| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Circulation. 2002;105:1440.)
© 2002 American Heart Association, Inc.
Gene Variants Influence Progression of Coronary Atherosclerosis and Risk of Coronary Artery Disease
From the Centre for Cardiovascular Genetics, Department of Medicine, Royal Free and University College of London Medical School, London, UK (D.M.F., Y.J., E.H., S.E.H., P.J.T.); U.325 INSERM, Département dAthérosclérose, Institut Pasteur, Lille, France (I.P.T., B.S.); the Department of Medicine, Helsinki University Central Hospital, Helsinki, Finland (M.-R.T., M.H.F., M.S.N., M.S.); the Department of Medicine, University of Oulu, Oulu, Finland (Y.A.K.); the Department of Medicine, Tampere University Hospital, Tampere, Finland (A.P.); and Medical Research Council Epidemiology and Medical Care Unit, Wolfson Institute of Preventive Medicine, The Medical College of St Bartholomews Hospital, London, UK (G.M.).
Correspondence to David M. Flavell, Centre for Cardiovascular Genetics, Department of Medicine, Royal Free and University College of London Medical School, Rayne Building, 5 University St, London WC1E 6JJ, UK. E-mail d.flavell{at}ucl.ac.uk
| Abstract |
|---|
|
|
|---|
(PPAR
) regulates the expression of genes involved in lipid metabolism and inflammation, making it a candidate gene for atherosclerosis and ischemic heart disease (IHD).
Methods and Results We investigated the association between the leucine 162 to valine (L162V) polymorphism and a G to C transversion in intron 7 of the PPAR
gene and progression of atherosclerosis in the Lopid Coronary Angiography Trial (LOCAT), a trial examining the effect of gemfibrozil treatment on progression of atherosclerosis after bypass surgery and on risk of IHD in the second Northwick Park Heart Study (NPHS2), a prospective study of healthy middle-aged men in the United Kingdom. There was no association with plasma lipid concentrations in either study. Both polymorphisms influenced progression of atherosclerosis and risk of IHD. V162 allele carriers had less progression of diffuse atherosclerosis than did L162 allele homozygotes with a similar trend for focal atherosclerosis. Intron 7 C allele carriers had greater progression of atherosclerosis than did G allele homozygotes. The V162 allele attenuated the proatherosclerotic effect of the intron 7 C allele. Homozygotes for the intron 7 C allele had increased risk of IHD, an effect modulated by the L162V polymorphism
Conclusions The PPAR
gene affects progression of atherosclerosis and risk of IHD. Absence of association with plasma lipid concentrations suggests that PPAR
affects atherosclerotic progression directly in the vessel wall.
Key Words: atherosclerosis genetics coronary disease
| Introduction |
|---|
|
|
|---|
(PPAR
) is a member of the nuclear hormone receptor superfamily of ligand-activated transcription factors.2 Ligands for PPAR
include fatty acids, eicosanoids, and the fibrate class of hypolipidemic drugs.3 PPAR
regulates the expression of genes involved in lipid metabolism, and fibrate treatment causes a dramatic decrease in triglycerides, a lesser decrease in LDL cholesterol, and an increase in HDL cholesterol, producing a less atherogenic lipid phenotype.4 PPAR
is expressed at high levels in liver, heart, skeletal muscle, and kidney,5 tissues that catabolize fatty acids.
PPAR
also regulates proatherosclerotic processes in the vessel wall. PPAR
is expressed in endothelial cells6 and smooth muscle cells7 and in monocyte/macrophages in the circulation8 and in atherosclerotic plaques.9 In these cell types, PPAR
regulates the expression of genes influencing monocyte recruitment (monocyte chemotactic protein-1,10 endothelin11), adhesion (vascular cell adhesion model-1 [VCAM-1]12,13) and transmigration (matrix metalloproteinase-9 [MMP-9]14), foam cell formation (SR-BI9), reverse cholesterol transport (liver X receptor
[LXR
], ATP binding cassette transporter 1 [ABCA1]15), and thrombogenicity (tissue factor16,17).
PPAR
also may influence atherosclerosis through antiinflammatory properties. PPAR
inhibits the activator protein (AP-1)11,18 and nuclear factor-
B7,11,18,19 inflammatory cytokine signaling pathways. Fenofibrate lowers plasma concentrations of proinflammatory cytokines.7,20 PPAR
knockout mice have a greater18,21 inflammatory response. Oxidative stress also influences atherosclerosis.22 PPAR
activators reduce oxidative stress,23 and PPAR
knockout mice have higher levels of proinflammatory cytokines and lipid peroxides.19
Fibrates reduced the progression of coronary atherosclerosis in the Bezafibrate Coronary Atherosclerosis Trial (BECAIT) and the Lopid Coronary Angiography Trial (LOCAT) and reduced the incidence of coronary artery disease in the Helsinki Heart Study and Veterans Administration HDL-cholesterol Intervention Trial (VA-HIT).24 Thus, PPAR
is expressed in cell types involved in atherosclerosis, and PPAR
activators have pleiotropic beneficial effects on proatherosclerotic factors. To investigate the role of PPAR
in human atherosclerosis, we examined the association between two polymorphisms in the PPAR
gene, the functional leucine 162 to valine (L162V) variant25,26 and a novel polymorphism in intron 7, and progression of atherosclerosis in LOCAT, a trial examining the effect of gemfibrozil treatment on progression of atherosclerosis in Finnish patients with CABG and low HDL27 and in the second Northwick Park Heart Study (NPHS2), a prospective study examining the risk of heart disease in healthy middle-aged men in the United Kingdom.28
| Methods |
|---|
|
|
|---|
70 years old with HDL cholesterol
1.1 mmol/L, LDL cholesterol
4.5 mmol/L, and triglycerides
4.0 mmol/L entered the study (baseline characteristics are shown in Table 1). Current smokers and subjects with severe hypertension, obesity, history of diabetes, or fasting glucose concentration >7.8 mmol/L were excluded. Patients had undergone coronary artery bypass surgery and were treated with placebo or gemfibrozil (1200 mg/d) (Parke Davis) for 2.5 years.27 Coronary angiography was performed at baseline and on average at 32 months after therapy commencement. Cholesterol and triglyceride concentrations were determined in LDL and HDL subfractions.29 Angiographic images were analyzed with a computer-assisted quantitative method.30 Diffuse atherosclerosis is defined as a change in average diameter of coronary segments (
ADS) from baseline to follow-up angiogram. Focal atherosclerosis is a change in minimum luminal diameter (
MLD) of stenoses. Of subjects with L162V genotype, 302 had
ADS data and 297 subjects had
MLD data. For those with intron 7 genotype, 283 had
ADS and 278 had
MLD data.
|
The Second Northwick Park Heart Study (NPHS2) is a prospective study of ischemic heart disease (IHD) in 3012 middle-aged (50 to 61 years) healthy men in the United Kingdom over a period of 7 years (see Table 1 for baseline characteristics). Exclusion criteria included history of type 2 diabetes, unstable angina, or previous myocardial infarction or stroke.28 Plasma concentrations of cholesterol, HDL cholesterol, triglycerides, apolipoprotein (apo)AI, and apoB were determined. "Ischemic events" is a measure of acute myocardial infarction (n=136), silent myocardial infarction (n=21), or coronary surgery (n=34).
Detection of the Intron 7 and L162V Polymorphism
The intron 7 polymorphism was reported as a TaqI restriction fragment length polymorphism.31 Human PPAR
genomic sequence (Genbank AL078611) indicated that the polymorphism was situated in a TaqI fragment spanning exon 7. TaqI digestion of polymerase chain reaction (PCR) products revealed a polymorphic site, and sequencing revealed a G to C transversion at nt 2498 of intron 7 (nt 16669 of complementary strand of Genbank AL078611), 396 nt from the 3' end of intron 7. Intron 7 PCR primers were forward ACAATCACTCCTTAAATATGGTGG, reverse AAGTAGGGACAGACAGGACCAGTA, generating a fragment of 266bp digested by TaqI to 216bp and 50bp. PCR reactions were performed in 10 µL containing 1x buffer (16 mmol/L [NH4]2SO4/67 mmol/L Tris, pH 8.4/0.01% Tween 20/0.02 mmol/L each dNTP), 2 mmol/L MgCl2, 8 pmol each primer, 0.1 U Taq polymerase. TaqI digestion was performed by adding 3 U of TaqI (Helena), 1.5 µL restriction enzyme buffer in a volume of 5 µL, and incubation for 4 hours at 65°C. L162V polymorphism genotyping has been previously described.25
Statistical Analysis
The maximum number of genotypes available for each parameter was used in analysis. Polymorphisms were checked for deviation from Hardy-Weinberg equilibrium by means of the
2 test. Allelic association was estimated by means of the Estimate Haplotype program. In LOCAT, the relation between baseline lipid levels, change in lipid levels on treatment, and PPAR
genotype was examined by t test or ANOVA. Triglycerides were log-transformed. Multivariate ANOVA was used to control for baseline levels of ADS or MLD, time between the baseline and follow-up angiograms, and randomized therapy. Results are reported as unadjusted and adjusted least-squares mean±SEM.
In NPHS2, statistical analysis was conducted with intercooled STATA version 6.0. Body mass index (BMI), systolic blood pressure, triglycerides, and fibrinogen were log-transformed. One-way ANOVA was used to assess the effect of genotype on baseline characteristics. Survival analysis was carried out with Cox proportional hazards model, with significance assessed by the likelihood ratio test. Adjustment was performed for age, BMI, smoking status, systolic blood pressure, fibrinogen, and cholesterol. Because of the low numbers of individuals with L162V VV genotype, genotypes LV and VV were combined.
| Results |
|---|
|
|
|---|
=0.32, P<0.01) and NPHS2 (
=0.34, P<0.0001). Estimated haplotype frequencies are shown in Table 2.
|
The association between the PPAR
gene polymorphisms and plasma lipid concentrations at baseline and change in plasma lipid concentrations after gemfibrozil treatment was examined. There were no significant differences in plasma lipid concentrations in either study (Table 3) or in the change in plasma lipids in response to gemfibrozil in LOCAT (not shown) by PPAR
genotype.
|
Association between PPAR
polymorphisms and progression of atherosclerosis was examined. Compared with L162 homozygotes, V162 allele carriers had significantly reduced progression of diffuse atherosclerosis in native coronary arteries (LL, 0.026±0.006 mm, n=284; LV, 0.032± 0.025 mm, n=18; P=0.022) (Figure 1). In multivariate ANOVA, adjusting for baseline ADS, time between angiograms, and treatment, the effect remained significant (P=0.049). The effect was similar in the placebo and treated groups, with no evidence of interaction between genotype and treatment. Moreover, the LV genotype showed a protective influence against progression of focal atherosclerosis in coronary arteries (
MLD) (LL, 0.073±0.010 mm, n=279, versus LV, 0.006±0.041 mm, n=18; P=0.064) (Figure 1A), which was again independent of gemfibrozil treatment. Thus, carriers of the V162 allele were protected from progression of atherosclerosis.
|
The intron 7 polymorphism also influenced the rate of progression of atherosclerosis. C allele homozygotes (n=7) were combined with C allele carriers. Carriers of the C allele showed a nonsignificant trend toward greater progression of diffuse atherosclerosis (
ADS) than G allele homozygotes (GG, -0.017±0.007 mm, n=213; GC + CC, -0.041± 0.015 mm, n=70; P=0.095) (Figure 1B). Intron 7 genotype had similar effects in both placebo and treated groups. Intron 7 genotype significantly influenced progression of focal atherosclerosis (
MLD). Carriers of the C allele had a significantly greater decrease in MLD than G allele homozygotes (GG, -0.050±0.011 mm, n=209; GC+CC, -0.115±0.019 mm, n=69; P=0.003) (Figure 1B), an effect again observed in both placebo and treated groups. Thus intron 7 C allele carriers show increased progression of atherosclerosis.
The L162V and intron 7 polymorphisms are in positive allelic association yet have opposing effects on progression of atherosclerosis. The estimated frequency of the V162-intron 7 C haplotype in LOCAT was 0.021, whereas the haplotype frequency of the V162-G haplotype was 0.006; that is, 78% of V162 alleles are on the same haplotype as the intron 7 C allele (Table 2). In a regression model, both polymorphisms showed significant effects on progression of diffuse (
ADS: constant, -0.018±0.007 mm, P=0.014; V162 allele, 0.082±0.029 mm, P=0.005; intron 7 C allele, -0.038±0.015 mm, P=0.013) and focal (
MLD: constant, -0.054±0.011 mm, P<0.001; V162 allele, 0.132±0.045 mm, P=0.003; intron 7 C allele, -0.086±0.024 mm, P<0.001) atherosclerosis (Figure 1C). In a multivariate regression model including baseline measures, time between angiogram, both PPAR
genotypes and examining for interaction between the PPAR
variants, a significant interaction was observed between PPAR
genotypes for diffuse atherosclerosis (
ADS, P=0.05), with a similar trend observed for focal atherosclerosis (
MLD P=0.07).
We investigated whether PPAR
variants influence risk of IHD in the prospective second Northwick Park Heart Study. L162V genotype did not influence risk of events in a Cox proportional hazards model adjusted for age, BMI, cholesterol, fibrinogen, smoking, and systolic blood pressure. Carriers and homozygotes for the V162 allele combined had a hazard ratio of 0.75 (95% CI, 0.45 to 1.26, P=0.28). Intron 7 C allele homozygotes showed a nonsignificant trend for greater risk of IHD, with a hazard ratio of 1.83 (95% CI, 0.96 to 3.51, P=0.07), whereas carriers of the intron 7 C allele had a hazard ratio of 1.17 (95% CI, 0.84 to 1.63, P=0.34). When intron 7 and L162V genotype combination was examined, the V162 allele again attenuated the effect of the intron 7 C allele. Individuals homozygous for the L162 allele who were carriers of the intron 7 C allele had a 26% greater hazard ratio (1.26; 95% CI, 0.88 to 1.80, P=0.21), whereas those who were also C allele homozygotes had a 2.6-fold increased hazard ratio (2.61; 95% CI, 1.27 to 5.36, P=0.009) (Table 4). Intron 7 C allele homozygotes had a 3.2-fold greater risk of IHD if they were homozygous for the L162 allele than if they were V162 allele carriers. Haplotype frequencies were significantly different between cases and healthy individuals in NPHS2 (P=0.05), with the L-C haplotype being overrepresented in cases (0.178) compared with control subjects (0.129). Conversely, the V162 allelecontaining haplotypes had a lower frequency in cases than did control subjects (V-G 0.014 in cases, 0.021in control subjects; V-C 0.032 in cases, 0.043 in control subjects) (Table 2). Kaplan-Meier survival curves are shown in Figure 2, with homozygotes for the L-C haplotype showing a significantly greater risk of IHD than combined carriers of the V162 allele, L-G haplotype homozygotes, or L-G/L-C heterozygotes. There was no interaction between PPAR
genotype and smoking, BMI, or systolic blood pressure on risk of ischemic events.
|
|
| Discussion |
|---|
|
|
|---|
gene is associated with progression of atherosclerosis and risk of IHD. Furthermore, this effect is not mediated through plasma lipid levels, suggesting that PPAR
may influence the atherosclerotic process through mechanisms involving inflammation and/or oxidative stress. This further illustrates the importance of nonlipid-mediated mechanisms in atherosclerosis and demonstrates that PPAR
influences such mechanisms in humans.
In LOCAT, both PPAR
polymorphisms were associated with progression of atherosclerosis. The V162 allele was associated with reduced progression of atherosclerosis, whereas the intron 7 C allele was associated with increased progression of atherosclerosis. The V162 allele and intron 7 C allele are in strong allelic association, such that 78% of V162 alleles are found in combination with the intron 7 C allele, and the atheroprotective V162 allele strongly attenuated the proatherosclerotic effect of the intron 7 C allele. The PPAR
intron 7 polymorphism was also associated with risk of IHD in NPHS2, and although there was no significant association with the L162V polymorphism and risk, the V162 allele again reduced the effect of the intron 7 polymorphism. The risk-associated L-C haplotype is overrepresented in subjects with IHD, whereas the V-G and V-C haplotypes are found at a lower frequency in cases than in control subjects.
Surprisingly, given the well-documented effects of fibrate treatment on plasma lipid levels, the PPAR
gene polymorphisms had no effect on plasma lipid concentrations in either study, confirming our previous findings.25 It has been reported that apoB and LDL cholesterol concentrations are higher in carriers of the V162 allele,32,33 though we did not observe such a finding, possibly because of differences in the subject selection criteria. In the LOCAT study, a similar effect of PPAR
genotype on progression of atherosclerosis was observed in both placebo and treated groups, suggesting that these variants in the PPAR
gene do not dramatically influence response to fibrate treatment, as previously observed.25,34 The absence of an association between PPAR
polymorphisms and plasma lipid levels suggests that the effect of the PPAR
polymorphisms on IHD is not plasma lipidmediated unless subtle alterations occur in plasma lipid profiles. Additionally, the risk of IHD was unchanged when plasma cholesterol levels were included in the Cox proportional hazards model.
PPAR
is also expressed in vessel wall cell types and regulates the expression of genes that influence proatherosclerotic processes in these cells. Inflammation plays a major role in both the initiation and progression of atherosclerosis,1 and PPAR
activation has antiinflammatory actions.35 PPAR
also influences oxidative stress.19,23 Thus, PPAR
polymorphisms may affect progression of atherosclerosis through inflammatory and/or oxidative stress mechanisms.
The mechanism by which the intron 7 variant influences the atherosclerotic process remains unclear. PPAR
-V162 has higher transcriptional activation in vitro.25,26 No other common missense variants have been identified in the PPAR
gene coding region.25,26,33 Given the opposing effects of the V162 allele and the intron 7 C allele and the beneficial effects of stimulation of PPAR
activity with fibrates, we hypothesize that the intron 7 C allele is associated with lower levels of PPAR
. It is unlikely that the intron 7 variant is itself functional, due to its position in an intron. However, we suggest that it is in allelic association with a functional variant in a promoter or enhancer element of the PPAR
gene that results in reduced PPAR
gene expression. Surprisingly, PPAR
knockout mice crossed with the apoE knockout mouse on an atherogenic diet show reduced aortic atherosclerosis compared with apoE knockout control mice.36
Thus, PPAR
affects factors that contribute to the atherosclerotic process, and common variation in the human PPAR
gene influences these factors. These data demonstrate the important role of PPAR
in human atherogenesis and provide genetic evidence that PPAR
has antiatherosclerotic effects in humans in vivo and so influences risk of IHD.
| Acknowledgments |
|---|
Received November 20, 2001; revision received January 18, 2002; accepted January 18, 2002.
| References |
|---|
|
|
|---|
2. Issemann I, Green S. Activation of a member of the steroid hormone receptor superfamily by peroxisome proliferators. Nature. 1990; 347: 645650.
3. Krey G, Braissant O, LHorset F, et al. Fatty acids, eicosanoids, and hypolipidemic agents identified as ligands of peroxisome proliferator-activated receptors by coactivator-dependent receptor ligand assay. Mol Endocrinol. 1997; 11: 779791.
4. Fruchart J-C, Duriez P, Staels B. Peroxisome proliferator-activated receptor-alpha activators regulate genes governing lipoprotein metabolism, vascular inflammation and atherosclerosis. Curr Opin Lipidol. 1999; 10: 245257.
5. Auboeuf D, Rieusset J, Fajas L, et al. Tissue distribution and quantification of the expression of mRNAs of peroxisome proliferator-activated receptors and liver X receptor-alpha in humans: no alteration in adipose tissue of obese and NIDDM patients. Diabetes. 1997; 46: 13191327.
6. Inoue I, Shino K, Noji S, et al. Expression of peroxisome proliferator-activated receptor alpha (PPAR alpha) in primary cultures of human vascular endothelial cells. Biochem Biophys Res Commun. 1998; 246: 370374.
7.
Staels B, Koenig W, Habib A, et al. Activation of human aortic smooth-muscle cells is inhibited by PPAR
but not by PPAR
activators. Nature. 1998; 393: 790793.
8. Chinetti G, Griglio S, Antonucci M, et al. Activation of proliferator-activated receptors alpha and gamma induces apoptosis of human monocyte-derived macrophages. J Biol Chem. 1998; 273: 2557325580.
9. Chinetti G, Gbaguidi FG, Griglio S, et al. CLA-1/SR-BI is expressed in atherosclerotic lesion macrophages and regulated by activators of peroxisome proliferator activated receptors. Circulation. 2000; 101: 24112417.
10. Zhu L, Bisgaier CL, Aviram M, et al. 9-Cis retinoic acid induces monocyte chemoattractant protein-1 secretion in human monocytic THP-1 cells. Arterioscler Thromb Vasc Biol. 1999; 19: 21052111.
11. Delerive P, Martin Nizard F, Chinetti G, et al. Peroxisome proliferator-activated receptor activators inhibit thrombin-induced endothelin-1 production in human vascular endothelial cells by inhibiting the activator protein-1 signaling pathway. Circ Res. 1999; 85: 394402.
12. Jackson SM, Parhami F, Xi XP, et al. Peroxisome proliferator-activated receptor activators target human endothelial cells to inhibit leukocyte-endothelial cell interaction. Arterioscler Thromb Vasc Biol. 1999; 19: 20942104.
13.
Marx N, Sukhova GK, Collins T, et al. PPAR
activators inhibit cytokine-induced vascular cell adhesion molecule-1 expression in human endothelial cells. Circulation. 1999; 99: 31253131.
14. Shu H, Wong B, Zhou G, et al. Activation of PPARalpha or gamma reduces secretion of matrix metalloproteinase 9 but not interleukin 8 from human monocytic THP-1 cells. Biochem Biophys Res Commun. 2000; 267: 345349.
15. Chinetti G, Lestavel S, Bocher V, et al. PPAR-alpha and PPAR-gamma activators induce cholesterol removal from human macrophage foam cells through stimulation of the ABCA1 pathway. Nat Med. 2001; 7: 5358.
16.
Neve BP, Corseaux D, Chinetti G, et al. PPAR
agonists inhibit tissue factor expression in human monocytes and macrophages. Circulation. 2001; 103: 207212.
17.
Marx N, Mackman N, Schonbeck U, et al. PPAR
activators inhibit tissue factor expression and activity in human monocytes. Circulation. 2001; 103: 213219.
18. Delerive P, De Bosscher K, Besnard S, et al. Peroxisome proliferator-activated receptor alpha negatively regulates the vascular inflammatory gene response by negative cross-talk with transcription factors NF-kappaB and AP-1. J Biol Chem. 1999; 274: 3204832054.
19. Poynter ME, Daynes RA. Peroxisome proliferator-activated receptor alpha activation modulates cellular redox status, represses nuclear factor-kappaB signaling, and reduces inflammatory cytokine production in aging. J Biol Chem. 1998; 273: 3283332841.
20. Madej A, Okopien B, Kowalski J, et al. Effects of fenofibrate on plasma cytokine concentrations in patients with atherosclerosis and hyperlipoproteinemia IIb. Int J Clin Pharmacol Ther. 1998; 36: 345349.
21. Devchand PR, Keller H, Peters JM, et al. The PPARalpha-leukotriene B4 pathway to inflammation control. Nature. 1996; 384: 3943.
22. Kunsch C, Medford RM. Oxidative stress as a regulator of gene expression in the vasculature. Circ Res. 1999; 85: 753766.
23. Inoue I, Noji S, Awata T, et al. Bezafibrate has an antioxidant effect: peroxisome proliferator- activated receptor alpha is associated with Cu2+, Zn2+-superoxide dismutase in the liver. Life Sci. 1998; 63: 135144.
24. Watts GF, Dimmitt SB. Fibrates, dyslipoproteinaemia and cardiovascular disease. Curr Opin Lipidol. 1999; 10: 561574.
25.
Flavell DM, Pineda Torra I, Jamshidi Y, et al. Variation in the PPAR
gene is associated with altered function in vitro and plasma lipid concentrations in type II diabetic subjects. Diabetologia. 2000; 43: 673680.
26.
Sapone A, Peters JM, Sakai S, et al. The human peroxisome proliferator-activated receptor
gene: identification and functional characterization of two natural allelic variants. Pharmacogenetics. 2000; 10: 321333.
27. Frick MH, Syvanne M, Nieminen MS, et al. Prevention of the angiographic progression of coronary and vein-graft atherosclerosis by gemfibrozil after coronary bypass surgery in men with low levels of HDL cholesterol: Lopid Coronary Angiography Trial (LOCAT) Study Group. Circulation. 1997; 96: 21372143.
28. Miller GJ, Bauer KA, Barzegar S, et al. Increased activation of the haemostatic system in men at high risk of fatal coronary heart disease. Thromb Haemost. 1996; 75: 767771.
29. Syvanne M, Nieminen MS, Frick MH, et al. Associations between lipoproteins and the progression of coronary and vein-graft atherosclerosis in a controlled trial with gemfibrozil in men with low baseline levels of HDL cholesterol. Circulation. 1998; 98: 19931999.
30. Syvanne M, Nieminen MS, Frick MH. Accuracy and precision of quantitative arteriography in the evaluation of coronary artery disease after coronary bypass surgery. A validation study. Int J Card Imaging. 1994; 10: 243252.
31. Sher T, Yi HF, McBride OW, et al. cDNA cloning, chromosomal mapping, and functional characterization of the human peroxisome proliferator activated receptor. Biochemistry. 1993; 32: 55985604.
32.
Vohl M-C, Lepage P, Gaudet D, et al. Molecular scanning of the human PPAR
gene: association of the L162V mutation with hyperapobetalipoproteinemia. J Lipid Res. 2000; 41: 945952.
33. Lacquemant C, Lepretre F, Pineda T, et al. Mutation screening of the PPARalpha gene in type 2 diabetes associated with coronary heart disease. Diabetes Metab. 2000; 26: 393401.
34. Jamshidi Y, Flavell DM, Hawe E, et al. Genetic determinants of the response to bezafibrate treatment in the Lower Extremity Arterial Disease Event Reduction (LEADER) trial. Atherosclerosis. In press.
35. Delerive P, Fruchart C, Staels B. Peroxisome proliferator-activated receptors in inflammation control. J Endocrinol.;. 2001; 169: 453459.
36. Tordjman K, Bernal-Mizrachi C, Zemany L, et al. PPARalpha deficiency reduces insulin resistance and atherosclerosis in apoE-null mice. J Clin Invest. 2001; 107: 10251034.
This article has been cited by other articles:
![]() |
A. Kotronen, H. Yki-Jarvinen, A. Aminoff, R. Bergholm, K. H Pietilainen, J. Westerbacka, P. J Talmud, S. E Humphries, A. Hamsten, B. Isomaa, et al. Genetic variation in the ADIPOR2 gene is associated with liver fat content and its surrogate markers in three independent cohorts Eur. J. Endocrinol., April 1, 2009; 160(4): 593 - 602. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. H. Liu, J. Li, P. Shen, B. Husna, E. S. Tai, and E. L. Yong A Natural Polymorphism in Peroxisome Proliferator-Activated Receptor-{alpha} Hinge Region Attenuates Transcription due to Defective Release of Nuclear Receptor Corepressor from Chromatin Mol. Endocrinol., May 1, 2008; 22(5): 1078 - 1092. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. R. Babaev, H. Ishiguro, L. Ding, P. G. Yancey, D. E. Dove, W. J. Kovacs, C. F. Semenkovich, S. Fazio, and M. F. Linton Macrophage Expression of Peroxisome Proliferator Activated Receptor-{alpha} Reduces Atherosclerosis in Low-Density Lipoprotein Receptor Deficient Mice Circulation, September 18, 2007; 116(12): 1404 - 1412. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Tanaka, J. M. Ordovas, J. Delgado-Lista, F. Perez-Jimenez, C. Marin, P. Perez-Martinez, P. Gomez, and J. Lopez-Miranda Peroxisome proliferator-activated receptor {alpha} polymorphisms and postprandial lipemia in healthy men J. Lipid Res., June 1, 2007; 48(6): 1402 - 1408. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Gilde, J.-C. Fruchart, and B. Staels Peroxisome Proliferator-Activated Receptors at the Crossroads of Obesity, Diabetes, and Cardiovascular Disease J. Am. Coll. Cardiol., October 27, 2006; 48(9_Suppl_A): A24 - A32. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Flavell, H. Ireland, J. W. Stephens, E. Hawe, J. Acharya, H. Mather, S. J. Hurel, and S. E. Humphries Peroxisome Proliferator-Activated Receptor {alpha} Gene Variation Influences Age of Onset and Progression of Type 2 Diabetes Diabetes, February 1, 2005; 54(2): 582 - 586. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q H Khan, D E Pontefract, S Iyengar, and S Ye Evidence of differing genotypic effects of PPAR{alpha} in women and men J. Med. Genet., June 1, 2004; 41(6): e79 - e79. [Full Text] [PDF] |
||||
![]() |
N. Marx, H. Duez, J.-C. Fruchart, and B. Staels Peroxisome Proliferator-Activated Receptors and Atherogenesis: Regulators of Gene Expression in Vascular Cells Circ. Res., May 14, 2004; 94(9): 1168 - 1178. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Talmud, S. Martin, M.-R. Taskinen, M. H. Frick, M. S. Nieminen, Y. A. Kesaniemi, A. Pasternack, S. E. Humphries, and M. Syvanne APOA5 gene variants, lipoprotein particle distribution, and progression of coronary heart disease: results from the LOCAT study J. Lipid Res., April 1, 2004; 45(4): 750 - 756. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Humphries, P. M. Ridker, and P. J. Talmud Genetic Testing for Cardiovascular Disease Susceptibility: A Useful Clinical Management Tool or Possible Misinformation? Arterioscler Thromb Vasc Biol, April 1, 2004; 24(4): 628 - 636. [Abstract] [Full Text] [PDF] |
||||
![]() |
M Vytopil, S Benedetti, E Ricci, G Galluzzi, A Dello Russo, L Merlini, G Boriani, M Gallina, L Morandi, L Politano, et al. Mutation analysis of the lamin A/C gene (LMNA) among patients with different cardiomuscular phenotypes J. Med. Genet., December 1, 2003; 40(12): e132 - 132. [Full Text] |
||||
![]() |
P. J. Talmud, S. Martin, G. Steiner, D. M. Flavell, D. B. Whitehouse, S. Nagl, R. Jackson, M.-R. Taskinen, M. H. Frick, M. S. Nieminen, et al. Progression of Atherosclerosis Is Associated With Variation in the {alpha}1-Antitrypsin Gene Arterioscler Thromb Vasc Biol, April 1, 2003; 23(4): 644 - 649. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2002 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |