Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 2001;104:979-981
doi: 10.1161/hc3401.095947
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Negoro, S.
Right arrow Articles by Yamauchi-Takihara, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Negoro, S.
Right arrow Articles by Yamauchi-Takihara, K.
Related Collections
Right arrow Oxidant stress

(Circulation. 2001;104:979.)
© 2001 American Heart Association, Inc.


Brief Rapid Communications

Activation of Signal Transducer and Activator of Transcription 3 Protects Cardiomyocytes from Hypoxia/Reoxygenation-Induced Oxidative Stress Through the Upregulation of Manganese Superoxide Dismutase

Shinji Negoro, MD, PhD; Keita Kunisada, MD, PhD; Yasushi Fujio, MD, PhD; Masanobu Funamoto, MD, PhD; Martine I. Darville, MD, PhD; Décio L. Eizirik, MD, PhD; Tomoaki Osugi, MD; Masahiro Izumi, MD; Yuichi Oshima, MD; Yoshikazu Nakaoka, MD; Hisao Hirota, MD, PhD; Tadamitsu Kishimoto, MD, PhD; Keiko Yamauchi-Takihara, MD, PhD

From the Department of Molecular Medicine, Osaka University Graduate School of Medicine, Osaka, Japan (S.N., K.K., Y.F., M.F., T.O., M.I., Y.O., Y.N., H.H., T.K., K.Y.-T.), and the Gene Expression Unit, Diabetes Research Center, Vrije Universiteit, Brussels, Belgium (M.I.D., D.L.E.).

Correspondence to Keita Kunisada, MD, PhD, Department of Molecular Medicine, Osaka University Graduate School of Medicine, 2-2 Yamadaoka, Suita, Osaka 565-0871, Japan. E-mail: kunisada{at}imed3.med.osaka-u.ac.jp


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background— Mice with cardiac-specific overexpression of signal transducer and activator of transcription 3 (STAT3) are resistant to doxorubicin-induced damage. The STAT3 signal may be involved in the detoxification of reactive oxygen species (ROS).

Methods and Results— The effects of leukemia inhibitory factor (LIF) or adenovirus-mediated transfection of constitutively activated STAT3 (caSTAT3) on the intracellular ROS formation induced by hypoxia/reoxygenation (H/R) were examined using rat neonatal cardiomyocytes. Either LIF treatment or caSTAT3 significantly suppressed the increase of H/R-induced ROS evaluated by 2',7'-dichlorofluorescin diacetate fluorescence. To assess whether ROS are really involved in H/R-induced cardiomyocyte injury, the amount of creatine phosphokinase in cultured medium was examined. Both LIF treatment and caSTAT3 significantly decreased H/R-induced creatine phosphokinase release. These results indicate that the gp130/STAT3 signal protects H/R-induced cardiomyocyte injury by scavenging ROS generation. To investigate the mechanism of scavenging ROS, the effects of LIF on the induction of antioxidant enzymes were examined. LIF treatment significantly increased the expression of manganese superoxide dismutase (MnSOD) mRNA, whereas the expression of the catalase and glutathione peroxidase genes were unaffected. This induction of MnSOD mRNA expression was completely blocked by adenovirus-mediated transfection of dominant-negative STAT3. Moreover, caSTAT3 augmented MnSOD mRNA and its enzyme activity. In addition, the antisense oligodeoxyribonucleotide to MnSOD significantly inhibited both LIF and caSTAT3-mediated protective effects.

Conclusions— The activation of STAT3 induces a protective effect on H/R-induced cardiomyocyte damage, mainly by inducting MnSOD. The STAT3-mediated signal is proposed as a therapeutical target of ROS-induced cardiomyocyte injury.


Key Words: antioxidants • hypoxia • signal transduction


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
In the heart, it has been reported that reactive oxygen species (ROS) contribute to cardiac dysfunction and myocardial damage under a variety of conditions, such as ischemia-reperfusion, congestive heart failure, and doxorubicin-induced cardiomyopathy.13 Recent studies have shown that gp130-mediated signals transduced both cytoprotective and hypertrophic responses in the heart.4 The signal transducer and activator of transcription-3 (STAT3) is a key molecule downstream of gp130, which is activated under various stressful conditions, such as pressure-overload and myocardial infarction.4 Transgenic mice with cardiac-specific overexpression of the STAT3 gene are protected against doxorubicin-induced cardiomyopathy.5 Therefore, the activation of STAT3 might induce a protective effect against oxidative stress–induced cardiomyocyte damage by scavenging ROS.

In the present study, we explored whether the gp130/STAT3 signal has a protective function against hypoxia/reoxygenation (H/R)–induced cardiomyocyte damage.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Cell Culture and H/R Experiments
Primary cultures of neonatal rat cardiomyocytes were prepared from the ventricles of 1-day-old Sprague-Dawley rats (Kiwa Dobutsu Wakayama, Japan), as previously described.6 Hypoxia was created by incubating cells in an airtight Plexiglas chamber with <1% O2 and 5% CO2/95% N2 at 37°C for 2 hours using Gas Pak Plus (BBL). By replacing the medium saturated with 95% air and 5% CO2, the cells were exposed to normoxic atmosphere (reoxygenation). Antisense oligodeoxyribonucleotides (ODN) corresponding to the initiation sites of manganese superoxide dismutase (MnSOD) translation (22 mer: CACGCCGCCCGACACAACATTG; 1.0 µmol/L) or sense ODN at the same site (22 mer: CAATGTTGTGTCGGGCGGCGTG; 1.0 µmol/L) were added to the cultured medium 18 hours before hypoxia until 24 hours after reoxygenation.7

Generation of Recombinant Adenovirus and Protocol of Adenovirus Infection
The recombinant replication-defective adenovirus expressing a dominant-negative form of STAT3 and constitutively activated STAT3 (caSTAT3), which were kindly provided by Drs J.F. Bromberg and J.E. Darnell, Jr (Laboratory of Molecular Cell Biology, The Rockefeller University, New York, NY),8 were prepared as described previously.6,9,10 Adenovirus vector expressing ß-galactosidase (ß-gal) was used as a control.

Analysis of Intracellular ROS Generation
The fluorescent probe, 2',7'-dichlorofluorescin diacetate (DCF-DA), was used to assess intracellular ROS formation in cultured rat cardiomyocytes, as previously described.11

Northern Blot Analysis and Western Blot Analysis
Northern and Western blotting were performed as previously described.6 Specific cDNA probes for the detection of MnSOD, catalase, and glutathione peroxidase gene transcripts were reported previously.12

Measurement of MnSOD Activity
MnSOD activity was determined by the nitroblue tetrazolium method.7

Measurement of Creatine Phosphokinase
Creatine phosphokinase (CPK) activity in the culture medium was measured by the MERCK-1-TEST CK kit (Kantou Kagaku Co).13

Statistical Analysis
Statistical analysis was performed by Student’s t test and 1-way ANOVA followed by Bonferroni collection for multiple group comparisons. P<0.05 was considered significant.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Activation of Gp130/STAT3 Protects Cardiomyocytes from H/R Injury by Scavenging ROS
To examine the effects of leukemia inhibitory factor (LIF) or caSTAT3 on the intracellular ROS formation induced by H/R, DCF-DA was used as a fluorescent probe. Both LIF treatment and caSTAT3 significantly suppressed the generation of ROS induced by H/R (Figure 1A). Furthermore, they both significantly decreased H/R-induced CPK release (Figure 1B). These results indicate that the gp130/STAT3 signal protects H/R-induced cardiomyocytes injury by scavenging ROS generation.



View larger version (33K):
[in this window]
[in a new window]
 
Figure 1. Activation of gp130/STAT3 protects cardiomyocytes from H/R injury by scavenging ROS. A, LIF-treated (preincubated with 103 units/mL LIF for 6 hours) or caSTAT3-transfected cardiomyocytes were subjected to H/R (2 hours of ischemia and 24 hours of reoxygenation), and incubated with DCF-DA (5 µmol/L) for 30 minutes. Two fields were randomly selected in each well and were examined for each condition. Representative cardiomyocytes observed by laser confocal microscopy are shown. Con indicates control. B, Cardiomyocytes were treated with LIF (preincubated with 103 units/mL of LIF for 6 hours) or transfected with ß-gal or caSTAT3. CPK activity in the culture medium was measured after H/R. Data are mean±SEM from 3 experiments. *P<0.05 vs ß-gal without H/R; #P<0.05 vs ß-gal with H/R.

The Protective Effects of STAT3 Are Involved in the Upregulation of MnSOD
To explore the mechanism of protection against ROS, the effects of LIF on the induction of 3 important myocardial antioxidant enzymes (ie, MnSOD, catalase, and glutathione peroxidase) were examined. LIF treatment resulted in a significant increase of MnSOD mRNA level from 1 hour that continued for up to 24 hours, whereas the expressions of catalase and glutathione peroxidase mRNAs were unchanged throughout the time points examined (Figure 2A). Figure 2B shows the dose-dependent effect of LIF on the induction of MnSOD mRNA expression. These effects of LIF were inhibited by dominant-negative form of STAT3 (Figure 2C). Furthermore, significant enhancement of MnSOD mRNA expression was detected with caSTAT3, and this was accompanied by an increase in its enzyme activity. Thus, STAT3 is considered essential for LIF-induced MnSOD expression.



View larger version (46K):
[in this window]
[in a new window]
 
Figure 2. LIF and caSTAT3 protect from cardiomyocyte injury after H/R through the induction of MnSOD. A, Cardiomyocytes were treated with LIF (103 U/mL) and harvested at the indicated time points. MnSOD, catalase (Cat), and glutathione peroxidase (GPX) mRNA expressions were examined by Northern blot analysis. 18S indicates 18S ribosomal RNA. The results are representative of 3 similar experiments. B, Cardiomyocytes were stimulated with various concentrations of LIF for 3 hours. MnSOD mRNA expression was examined by Northern blot analysis. The results are representative of 3 similar experiments. C, Cardiomyocytes were transfected with adenovirus vectors expressing a dominant-negative form of STAT3 (dnSTAT3), caSTAT3, or ß-gal and stimulated with LIF (103 U/mL) for 3 hours. MnSOD mRNA expression was examined by Northern blot analysis. After cardiomyocytes were stimulated with LIF (103 U/mL) for 6 hours, MnSOD enzyme activity was determined as described in Methods. Data are presented as mean±SEM from 3 samples. *P<0.05 vs ß-gal without LIF stimulation; #P<0.05 vs ß-gal with LIF treatment. D, Sense or antisense ODN (1.0 µmol/L) were applied to LIF-treated (preincubated with 103 U/mL LIF for 6 hours) or ß-gal– or caSTAT3-transfected cardiomyocytes for18 hours before H/R. CPK activity in the culture medium was measured after H/R. Data are mean±SEM from 3 experiments. *P<0.05 vs LIF with sense ODN; #P<0.05 vs caSTAT3 with sense ODN.

To evaluate whether the increase in MnSOD activity is indeed directly related to the protective effect of STAT3, antisense ODN against the MnSOD gene were used. Antisense ODN completely cancelled both LIF and caSTAT3-induced MnSOD activities, and sense ODN did not affect our experiments (data not shown). As shown in Figure 2D, these beneficial effects of LIF and caSTAT3 on CPK release were significantly decreased in the presence of antisense ODN. Thus, the protective effects of STAT3 against H/R are mainly related to the induction of MnSOD activity.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
The major new finding in the present study is that STAT3 activation protects cardiomyocytes against ROS caused by H/R through the upregulation of the MnSOD gene and its enzyme activity.

Endotoxin and cytokines such as tumor necrosis factor-{alpha}, interleukin-1ß, and interluekin-6 are known to induce MnSOD, and several studies have confirmed the cardioprotective role of MnSOD.1416 In view of the transcriptional regulation, 3 interferon-{gamma} activation site motifs (TTCCTCTAA, TTCCTCAA, and TTACATCAA) that are bound with activated STAT3 were identified in the region spanning from –2505 to –1104 in the MnSOD promoter region.17,18 This suggests that LIF induce MnSOD mRNA expression mainly via the STAT3 binding cis-element in cardiac myocytes. It remains to be identified which motifs of the 3 discussed above are the most important for the induction of the MnSOD gene.

To clarify the role of MnSOD in H/R, we used an antisense strategy to suppress MnSOD induction.7 The responses to the pretreatment with antisense ODN in caSTAT3- or LIF-treated cells were different. The protective effects observed in caSTAT3 transduction were nearly completely abolished with antisense ODN, whereas the protective effects by LIF were not completely abolished with antisense ODN. These results suggest that induction of MnSOD by caSTAT3 is essential for caSTAT3-induced protection in H/R. The genes related to cardiac protection, such as the atrial natriuretic factor and vascular endothelial growth factor genes, increased in the hearts with cardiac-specific overexpression of STAT3; however, these genes have little effect on this condition.5 However, LIF stimulation induces other anti-apoptotic molecules, such as Bcl-xL and Bcl-2, and also activates phosphatidylinositol 3 kinase-Akt and mitogen-activated protein kinase pathways, which would be involved in a protective effect against ROS.4,19,20 Therefore, LIF presents more protective effects than STAT3 by inducing other protective factors besides MnSOD.

We propose that the activation of STAT3 could be a therapeutic strategy for cardiac protection against ROS-mediated cytotoxicity in several pathological conditions.


*    Acknowledgments
 
This study was supported by a Grant-in-Aid for Scientific Research from the Ministry of Education, Science, and Culture of Japan; grants from the Ministry of Health and Welfare of Japan; and the Takeda Science Foundation. We thank Jurei Hironaka for her secretarial assistance.

Received April 30, 2001; revision received July 9, 2001; accepted July 10, 2001.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Bolli R. Oxgen-derived free radicals and postischemic myocardial dysfunction "stunned myocardium". J Am Coll Cardiol. 1988; 12: 239–249.[Abstract]

2. Singh N, Dhalla AK, Seneviratne C, et al. Oxidative stress and heart failure. Mol Cell Biochem. 1995; 147: 77–81.[Medline] [Order article via Infotrieve]

3. Myers CE, McGuire WP, Liss RH, et al. Adriamycin: the role of lipid peroxidation in cardiac toxicity and tumor response. Science. 1984; 226: 466–468.[Abstract/Free Full Text]

4. Yamauchi-Takihara K, Kishimoto T. Cytokines and their receptors in cardiovascular diseases-role of gp130 signaling pathway in cardiac myocyte growth and maintenance. Int J Exp Pathol. 2000; 81: 1–16.[Medline] [Order article via Infotrieve]

5. Kunisada K, Negoro S, Tone E, et al. Signal transducer and activator of transcription 3 in the heart transduces not only a hypertrophic signal but a protective signal against doxorubicin-induced cardiomyopathy. Proc Natl Acad Sci U S A. 2000; 97: 315–319.[Abstract/Free Full Text]

6. Kunisada K, Tone E, Fujio Y, et al. Activation of gp130 transduces hypertrophic signals via STAT3 in cardiac myocytes. Circulation. 1998; 98: 346–352.[Abstract/Free Full Text]

7. Yamashita N, Nishida M, Hoshida S, et al. Induction of manganese superoxide dismutase in rat cardiac myocytes increases tolerance to hypoxia 24 hours after preconditioning. J Clin Invest. 1994; 94: 2193–2199.

8. Bromberg JF, Wrzeszczynska MH, Devgan G, et al. STAT3 as an oncogene. Cell. 1999; 98: 295–230.[Medline] [Order article via Infotrieve]

9. Fujio Y, Guo K, Mano T, et al. Cell cycle withdrawal promotes myogenic induction of Akt, a positive modulator of myocyte survival. Mol Cell Biol. 1999; 19: 5073–5082.[Abstract/Free Full Text]

10. Becker TC, Noel RJ, Coats WS, et al. Use of recombinant adenovirus for metabolic engineering of mammalian cells. Methods Cell Biol. 1994; 43: 161–189.

11. Luo JD, Xie F, Zhang WW, et al. Simvastatin inhibits noradrenaline-induced hypertrophy of cultured neonatal rat cardiomyocytes. Br J Phamacol. 2001; 132: 159–164.[Medline] [Order article via Infotrieve]

12. Dieterich S, Bieligk U, Beulich K, et al. Gene expression of antioxidative enzymes in the human heart: increased expression of catalase in the end-stage failing heart. Circulation. 2000; 101: 33–39.[Abstract/Free Full Text]

13. Gerhardt W. Creatine kinase.In: Bergmeyer HU, ed. Methods of Enzymatic Analysis. 3rd ed. Weinheim: Verlag Chemie; 1983: 508–539.

14. Shiki Y, Meyrick BO, Brigham KL, et al. Endotoxin increased superoxide dismutase in cultured bovine pulmonary endothelial cells. Am J Physiol. 1987; 252: C436–C440.[Abstract/Free Full Text]

15. Tsan MF, White JE, Treanor C, et al. Molecular basis for tumor necrosis factor-induced increase in pulmonary superoxide dismutase activities. Am J Physiol. 1990; 259: L506–L512.[Abstract/Free Full Text]

16. Masuda A, Longo DL, Kobayashi Y, et al. Induction of mitochondrial manganese superoxide dismutase by interleukin 1. FASEB J. 1988; 2: 3087–3091.[Abstract]

17. Dougall WC, Nick HS. Manganese superoxide dismutase: a hepatic acute phase protein regulated by interleukin-6 and glucocorticoids. Endocrinology. 1991; 129: 2376–2384.[Abstract/Free Full Text]

18. Ihle JN. STATs: signal transducers and activators of transcription. Cell. 1996; 84: 331–333.[Medline] [Order article via Infotrieve]

19. Wang X, McCullough KD, Franke TF, et al. Epidermal growth factor receptor-dependent Akt activation by oxidative stress enhances cell survival. J Biol Chem. 2000; 275: 14624–14631.[Abstract/Free Full Text]

20. Aikawa R, Komuro I, Yamazaki T, et al. Oxidative stress activates extracellular signal-regulated kinase through Src and Ras in cultured cardiac myocytes of neonatal rats. J Clin Invest. 1997; 100: 1813–1821.[Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
Cardiovasc ResHome page
M. A. Frias, S. Somers, C. Gerber-Wicht, L. H. Opie, S. Lecour, and U. Lang
The PGE2-Stat3 interaction in doxorubicin-induced myocardial apoptosis
Cardiovasc Res, October 1, 2008; 80(1): 69 - 77.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Pincheira, A. F. Castro, O. N. Ozes, P. S. Idumalla, and D. B. Donner
Type 1 TNF Receptor Forms a Complex with and Uses Jak2 and c-Src to Selectively Engage Signaling Pathways That Regulate Transcription Factor Activity
J. Immunol., July 15, 2008; 181(2): 1288 - 1298.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z. Guo, H. Jiang, X. Xu, W. Duan, and M. P. Mattson
Leptin-mediated Cell Survival Signaling in Hippocampal Neurons Mediated by JAK STAT3 and Mitochondrial Stabilization
J. Biol. Chem., January 18, 2008; 283(3): 1754 - 1763.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. Wang, W. Zhang, P. Crisostomo, T. Markel, K. K. Meldrum, X. Y. Fu, and D. R. Meldrum
Endothelial STAT3 plays a critical role in generalized myocardial proinflammatory and proapoptotic signaling
Am J Physiol Heart Circ Physiol, October 1, 2007; 293(4): H2101 - H2108.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
M. Wang, W. Zhang, P. Crisostomo, T. Markel, K. K. Meldrum, X. Y. Fu, and D. R. Meldrum
Sex differences in endothelial STAT3 mediate sex differences in myocardial inflammation
Am J Physiol Endocrinol Metab, September 1, 2007; 293(3): E872 - E877.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J.-X. Chen, H. Zeng, Q.-H. Tuo, H. Yu, B. Meyrick, and J. L. Aschner
NADPH oxidase modulates myocardial Akt, ERK1/2 activation, and angiogenesis after hypoxia-reoxygenation
Am J Physiol Heart Circ Physiol, April 1, 2007; 292(4): H1664 - H1674.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
D. Hilfiker-Kleiner, U. Landmesser, and H. Drexler
Molecular Mechanisms in Heart Failure: Focus on Cardiac Hypertrophy, Inflammation, Angiogenesis, and Apoptosis
J. Am. Coll. Cardiol., October 27, 2006; 48(9_Suppl_A): A56 - A66.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
X. Zhang, P. Shan, G. Jiang, S. S-M. Zhang, L. E. Otterbein, X.-Y. Fu, and P. J. Lee
Endothelial STAT3 is essential for the protective effects of HO-1 in oxidant-induced lung injury
FASEB J, October 1, 2006; 20(12): 2156 - 2158.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
E. R. Gross, A. K. Hsu, and G. J. Gross
The JAK/STAT pathway is essential for opioid-induced cardioprotection: JAK2 as a mediator of STAT3, Akt, and GSK-3beta
Am J Physiol Heart Circ Physiol, August 1, 2006; 291(2): H827 - H834.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
K. L. Butler, L. C. Huffman, S. E. Koch, H. S. Hahn, and J. K. Gwathmey
STAT-3 activation is necessary for ischemic preconditioning in hypertrophied myocardium
Am J Physiol Heart Circ Physiol, August 1, 2006; 291(2): H797 - H803.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Mohri, Y. Fujio, M. Maeda, T. Ito, T. Iwakura, Y. Oshima, Y. Uozumi, M. Segawa, H. Yamamoto, T. Kishimoto, et al.
Leukemia Inhibitory Factor Induces Endothelial Differentiation in Cardiac Stem Cells
J. Biol. Chem., March 10, 2006; 281(10): 6442 - 6447.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
M. Masaki, M. Izumi, Y. Oshima, Y. Nakaoka, T. Kuroda, R. Kimura, S. Sugiyama, K. Terai, M. Kitakaze, K. Yamauchi-Takihara, et al.
Smad1 Protects Cardiomyocytes From Ischemia-Reperfusion Injury
Circulation, May 31, 2005; 111(21): 2752 - 2759.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
N. R. Madamanchi, S.-K. Moon, Z. S. Hakim, S. Clark, A. Mehrizi, C. Patterson, and M. S. Runge
Differential Activation of Mitogenic Signaling Pathways in Aortic Smooth Muscle Cells Deficient in Superoxide Dismutase Isoforms
Arterioscler. Thromb. Vasc. Biol., May 1, 2005; 25(5): 950 - 956.
[Abstract] [Full Text] [PDF]


Home page
J. Thorac. Cardiovasc. Surg.Home page
M. F. Berry, T. J. Pirolli, V. Jayasankar, K. J. Morine, M. A. Moise, O. Fisher, T. J. Gardner, P. H. Patterson, and Y. J. Woo
Targeted overexpression of leukemia inhibitory factor to preserve myocardium in a rat model of postinfarction heart failure
J. Thorac. Cardiovasc. Surg., December 1, 2004; 128(6): 866 - 875.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
E. Suganami, H. Takagi, H. Ohashi, K. Suzuma, I. Suzuma, H. Oh, D. Watanabe, T. Ojima, T. Suganami, Y. Fujio, et al.
Leptin Stimulates Ischemia-Induced Retinal Neovascularization: Possible Role of Vascular Endothelial Growth Factor Expressed in Retinal Endothelial Cells
Diabetes, September 1, 2004; 53(9): 2443 - 2448.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
R. M. Smith, N. Suleman, L. Lacerda, L. H. Opie, S. Akira, K. R. Chien, and M. N. Sack
Genetic depletion of cardiac myocyte STAT-3 abolishes classical preconditioning
Cardiovasc Res, September 1, 2004; 63(4): 611 - 616.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
D. Hilfiker-Kleiner, A. Hilfiker, M. Fuchs, K. Kaminski, A. Schaefer, B. Schieffer, A. Hillmer, A. Schmiedl, Z. Ding, E. Podewski, et al.
Signal Transducer and Activator of Transcription 3 Is Required for Myocardial Capillary Growth, Control of Interstitial Matrix Deposition, and Heart Protection From Ischemic Injury
Circ. Res., July 23, 2004; 95(2): 187 - 195.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
J. Trial, R. D. Rossen, J. Rubio, and A. A. Knowlton
Inflammation and Ischemia: Macrophages Activated by Fibronectin Fragments Enhance the Survival of Injured Cardiac Myocytes
Experimental Biology and Medicine, June 1, 2004; 229(6): 538 - 545.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
R. Lai, G. Z. Rassidakis, L. J. Medeiros, L. Ramdas, A. H. Goy, C. Cutler, Y. Fujio, K. Kunisada, H. M. Amin, and F. Gilles
Signal Transducer and Activator of Transcription-3 Activation Contributes to High Tissue Inhibitor of Metalloproteinase-1 Expression in Anaplastic Lymphoma Kinase-Positive Anaplastic Large Cell Lymphoma
Am. J. Pathol., June 1, 2004; 164(6): 2251 - 2258.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
D. Hedley, M. Pintilie, J. Woo, T. Nicklee, A. Morrison, D. Birle, A. Fyles, M. Milosevic, and R. Hill
Up-Regulation of the Redox Mediators Thioredoxin and Apurinic/Apyrimidinic Excision (APE)/Ref-1 in Hypoxic Microregions of Invasive Cervical Carcinomas, Mapped Using Multispectral, Wide-Field Fluorescence Image Analysis
Am. J. Pathol., February 1, 2004; 164(2): 557 - 565.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. J. Jacoby, A. Kalinowski, M.-G. Liu, S. S.-M. Zhang, Q. Gao, G.-X. Chai, L. Ji, Y. Iwamoto, E. Li, M. Schneider, et al.
Cardiomyocyte-restricted knockout of STAT3 results in higher sensitivity to inflammation, cardiac fibrosis, and heart failure with advanced age
PNAS, October 28, 2003; 100(22): 12929 - 12934.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. Taler, S. Shpungin, Y. Salem, H. Malovani, O. Pasder, and U. Nir
Fer Is a Downstream Effector of Insulin and Mediates the Activation of Signal Transducer and Activator of Transcription 3 in Myogenic Cells
Mol. Endocrinol., August 1, 2003; 17(8): 1580 - 1592.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
E. K. Podewski, D. Hilfiker-Kleiner, A. Hilfiker, H. Morawietz, A. Lichtenberg, K. C. Wollert, and H. Drexler
Alterations in Janus Kinase (JAK)-Signal Transducers and Activators of Transcription (STAT) Signaling in Patients With End-Stage Dilated Cardiomyopathy
Circulation, February 18, 2003; 107(6): 798 - 802.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
D. C.H Ng, N. W Court, C. G dos Remedios, and M. A Bogoyevitch
Activation of signal transducer and activator of transcription (STAT) pathways in failing human hearts
Cardiovasc Res, February 1, 2003; 57(2): 333 - 346.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
R. M Smith, S. Lecour, and M. N Sack
Innate immunity and cardiac preconditioning: a putative intrinsic cardioprotective program
Cardiovasc Res, August 15, 2002; 55(3): 474 - 482.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
W. Briest
Do we have a new early marker of chronic transplant dysfunction now?
Cardiovasc Res, June 1, 2002; 54(3): 492 - 494.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Negoro, S.
Right arrow Articles by Yamauchi-Takihara, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Negoro, S.
Right arrow Articles by Yamauchi-Takihara, K.
Related Collections
Right arrow Oxidant stress