes Involved in Apoptosis, Cell Cycle, and Metabolism Infect. Immun., June 1, 2007; 75(6): 2853 - 2863. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. G. Spagnoli, S. Pucci, E. Bonanno, A. Cassone, F. Sesti, A. Ciervo, and A. Mauriello Persistent Chlamydia pneumoniae Infection of Cardiomyocytes Is Correlated with Fatal Myocardial Infarction Am. J. Pathol., January 1, 2007; 170(1): 33 - 42. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Rupp, W. Solbach, and J. Gieffers Single-Nucleotide-Polymorphism-Specific PCR for Quantification and Discrimination of Chlamydia pneumoniae Genotypes by Use of a "Locked" Nucleic Acid. Appl. Envir. Microbiol., May 1, 2006; 72(5): 3785 - 3787. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Uruma, H. Yamaguchi, M. Fukuda, H. Kawakami, H. Goto, T. Kishimoto, Y. Yamamoto, A. Tomoda, and S. Kamiya Chlamydia pneumoniae growth inhibition in human monocytic THP-1 cells and human epithelial HEp-2 cells by a novel phenoxazine derivative J. Med. Microbiol., December 1, 2005; 54(12): 1143 - 1149. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Taylor-Robinson and J. Boman The failure of antibiotics to prevent heart attacks BMJ, August 13, 2005; 331(7513): 361 - 362. [Full Text] [PDF] |
||||
![]() |
K. Wolf, E. Fischer, and T. Hackstadt Degradation of Chlamydia pneumoniae by Peripheral Blood Monocytic Cells Infect. Immun., August 1, 2005; 73(8): 4560 - 4570. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Siewert, J. Rupp, M. Klinger, W. Solbach, and J. Gieffers Growth Cycle-Dependent Pharmacodynamics of Antichlamydial Drugs Antimicrob. Agents Chemother., May 1, 2005; 49(5): 1852 - 1856. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Pinchuk, B. C. Starcher, B. Livingston, A. Tvninnereim, S. Wu, E. Appella, J. Sidney, A. Sette, and B. Wizel A CD8+ T Cell Heptaepitope Minigene Vaccine Induces Protective Immunity against Chlamydia pneumoniae J. Immunol., May 1, 2005; 174(9): 5729 - 5739. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Anderson Infection, Antibiotics, and Atherothrombosis -- End of the Road or New Beginnings? N. Engl. J. Med., April 21, 2005; 352(16): 1706 - 1709. [Full Text] [PDF] |
||||
![]() |
J. Rupp, T. Hellwig-Burgel, V. Wobbe, U. Seitzer, E. Brandt, and M. Maass Chlamydia pneumoniae infection promotes a proliferative phenotype in the vasculature through Egr-1 activation in vitro and in vivo PNAS, March 1, 2005; 102(9): 3447 - 3452. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Opitz, S. Forster, A. C. Hocke, M. Maass, B. Schmeck, S. Hippenstiel, N. Suttorp, and M. Krull Nod1-Mediated Endothelial Cell Activation by Chlamydophila pneumoniae Circ. Res., February 18, 2005; 96(3): 319 - 326. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Mitusch, J. Luedemann, W. G. Wood, K. Berger, U. Schminke, M. Suter, C. Kessler, U. John, J. Rupp, M. Kentsch, et al. Asymptomatic Carotid Atherosclerosis Is Associated With Circulating Chlamydia pneumoniae DNA in Younger Normotensive Subjects in a General Population Survey Arterioscler Thromb Vasc Biol, February 1, 2005; 25(2): 386 - 391. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. de Kruif, E. C.M. van Gorp, T. T. Keller, J. M. Ossewaarde, and H. ten Cate Chlamydia pneumoniae infections in mouse models: relevance for atherosclerosis research Cardiovasc Res, February 1, 2005; 65(2): 317 - 327. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Caronzolo, V. Lucini, M. Pannacci, S. Grosso, F. Colleoni, F. Fraschini, and F. Scaglione Glucocorticoids Increase In Vitro and In Vivo Activities of Antibiotics against Chlamydophila pneumoniae Antimicrob. Agents Chemother., December 1, 2004; 48(12): 4878 - 4881. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Tormakangas, H. Alakarppa, D. B. David, M. Leinonen, and P. Saikku Telithromycin Treatment of Chronic Chlamydia pneumoniae Infection in C57BL/6J mice Antimicrob. Agents Chemother., October 1, 2004; 48(10): 3655 - 3661. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. F. Riska, A. Kutlin, P. Ajiboye, A. Cua, P. M. Roblin, and M. R. Hammerschlag Genetic and Culture-Based Approaches for Detecting Macrolide Resistance in Chlamydia pneumoniae Antimicrob. Agents Chemother., September 1, 2004; 48(9): 3586 - 3590. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Legan, O. Vraspir-Porenta, D. Kese, R. Zorc-Pleskovic, and M. Zorc Histopathologic Signs for the Inflammatory Role of Chlamydia pneumoniae in the High-Grade Atherosclerotic Coronary Artery Wall Angiology, September 1, 2004; 55(5): 525 - 531. [Abstract] [PDF] |
||||
![]() |
P. B. Wyrick and S. T. Knight Pre-exposure of infected human endometrial epithelial cells to penicillin in vitro renders Chlamydia trachomatis refractory to azithromycin J. Antimicrob. Chemother., July 1, 2004; 54(1): 79 - 85. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Gieffers, G. van Zandbergen, J. Rupp, F. Sayk, S. Kruger, S. Ehlers, W. Solbach, and M. Maass Phagocytes transmit Chlamydia pneumoniae from the lungs to the vasculature Eur. Respir. J., April 1, 2004; 23(4): 506 - 510. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Gieffers, J. Rupp, A. Gebert, W. Solbach, and M. Klinger First-Choice Antibiotics at Subinhibitory Concentrations Induce Persistence of Chlamydia pneumoniae Antimicrob. Agents Chemother., April 1, 2004; 48(4): 1402 - 1405. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Sander, K. Winbeck, J. Klingelhofer, T. Etgen, and B. Conrad Progression of Early Carotid Atherosclerosis Is Only Temporarily Reduced After Antibiotic Treatment of Chlamydia pneumoniae Seropositivity Circulation, March 2, 2004; 109(8): 1010 - 1015. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. van Zandbergen, J. Gieffers, H. Kothe, J. Rupp, A. Bollinger, E. Aga, M. Klinger, H. Brade, K. Dalhoff, M. Maass, et al. Chlamydia pneumoniae Multiply in Neutrophil Granulocytes and Delay Their Spontaneous Apoptosis J. Immunol., February 1, 2004; 172(3): 1768 - 1776. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Lindsberg and A. J. Grau Inflammation and Infections as Risk Factors for Ischemic Stroke Stroke, October 1, 2003; 34(10): 2518 - 2532. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Yamaguchi, H. Friedman, M. Yamamoto, K. Yasuda, and Y. Yamamoto Chlamydia pneumoniae Resists Antibiotics in Lymphocytes Antimicrob. Agents Chemother., June 1, 2003; 47(6): 1972 - 1975. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Rupp and M. Maass Egr-1, a Major Link Between Infection and Atherosclerosis? Circ. Res., May 16, 2003; 92 (9): e78 - e78. [Full Text] [PDF] |
||||
![]() |
J. P. Higgins Chlamydia pneumoniae and Coronary Artery Disease: The Antibiotic Trials Mayo Clin. Proc., March 1, 2003; 78(3): 321 - 332. [Abstract] [PDF] |
||||
![]() |
M. V. Kalayoglu, P. Libby, and G. I. Byrne Chlamydia pneumoniae as an Emerging Risk Factor in Cardiovascular Disease JAMA, December 4, 2002; 288(21): 2724 - 2731. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Sander, K. Winbeck, J. Klingelhofer, T. Etgen, and B. Conrad Reduced Progression of Early Carotid Atherosclerosis After Antibiotic Treatment and Chlamydia pneumoniae Seropositivity Circulation, November 5, 2002; 106(19): 2428 - 2433. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Shor, P. Libby, P. M. Ridker, and A. Maseri Atherosclerosis: Lipid Infiltration or Chlamydia pneumoniae Infection? * Response Circulation, October 29, 2002; 106 (18): e135 - e136. [Full Text] [PDF] |
||||
![]() |
A. F.M. Stone, M. A. Mendall, J.-C. Kaski, T. M. Edger, P. Risley, J. Poloniecki, A. J. Camm, and T. C. Northfield Effect of Treatment for Chlamydia pneumoniae and Helicobacter pylori on Markers of Inflammation and Cardiac Events in Patients With Acute Coronary Syndromes: South Thames Trial of Antibiotics in Myocardial Infarction and Unstable Angina (STAMINA) Circulation, September 3, 2002; 106(10): 1219 - 1223. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Wizel, B. C. Starcher, B. Samten, Z. Chroneos, P. F. Barnes, J. Dzuris, Y. Higashimoto, E. Appella, and A. Sette Multiple Chlamydiapneumoniae Antigens Prime CD8+ Tc1 Responses That Inhibit Intracellular Growth of This Vacuolar Pathogen J. Immunol., September 1, 2002; 169(5): 2524 - 2535. [Abstract] [Full Text] [PDF] |
||||
![]() |
F Blasi, S Damato, R Cosentini, P Tarsia, R Raccanelli, S Centanni, and L Allegra Chlamydia pneumoniae and chronic bronchitis: association with severity and bacterial clearance following treatment Thorax, August 1, 2002; 57(8): 672 - 676. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Yamaguchi, S. Haranaga, R. Widen, H. Friedman, and Y. Yamamoto Chlamydia pneumoniae Infection Induces Differentiation of Monocytes into Macrophages Infect. Immun., May 1, 2002; 70(5): 2392 - 2398. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Boman and M. R. Hammerschlag Chlamydia pneumoniae and Atherosclerosis: Critical Assessment of Diagnostic Methods and Relevance to Treatment Studies Clin. Microbiol. Rev., January 1, 2002; 15(1): 1 - 20. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Fan, F. Dong, Y. Huang, and G. Zhong Chlamydia pneumoniae Secretion of a Protease-Like Activity Factor for Degrading Host Cell Transcription Factors Is Required for Major Histocompatibility Complex Antigen Expression Infect. Immun., January 1, 2002; 70(1): 345 - 349. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Dreses-Werringloer, I. Padubrin, H. Zeidler, and L. Kohler Effects of Azithromycin and Rifampin on Chlamydia trachomatis Infection In Vitro Antimicrob. Agents Chemother., November 1, 2001; 45(11): 3001 - 3008. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. U. Heuschmann, D. Neureiter, M. Gesslein, B. Craiovan, M. Maass, G. Faller, G. Beck, B. Neundoerfer, and P. L. Kolominsky-Rabas Association Between Infection With Helicobacter pylori and Chlamydia pneumoniae and Risk of Ischemic Stroke Subtypes: Results From a Population-Based Case-Control Study Stroke, October 1, 2001; 32(10): 2253 - 2258. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Shor Mechanism of Arterial Infection by Chlamydia pneumoniae Circulation, September 25, 2001; 104 (13): e75 - e75. [Full Text] [PDF] |
||||
![]() |
M. Huhtinen, M. Puolakkainen, K. Laasila, M. Sarvas, A. Karma, and M. Leirisalo-Repo Chlamydial Antibodies in Patients with Previous Acute Anterior Uveitis Invest. Ophthalmol. Vis. Sci., July 1, 2001; 42(8): 1816 - 1819. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Caligiuri, M. Rottenberg, A. Nicoletti, H. Wigzell, and G. K. Hansson Chlamydia pneumoniae Infection Does Not Induce or Modify Atherosclerosis in Mice Circulation, June 12, 2001; 103(23): 2834 - 2838. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2001 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |