This Article Abstract Full Text (PDF) All Versions of this Article: 104/3/317    most recent hc2801.094031v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Patel, R. Articles by Marian, A. J. Search for Related Content PubMed PubMed Citation Articles by Patel, R. Articles by Marian, A. J. Pubmed/NCBI databases Compound via MeSH Substance via MeSH Medline Plus Health Information Cardiomyopathy Related Collections Glucose intolerance Animal models of human disease Genetically altered mice Hypertension - basic studies

(Circulation. 2001;104:317.)
© 2001 American Heart Association, Inc.

Basic Science Reports

Simvastatin Induces Regression of Cardiac Hypertrophy and Fibrosis and Improves Cardiac Function in a Transgenic Rabbit Model of Human Hypertrophic Cardiomyopathy

Rajnikant Patel, MD; Sherif F. Nagueh, MD; Natalie Tsybouleva, MD; Maha Abdellatif, MD, PhD; Silvia Lutucuta, MD; Helen A. Kopelen, RDCS; Miguel A. Quinones, MD; William A. Zoghbi, MD; Mark L. Entman, MD; Robert Roberts, MD; A. J. Marian, MD

From the Section of Cardiology, Department of Medicine, The DeBakey Heart Center, The Methodist Hospital and Baylor College of Medicine, Houston, Tex.

Correspondence to A.J. Marian, MD, Associate Professor of Medicine, Section of Cardiology, One Baylor Plaza, 543E, Houston, TX 77030. E-mail amarian{at}lbcm.tmc.edu

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Background— Hypertrophic cardiomyopathy is a genetic disease characterized by cardiac hypertrophy, myocyte disarray, interstitial fibrosis, and left ventricular (LV) dysfunction. We have proposed that hypertrophy and fibrosis, the major determinants of mortality and morbidity, are potentially reversible. We tested this hypothesis in ß-myosin heavy chain–Q⁴⁰³ transgenic rabbits.

Methods and Results— We randomized 24 ß-myosin heavy chain–Q⁴⁰³ rabbits to treatment with either a placebo or simvastatin (5 mg · kg^-1 · d^-1) for 12 weeks and included 12 nontransgenic controls. We performed 2D and Doppler echocardiography and tissue Doppler imaging before and after treatment. Demographic data were similar among the groups. Baseline mean LV mass and interventricular septal thickness in nontransgenic, placebo, and simvastatin groups were 3.9±0.7, 6.2±2.0, and 7.5±2.1 g (P<0.001) and 2.2±0.2, 3.1±0.5, and 3.3±0.5 mm (P=0.002), respectively. Simvastatin reduced LV mass by 37%, interventricular septal thickness by 21%, and posterior wall thickness by 13%. Doppler indices of LV filling pressure were improved. Collagen volume fraction was reduced by 44% (P<0.001). Disarray was unchanged. Levels of activated extracellular signal-regulated kinase (ERK) 1/2 were increased in the placebo group and were less than normal in the simvastatin group. Levels of activated and total p38, Jun N-terminal kinase, p70S6 kinase, Ras, Rac, and RhoA and the membrane association of Ras, RhoA, and Rac1 were unchanged.

Conclusions— Simvastatin induced the regression of hypertrophy and fibrosis, improved cardiac function, and reduced ERK1/2 activity in the ß-myosin heavy chain–Q⁴⁰³ rabbits. These findings highlight the need for clinical trials to determine the effects of simvastatin on cardiac hypertrophy, fibrosis, and dysfunction in humans with hypertrophic cardiomyopathy and heart failure.

Key Words: hypertrophy • fibrosis • genetics • simvastatin • heart failure

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
Cardiovascular disease is the single most common cause of death in the Western world.¹ Heart failure, the predominant long-term outcome of all forms of cardiovascular disease, accounts for 450 000 deaths per year in the United States alone.¹ Cardiac hypertrophy and interstitial fibrosis, the common responses of the heart to all forms of injury, are the major determinants of morbidity and mortality from cardiovascular disease.^2,3

Familial hypertrophic cardiomyopathy (HCM), a genetic model of cardiac hypertrophy and fibrosis,⁴ is the most common cause of sudden cardiac death in the young and a major cause of heart failure in elderly.⁵ Hypertrophy and fibrosis, as in acquired cardiovascular disease, are also the primary determinants of mortality and morbidity in HCM.^6,7 The molecular genetic basis of HCM has been elucidated, and >100 mutations in 9 genes encoding sarcomeric proteins have been identified.⁴ Experimental studies⁴ in conjunction with studies in humans⁸ have provided significant insight into the pathogenesis of HCM and have led us and others to propose that the primary abnormality in HCM is impaired myocardial mechanical function.⁹ Accordingly, increased myocyte stress, which is imparted by the mutant contractile proteins, activates "stress-responsive" intracellular signaling molecules in a manner similar to pressure-overload, thus provoking the transcriptional machinery to induce hypertrophy and fibrosis. Thus, hypertrophy and fibrosis in HCM are "secondary phenotypes" and are potentially reversible.

We generated a transgenic rabbit model for HCM by the cardiac-restricted expression of ß-myosin heavy chain (MyHC)-glutamine 403 (Q⁴⁰³), which is known to cause HCM in humans.¹⁰ The ß-MyHC-Q⁴⁰³ rabbits fully recapitulate the phenotype of human HCM and exhibit cardiac hypertrophy, interstitial fibrosis, myocyte disarray, and cardiac dysfunction,^11,12 and they serve as a desirable model to determine the effects of therapies targeted at specific pathways to reverse cardiac hypertrophy, fibrosis, and dysfunction. Recently, 3-hydroxy-3-methyglutaryl-coenzyme A (HMG-CoA) reductase inhibitors (statins) have been shown to inhibit angiotensin II–mediated myocyte hypertrophy^13,14 and to block intracellular signaling molecules implicated in cardiac hypertrophy.^15–17 Thus, we determined the effects of simvastatin, a pleiotropic HMG-CoA reductase inhibitor, on cardiac hypertrophy, fibrosis, and dysfunction in the ß-MyHC-Q⁴⁰³ transgenic rabbits.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
The mutant ß-MyHC-Q⁴⁰³ transgenic rabbits were generated as described previously, and their phenotypic characteristics were the same as those published previously.^11,12 A total of 24 adult ß-MyHC-Q⁴⁰³ transgenic rabbits were matched for age and sex and randomized to either treatment with a placebo or simvastatin. Twelve age- and sex-matched nontransgenic littermates were included as controls. Baseline M-mode, 2D, Doppler echocardiography and tissue Doppler imaging were performed in all rabbits. The primary end point was regression of left ventricular (LV) mass, as detected by 2D echocardiography. The secondary end points were changes in interventricular septal thickness, posterior wall thickness, cardiac function, interstitial fibrosis, and myocyte disarray. Simvastatin was mixed with rabbit high-fiber diet #5326 (prepared by Purina Test diet) and was fed to rabbits at a concentration of 5 mg · kg^-1 · d^-1, which is considered a safe dose in rabbits,¹⁸ for 12 weeks. Follow-up echocardiographic studies were performed at the completion of the study. Echocardiographic images were obtained and analyzed as described previously.^11,12

Detection and Quantification
Fibrillar Collagen
Interstitial collagen volume fraction was determined as described previously.¹⁹ In brief, 5-µm-thick myocardial sections were stained with collagen-specific Sirius red F3BA and were analyzed by an investigator who was blinded to the groups, in 10 randomly selected fields per section, in 10 sections per rabbit, and in 12 rabbits per group in a random fashion by computerized planimetry. Perivascular and epimysial collagens were excluded. To confirm the results of picrosirius red staining, 5 additional thin sections were stained with Masson trichrome and analyzed for collagen volume fraction.

Myocyte Disarray
Myocyte disarray was detected and quantified as described previously, with some modifications.¹⁹ Each myocardial section was divided into 50 fields of approximately equal size, and the presence or absence of disarray in each field was scored. Number of fields per section showing disarray was computed as percent showing disarray (per section) and the total percent disarray was determined in 8 sections per rabbit (400 fields per rabbit). Areas of myocardium at the junctions of interventricular septum with the ventricles and sections near the blood vessels, trabeculations, and papillary muscles were excluded.

Expression of Skeletal -Actin
The expression of skeletal -actin, a marker of secondary cardiac hypertrophy, was detected by Northern blotting. In brief, 20-µg aliquots of total RNA extracts were loaded onto formaldehyde-agarose gels, electrophoresed, and transferred to nylon membranes.¹¹ A 502-bp fragment of the rabbit skeletal -actin gene was amplified by polymerase chain reaction. Oligonucleotide primers (forward primer: 5'TCATGGTCGGTATGGGTCAGA3'; reverse primer: 5' CCTCATAAATGGGCACGTTG3') were designed on the basis of the sequence of human skeletal -actin (GenBank accession number M20543). The probe was labeled with [³²P]dCTP and hybridized to membranes. Signals were detected by autoradiography and quantified by spot densitometry.

Signaling Kinases and Molecules
Expression levels of total and phosphorylated extracellular signal-regulated kinase (ERK) 1/2, p38, and p70S6 kinase were detected by immunoblotting using pan-specific and phospho-specific antibodies. Expression levels of total and phosphorylated Jun N-terminal kinases (JNKs) were detected by immunoblotting after immunoprecipitation with specific antibodies. All primary antibodies were used at a concentration of 1:200, and secondary antibodies were used at concentrations of 1:1000 to 1:2000.

Activation of Ras was detected by selective-affinity precipitation of Ras-GTP with immobilized Raf-1 (Ras binding domain), and Ras detection was determined by blotting with a pan-isoform–specific Ras antibody. Activation of Rac was determined by selective affinity precipitation of Rac-GTP with immobilized p21 activated kinase 1 (Rac binding domain). A positive control assay, composed of Ras activation after the timed exposure of cultured mink lung epithelial cells to 10% fetal calf serum, was included.

Subcellular Fractionation and Localization of Ras and RhoA
To determine the degree of membrane association of Ras, RhoA, and Rac1, we performed subcellular fractionation of heart tissue. For each sample, 300 mg of tissue was homogenized in 14 mL of hypotonic buffer (10 mmol/L Tris-HCl [pH 7.5], 1.0 mmol/L MgCl₂, 0.5 mmol/L phenylmethylsulfonyl fluoride, 10 µg/mL leupeptin, and 10 µmg/mL aprotinin). The lysate was then transferred to a polycarbonate ultracentrifuge tube and spun at 100 000g for 90 minutes at 4°C. The supernatant fluid (representing the cytosolic fraction) was transferred to a new microcentrifuge tube; the pellet (representing the membrane fraction) was resuspended in 1 mL of hypotonic buffer, to which was added 1% sodium dodecyl sulfate. A total of 15 µg of the cellular and membrane fractions were fractionated on SDS-PAGE gels and analyzed by Western blotting using monoclonal anti-Ras and anti-RhoA (Upstate Biotechnology Inc).

Statistical Analysis
Continuous variables were expressed as mean±SD. Differences among the groups were compared by ANOVA for phenotypes with equal variance and by Kruskal-Wallis test for those with unequal variance. Differences at baseline and follow-up in each group were compared by paired t tests.

	Results

Top Abstract Introduction Methods Results Discussion References

 
Phenotype in the Mutant ß-MyHC-Q⁴⁰³ Transgenic Rabbits
There were no significant differences in the mean age, male/female ratio, body weight, heart rate, or blood pressure between the ß-MyHC-Q⁴⁰³ transgenic and nontransgenic rabbits (Table 1). However, as shown previously, LV mass, interventricular septal thickness, posterior wall thickness, and left atrial size were increased significantly in the ß-MyHC-Q⁴⁰³ rabbits compared with nontransgenic ones (Table 1). Similarly, Doppler indices of LV filling pressures, early (E) and late (A) mitral inflow velocities, E/A ratio, and E/early diastolic velocity (Ea) ratio were increased significantly and isovolumic relaxation time was decreased. Furthermore, myocardial systolic and diastolic velocities were reduced significantly. Collagen volume fraction and the extent of myocyte disarray were increased in the ß-MyHC-Q⁴⁰³ rabbits (Table 1).

View this table: [in this window] [in a new window]   Table 1. Baseline Characteristics and Cardiac Phenotypes in the ß-MyHC-Q403 Transgenic Rabbits

Expression levels of activated ERK1/2 were increased by 2-fold in the ß-MyHC-Q⁴⁰³ rabbits compared with nontransgenic rabbits (Figure 1). Levels of total ERK1/2 were unchanged. We detected no significant increase in the levels of total and activated p38, JNKs, Ras, Rac1, or p70S6 kinase, a downstream target of phosphatidylinositol 3-kinase, in the ß-MyHC-Q⁴⁰³ rabbits (Figures 1 and 2A). In addition, the membrane association of Ras, Rac1, and RhoA was not significantly changed (Figure 2B).

View larger version (68K): [in this window] [in a new window]   Figure 1. Levels of activated and total stress-responsive intracellular signaling kinases in the heart of ß-MyHC-Q403 transgenic rabbits. Each lane represents a cardiac protein extract from one rabbit, and 2 rabbits per group are shown. Immunoblots for ERK1/2, p38, JNK, and p70S6 kinase are shown. The upper blot in each set of panels represents levels of phosphorylated kinases, and the lower panel represents levels of total kinases. Non-tg indicates nontransgenic.

View larger version (72K): [in this window] [in a new window]   Figure 2. GTP-bound and membrane association of Ras, Rac1, and RhoA. A, Activation Ras and Rac1. Each lane represents cardiac protein extract from one rabbit. Upper blot in each set of panels shows levels of GTP-bound Ras and Rac1, and the lower blot shows levels of total Ras and Rac-1. The bottom panel represents a positive control showing activation of Ras after stimulation of mink lung epithelial cells with 10% fetal calf serum at the specified time points. Molecular size markers are indicated on the right of each panel. B, Membrane-bound, soluble, and total Ras, Rac1, and RhoA. Non-tg indicates nontransgenic.

Effects of Simvastatin on LV Hypertrophy, Fibrosis, and Function
There were no significant differences in mean age, male/female ratio, body weight, heart rate, blood pressure, or cardiac phenotype, including LV mass, interventricular septal thickness, posterior wall thickness, LV end-diastolic diameter, LV end-systolic diameter, mitral inflow and pulmonary venous Doppler velocities, and tissue Doppler indices, at baseline between the placebo and simvastatin groups (Table 2). Therefore, the placebo and simvastatin groups were well matched.

View this table: [in this window] [in a new window]   Table 2. Indices of Cardiac Hypertrophy and Function at ables of contents in both Baseline and After Treatment With Simvastatin

Treatment with simvastatin reduced mean LV mass by 37%, interventricular septal thickness by 21%, posterior wall thickness by 15%, and LV end-diastolic diameter by 13% (Table 1). Concordant with regression of cardiac hypertrophy, Doppler indices of LV filling pressure, namely E/A ratio (reduced 35%), isovolumic relaxation time (improved 7.5%), septal E/Ea ratio (reduced 48%), and lateral E/Ea (reduced 46%) were improved significantly, indicating a lower LV filling pressure. Similarly, the time interval between the atrial reverse wave and antegrade mitral flow was reduced (by 167%), indicating a lower left atrial pressure.²⁰ Myocardial systolic and diastolic velocities at both corners of mitral annulus also showed significant improvement. Collectively, Doppler data indicate a significant reduction in the LV filling pressure and improvement in myocardial contractile and relaxation properties.

Interstitial collagen volume fraction was reduced by 44% in the simvastatin group (nontransgenic, 3.6±1.2%; placebo, 9.6±2.2%; simvastatin, 5.4±1.5% of the myocardium; P=0.001). Representative micrographs of Masson trichrome staining are shown in Figure 3. Myocyte disarray comprised 5.7±1.8%, 12.0±4.1%, and 10.2±2.2% of the myocardium in nontransgenic, placebo, and simvastatin groups, respectively (placebo versus simvastatin, P=0.295).

View larger version (124K): [in this window] [in a new window]   Figure 3. Massonm trichrome staining. The upper panels show low magnificiation (x 40) and the lower panels high magnification (x 400) of thin myocardial sections.

Expression of the skeletal -actin was increased in the placebo group compared with nontransgenic rabbits, and treatment with simvastatin reduced its expression >3-fold (Figure 4).

View larger version (51K): [in this window] [in a new window]   Figure 4. Northern bolt showing expression of skeletal -actin. Non-tg indicates nontransgenic.

Effects of Simvastatin on Intracellular Signaling Kinases and Molecules
Treatment with simvastatin significantly reduced activated ERK1/2 to levels less than those in the nontransgenic rabbits (Figure 2A). Simvastatin had no significant effect on total and activated p38, JNKs, Ras, Rac1, and p70S6 kinase or the membrane association of Ras, Rac1, and RhoA in the mutant ß-MyHC-Q⁴⁰³ rabbits (Figure 2).

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
We generated a transgenic rabbit model of human HCM by cardiac-restricted expression of ß-MyHC-Q⁴⁰³, which is known to cause HCM in humans.¹⁰ The adult ß-MyHC-Q⁴⁰³ rabbits fully recapitulate the phenotype of human HCM and exhibit cardiac hypertrophy, myocyte disarray, interstitial fibrosis, increased LV filling pressure, and reduced myocardial contraction and relaxation velocities.^11,12 We performed a randomized study and treated the mutant ß-MyHC-Q⁴⁰³ rabbits with a placebo or simvastatin for 12 weeks. Treatment with simvastatin reduced LV mass, wall thickness, and filling pressure significantly. In addition, collagen volume fraction was reduced by 50%, but the extent of myocyte disarray was unchanged. Levels of activated ERK1/2 were increased in the mutant ß-MyHC-Q⁴⁰³ rabbits and were reduced to less than normal after treatment with simvastatin. The expression of skeletal -actin, a marker of secondary hypertrophy, which was increased in the ß-MyHC-Q⁴⁰³, was reduced after treatment with simvastatin. Thus, simvastatin induced the regression of cardiac hypertrophy and fibrosis, improved LV filling pressures, and reduced the levels of activated stress-responsive ERK1/2 in a transgenic rabbit model of human HCM.

The study was randomized, and there were no significant differences in the baseline demographic and echocardiographic phenotypes between the placebo and simvastatin groups. We acquired the data and performed extensive phenotypic characterization without knowledge of the group assignment. The results were concordant for strong beneficial effects of simvastatin on molecular (reduction in phospho-ERK1/2 and expression of skeletal -actin), histological (reduction of fibrosis), structural (LV mass and wall thickness), and functional (reduction of LV filling pressures and improvement of myocardial contraction and relaxation velocities) phenotypes. Similarly, significant improvement in indices of hypertrophy and LV filling pressure at follow-up (compared with baseline) were detected only in the simvastatin group. The observed beneficial effects of simvastatin in the ß -MyHC-Q⁴⁰³ rabbits are in accord with the effects of statins on the prevention of angiotensin II–induced myocyte hypertrophy¹³ and pressure-overload–induced hypertrophy in rats.¹⁴ The dose of simvastatin used in this study is considered safe¹⁸ and similar to a previously used dose of 3.6 mg · kg^-1 · d^-1, which was shown to induce regression of cardiac hypertrophy in load-induced hypertrophy.¹⁴ The above dose is higher than the conventional dose of simvastatin used in humans (up to 80 mg/d) and, thus, whether the observed results could be extended to human patients with HCM and heart failure needs to be explored.

The mechanism(s) by which simvastatin induces the regression of hypertrophy and fibrosis and improves cardiac function is likely to involve downregulating the levels of activated ERK1/2, the predominant stress-responsive intracellular signaling kinase involved in modulating cardiac hypertrophy.²¹ Simvastatin, an HMG-CoA reductase inhibitor, has pleiotropic effects that interact with the effects of renin-angiotensin aldosterone system pathways. Simvastatin has also been shown to induce the regression of load-induced cardiac hypertrophy by reducing the activity of the angiotensin-converting enzyme and the cardiac content of angiotensin II.¹⁴ Simvastatin inhibits the synthesis of isoprenoid intermediates of cholesterol biosynthesis farnesylpyrophosphate and geranylgeranylpyrophosphate, which are used in the post-translation modification of the Ras and the Rho family of proteins, respectively, by isopropenyl transferases.²² This modification step is considered essential for maturation, membrane localization, and the subsequent activation of small GTP-binding proteins.²³

We found no significant differences in the activation and membrane association of Ras, Rac1 and RhoA. However, the lack of a significant increase in activation of the selected small GTP-binding proteins in the heart of ß-MyHC-Q⁴⁰³ rabbits does not necessarily exclude their involvement in the pathogenesis of HCM. It may reflect the nature of the stimulus, which is chronic and relatively low, in contrast to in vitro cell culture experiments, in which the stimulus is acute and strong. It is also possible that Ras-independent mechanisms are involved in the activation of ERK1/2 and the effects of simvastatin in the heart of ß-MyHC-Q⁴⁰³ rabbits. For example, G-protein–coupled receptor agonists can activate ERK1/2 through the protein kinase A/Rap1-B/Raf pathway and through the activation of phospholipase C. Activated phospholipase C catalyzes the hydrolysis of phosphatidyl-inositol bisphosphate into diacyl-glycerol and inositol trisphosphate. The latter induces calcium release from the endoplasmic reticulum and, together with diacyl-glycerol, activates protein kinase C.

Protein kinase C and Ca²⁺ lie upstream of a family of mitogen-activated protein kinases and plays a critical role in activating ERK1/2.^24–26 Other pathways, including mitogen-activated protein (MAP) kinase kinases (MKKKs) such as Nck-interacting kinase and adaptor proteins such as Grb2, could also activate (MAP/ERK kinase kinase [MEKK] 1)/(MAP/ERK kinase 1/2) and, subsequently, ERK1/2.²⁷ Furthermore, scaffolding or anchoring proteins such as 14-3-3, by regulating protein-protein interactions and subcellular localization, could activate the components of the MEKK1 pathway.²⁷ Moreover, complex interactions between mitogen-activated protein kinase, Ca²⁺-calmodulin/calcineurin, and ß₁-integrin pathways exists that could lead to the activation of ERK1/2. Therefore, a variety of upstream regulators, including Ras-independent pathways, could activate ERK1/2. Extensive investigation of signaling pathways and the mechanism(s) by which simvastatin suppresses the activation of ERK1/2 in the ß-MyHC-Q⁴⁰³ rabbits require additional investigations.

Hypertrophy and fibrosis are the major clinical and pathological phenotypes of HCM, which is the most common cause of sudden cardiac death in the young.⁵ None of the existing pharmacological therapies for HCM induces a regression of hypertrophy and fibrosis or reduces mortality.²⁸ Similarly, myomectomy and nonsurgical septal ablation are considered palliative therapies that are limited to patients who have significant septal hypertrophy and resting outflow tract obstruction. Therefore, our findings in a transgenic rabbit model that fully recapitulates the phenotype of HCM in humans is the first pharmacological intervention to reverse the underlying pathology, ie, cardiac hypertrophy, fibrosis, and dysfunction. Because the penetrance of the causal mutations in HCM is age-dependent, our findings also raise the possibility of an early intervention to prevent the development of cardiac phenotype in HCM. Furthermore, because hypertrophy and fibrosis are the common responses of the heart to all forms of injury and are major determinants of mortality and morbidity,^2,3 our findings could have broader implications for the treatment and prevention of all forms of cardiovascular disease. We note that simvastatin has a well-established safety profile, and it has been used extensively in humans. Thus, our results highlight the need for a clinical trial to determine the potential salutary effects of simvastatin in humans with HCM or heart failure.

In summary, we have shown that simvastatin, a pleiotropic HMG-CoA reductase inhibitor, induces the regression of cardiac hypertrophy and fibrosis, reduces levels of activated stress-responsive signaling kinases, and improves LV filling pressures in a transgenic rabbit model that fully recapitulates the phenotype of human HCM. These findings, if confirmed in humans, could provide a new option for the treatment and prevention of cardiac hypertrophy, fibrosis, and dysfunction in HCM and in all forms of cardiovascular disease.

	Acknowledgments

 
Supported by grants from the National Heart, Lung, and Blood Institute, Specialized Centers of Research (P50-HL42267-01), grant HL-42550, and an Established Investigator Award (9640133N) from the American Heart Association National Center, Dallas, Texas.

	Footnotes

 
This article originally appeared Online on June 25, 2001 (Circulation. 2001;103:r27–r34).

Received May 9, 2001; revision received May 30, 2001; accepted June 4, 2001.

	References

Top Abstract Introduction Methods Results Discussion References

 

1. Heart and Stroke Statistical Update. Dallas, Tex: American Heart Association; 2001. Available at: http://www.americanheart.org/statistics/pdf/HSSTATS2001_1.0.pdf. Accessed April 1, 2001
   
2. Haider AW, Larson MG, Benjamin EJ, et al. Increased left ventricular mass and hypertrophy are associated with increased risk for sudden death. J Am Coll Cardiol. 1998; 32: 1454–1459.[Abstract/Free Full Text]
   
3. Assayag P, Carre F, Chevalier B, et al. Compensated cardiac hypertrophy: arrhythmogenicity and the new myocardial phenotype, I: fibrosis. Cardiovasc Res. 1997; 34: 439–444.[Abstract/Free Full Text]
   
4. Marian AJ, Roberts R. The molecular genetic basis for hypertrophic cardiomyopathy. J Mol Cell Cardiol. 2001; 33: 655–670.[Medline] [Order article via Infotrieve]
   
5. Maron BJ, Shirani J, Poliac LC, et al. Sudden death in young competitive athletes: clinical, demographic, and pathological profiles. JAMA. 1996; 276: 199–204.[Abstract]
   
6. Shirani J, Pick R, Roberts WC, et al. Morphology and significance of the left ventricular collagen network in young patients with hypertrophic cardiomyopathy and sudden cardiac death. J Am Coll Cardiol. 2000; 35: 36–44.[Abstract/Free Full Text]
   
7. Spirito P, Maron BJ. Relation between extent of left ventricular hypertrophy and occurrence of sudden cardiac death in hypertrophic cardiomyopathy. J Am Coll Cardiol. 1990; 15: 1521–1526.[Abstract]
   
8. Nagueh SF, Bachinski L, Meyer D, et al. Tissue Doppler imaging consistently detects myocardial abnormalities in patients with familial hypertrophic cardiomyopathy and provides a novel means for an early diagnosis prior to an independent of hypertrophy. Circulation. 2001; 104: 128–130.[Abstract/Free Full Text]
   
9. Marian AJ. Pathogenesis of diverse clinical and pathological phenotypes in hypertrophic cardiomyopathy. Lancet. 2000; 355: 58–60.[Medline] [Order article via Infotrieve]
   
10. Watkins H, Rosenzweig A, Hwang DS, et al. Characteristics and prognostic implications of myosin missense mutations in familial hypertrophic cardiomyopathy. N Engl J Med. 1992; 326: 1108–1114.[Abstract]
    
11. Marian AJ, Wu Y, Lim DS, et al. A transgenic rabbit model for human hypertrophic cardiomyopathy. J Clin Invest. 1999; 104: 1683–1692.[Medline] [Order article via Infotrieve]
    
12. Nagueh SF, Kopelen HA, Lim DS, et al. Tissue Doppler imaging consistently detects myocardial contraction and relaxation abnormalities, irrespective of cardiac hypertrophy, in a transgenic rabbit model of human hypertrophic cardiomyopathy. Circulation. 2000; 102: 1346–1350.[Abstract/Free Full Text]
    
13. Oi S, Haneda T, Osaki J, et al. Lovastatin prevents angiotensin II-induced cardiac hypertrophy in cultured neonatal rat heart cells. Eur J Pharmacol. 1999; 376: 139–148.[Medline] [Order article via Infotrieve]
    
14. Luo JD, Zhang WW, Zhang GP, et al. Simvastatin inhibits cardiac hypertrophy and angiotensin-converting enzyme activity in rats with aortic stenosis. Clin Exp Pharmacol Physiol. 1999; 26: 903–908.[Medline] [Order article via Infotrieve]
    
15. Hernandez-Perera O, Perez-Sala D, Soria E, et al. Involvement of Rho GTPases in the transcriptional inhibition of preproendothelin-1 gene expression by simvastatin in vascular endothelial cells. Circ Res. 2000; 87: 616–622.[Abstract/Free Full Text]
    
16. Park HJ, Galper JB. 3-Hydroxy-3-methylglutaryl CoA reductase inhibitors up-regulate transforming growth factor-beta signaling in cultured heart cells via inhibition of geranylgeranylation of RhoA GTPase. Proc Natl Acad Sci U S A. 1999; 96: 11525–11530.[Abstract/Free Full Text]
    
17. Guijarro C, Blanco-Colio LM, Ortego M, et al. 3-Hydroxy-3-methylglutaryl coenzyme a reductase and isoprenylation inhibitors induce apoptosis of vascular smooth muscle cells in culture. Circ Res. 1998; 83: 490–500.[Abstract/Free Full Text]
    
18. Gerson RJ, MacDonald JS, Alberts AW, et al. Animal safety and toxicology of simvastatin and related hydroxy-methylglutaryl-coenzyme A reductase inhibitors. Am J Med. 1989; 87: 28S–38S.
    
19. Lim DS, Lutucuta S, 1 Bachireddy P, et al. Angiotensin II blockade reverses myocardial fibrosis in a transgenic mouse model of human hypertrophic cardiomyopathy. Circulation. 2001; 103: 789–791.[Abstract/Free Full Text]
    
20. Nagueh SF, Lakkis NM, 1 Middleton KJ, et al. Doppler estimation of left ventricular filling pressures in patients with hypertrophic cardiomyopathy. Circulation. 1999; 99: 254–261.[Abstract/Free Full Text]
    
21. Sugden PH, Clerk A. "Stress-responsive" mitogen-activated protein kinases (c-Jun N-terminal kinases and p38 mitogen-activated protein kinases) in the myocardium. Circ Res. 1998; 83: 345–352.[Free Full Text]
    
22. Grunler J, Ericsson J, Dallner G. Branch-point reactions in the biosynthesis of cholesterol, dolichol, ubiquinone and prenylated proteins. Biochim Biophys Acta. 1994; 1212: 259–277.[Medline] [Order article via Infotrieve]
    
23. Hori Y, Kikuchi A, Isomura M, et al. Post-translational modifications of the C-terminal region of the rho protein are important for its interaction with membranes and the stimulatory and inhibitory GDP/GTP exchange proteins. Oncogene. 1991; 6: 515–522.[Medline] [Order article via Infotrieve]
    
24. Zou Y, Komuro I, Yamazaki T, et al. Protein kinase C, but not tyrosine kinases or Ras, plays a critical role in angiotensin II-induced activation of Raf-1 kinase and extracellular signal-regulated protein kinases in cardiac myocytes. J Biol Chem. 1996; 271: 33592–33597.[Abstract/Free Full Text]
    
25. Craddock BL, Hobbs J, Edmead CE, et al. Phosphoinositide 3-kinase-dependent regulation of IL-3-induced proliferation: involvement of mitogen-activated protein kinases, SHP2 and Gab2. J Biol Chem. In press.
    
26. Lorimer IA, Lavictoire SJ. Activation of extracellular-regulated kinases by normal and mutant EGF receptors. Biochim Biophys Acta. 2001; 1538: 1–9.[Medline] [Order article via Infotrieve]
    
27. Garrington TP, Johnson GL. Organization and regulation of mitogen-activated protein kinase signaling pathways. Curr Opin Cell Biol. 1999; 11: 211–218.[Medline] [Order article via Infotrieve]
    
28. Marian AJ. Hypertrophic cardiomyopathy.In: Rackel RE, ed. Conn’s Current Therapy. Philadelphia: Saunders; 2000: 286–287.
    

This article has been cited by other articles:

				T. Tsoutsman, M. Kelly, D. C.H. Ng, J.-E. Tan, E. Tu, L. Lam, M. A. Bogoyevitch, C. E. Seidman, J.G. Seidman, and C. Semsarian Severe Heart Failure and Early Mortality in a Double-Mutation Mouse Model of Familial Hypertrophic Cardiomyopathy Circulation, April 8, 2008; 117(14): 1820 - 1831. [Abstract] [Full Text] [PDF]

				M. Revera, L. van der Merwe, M. Heradien, A. Goosen, V. A. Corfield, P. A. Brink, and J. C. Moolman-Smook Troponin T and {beta}-myosin mutations have distinct cardiac functional effects in hypertrophic cardiomyopathy patients without hypertrophy Cardiovasc Res, March 1, 2008; 77(4): 687 - 694. [Abstract] [Full Text] [PDF]

				C. M. Ripplinger, W. Li, J. Hadley, J. Chen, F. Rothenberg, R. Lombardi, S. A. Wickline, A. J. Marian, and I. R. Efimov Enhanced Transmural Fiber Rotation and Connexin 43 Heterogeneity Are Associated With an Increased Upper Limit of Vulnerability in a Transgenic Rabbit Model of Human Hypertrophic Cardiomyopathy Circ. Res., November 9, 2007; 101(10): 1049 - 1057. [Abstract] [Full Text] [PDF]

				A. Shiroshita-Takeshita, B. J.J.M. Brundel, B. Burstein, T.-K. Leung, H. Mitamura, S. Ogawa, and S. Nattel Effects of simvastatin on the development of the atrial fibrillation substrate in dogs with congestive heart failure Cardiovasc Res, April 1, 2007; 74(1): 75 - 84. [Abstract] [Full Text] [PDF]

				J. J. M. Greer, A. K. Kakkar, J. W. Elrod, L. J. Watson, S. P. Jones, and D. J. Lefer Low-dose simvastatin improves survival and ventricular function via eNOS in congestive heart failure Am J Physiol Heart Circ Physiol, December 1, 2006; 291(6): H2743 - H2751. [Abstract] [Full Text] [PDF]

				J. Bauersachs, K. Hiss, D. Fraccarollo, U. Laufs, and H. Ruetten Simvastatin improves left ventricular function after myocardial infarction in hypercholesterolemic rabbits by anti-inflammatory effects Cardiovasc Res, December 1, 2006; 72(3): 438 - 446. [Abstract] [Full Text] [PDF]

				J. Wang, K. M. Kurrelmeyer, G. Torre-Amione, and S. F. Nagueh Systolic and Diastolic Dyssynchrony in Patients With Diastolic Heart Failure and the Effect of Medical Therapy J. Am. Coll. Cardiol., October 31, 2006; (2006) j.jacc.2006.10.023v1. [Abstract] [Full Text] [PDF]

				C. Y. Ho and C. E. Seidman A Contemporary Approach to Hypertrophic Cardiomyopathy Circulation, June 20, 2006; 113(24): e858 - e862. [Full Text] [PDF]

				A. J. Marian, V. Senthil, S. N. Chen, and R. Lombardi Antifibrotic Effects of Antioxidant N-Acetylcysteine in a Mouse Model of Human Hypertrophic Cardiomyopathy Mutation J. Am. Coll. Cardiol., February 21, 2006; 47(4): 827 - 834. [Abstract] [Full Text] [PDF]

				W. D. Binder, M. A. Fifer, M. E. King, and J. R. Stone Case 26-2005 - A 48-Year-Old Man with Sudden Loss of Consciousness while Jogging N. Engl. J. Med., August 25, 2005; 353(8): 824 - 832. [Full Text] [PDF]

				V. Senthil, S. N. Chen, N. Tsybouleva, T. Halder, S. F. Nagueh, J. T. Willerson, R. Roberts, and A.J. Marian Prevention of Cardiac Hypertrophy by Atorvastatin in a Transgenic Rabbit Model of Human Hypertrophic Cardiomyopathy Circ. Res., August 5, 2005; 97(3): 285 - 292. [Abstract] [Full Text] [PDF]

				M. R. Zile Treating Diastolic Heart Failure With Statins: "Phat" Chance for Pleiotropic Benefits Circulation, July 19, 2005; 112(3): 300 - 303. [Full Text] [PDF]

				H. Fukuta, D. C. Sane, S. Brucks, and W. C. Little Statin Therapy May Be Associated With Lower Mortality in Patients With Diastolic Heart Failure: A Preliminary Report Circulation, July 19, 2005; 112(3): 357 - 363. [Abstract] [Full Text] [PDF]

				R. Roberts and U. Sigwart Current Concepts of the Pathogenesis and Treatment of Hypertrophic Cardiomyopathy Circulation, July 12, 2005; 112(2): 293 - 296. [Full Text] [PDF]

				D. A. Kass Ventricular Arterial Stiffening: Integrating the Pathophysiology Hypertension, July 1, 2005; 46(1): 185 - 193. [Abstract] [Full Text] [PDF]

				A D Gavin and A D Struthers Allopurinol reduces B-type natriuretic peptide concentrations and haemoglobin but does not alter exercise capacity in chronic heart failure Heart, June 1, 2005; 91(6): 749 - 753. [Abstract] [Full Text] [PDF]

				A. Sanbe, J. James, V. Tuzcu, S. Nas, L. Martin, J. Gulick, H. Osinska, S. Sakthivel, R. Klevitsky, K. S. Ginsburg, et al. Transgenic Rabbit Model for Human Troponin I-Based Hypertrophic Cardiomyopathy Circulation, May 10, 2005; 111(18): 2330 - 2338. [Abstract] [Full Text] [PDF]

				K. L. Watts, E. M. Sampson, G. S. Schultz, and M. A. Spiteri Simvastatin Inhibits Growth Factor Expression and Modulates Profibrogenic Markers in Lung Fibroblasts Am. J. Respir. Cell Mol. Biol., April 1, 2005; 32(4): 290 - 300. [Abstract] [Full Text] [PDF]

				T.-M. Lee, M.-S. Lin, T.-F. Chou, and N.-C. Chang Effect of simvastatin on left ventricular mass in hypercholesterolemic rabbits Am J Physiol Heart Circ Physiol, March 1, 2005; 288(3): H1352 - H1358. [Abstract] [Full Text] [PDF]

				J. S. Sidhu, Y. S. Rajawat, T. G. Rami, M. H. Gollob, Z. Wang, R. Yuan, A.J. Marian, F. J. DeMayo, D. Weilbacher, G. E. Taffet, et al. Transgenic Mouse Model of Ventricular Preexcitation and Atrioventricular Reentrant Tachycardia Induced by an AMP-Activated Protein Kinase Loss-of-Function Mutation Responsible for Wolff-Parkinson-White Syndrome Circulation, January 4, 2005; 111(1): 21 - 29. [Abstract] [Full Text] [PDF]

				S. Lutucuta, N. Tsybouleva, M. Ishiyama, G. DeFreitas, L. Wei, B. Carabello, and A.J. Marian Induction and reversal of cardiac phenotype of human hypertrophic cardiomyopathy mutation cardiac troponin T-Q92 in switch on-switch off bigenic mice J. Am. Coll. Cardiol., December 7, 2004; 44(11): 2221 - 2230. [Abstract] [Full Text] [PDF]

				K. E. Porter, N. A. Turner, D. J. O'Regan, and S. G. Ball Tumor necrosis factor {alpha} induces human atrial myofibroblast proliferation, invasion and MMP-9 secretion: inhibition by simvastatin Cardiovasc Res, December 1, 2004; 64(3): 507 - 515. [Abstract] [Full Text] [PDF]

				H. Chen, X. N. Huang, A. F. R. Stewart, and J. L. Sepulveda Gene expression changes associated with fibronectin-induced cardiac myocyte hypertrophy Physiol Genomics, August 11, 2004; 18(3): 273 - 283. [Abstract] [Full Text] [PDF]