This Article Abstract Full Text (PDF) All Versions of this Article: 105/5/608    most recent hc0502.103672v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Edelberg, J. M. Articles by Hong, M. K. Search for Related Content PubMed PubMed Citation Articles by Edelberg, J. M. Articles by Hong, M. K. Related Collections Endothelium/vascular type/nitric oxide Angiogenesis Gene expression Growth factors/cytokines

(Circulation. 2002;105:608.)
© 2002 American Heart Association, Inc.

Basic Science Reports

Platelet-Derived Growth Factor-AB Limits the Extent of Myocardial Infarction in a Rat Model

Feasibility of Restoring Impaired Angiogenic Capacity in the Aging Heart

Jay M. Edelberg, MD, PhD; Seung H. Lee, MD; Manmeen Kaur, BS; Lilong Tang, MD, PhD; Nikki M. Feirt, MD; Samuel McCabe, BS; Orville Bramwell, BS; S. Chiu Wong, MD; Mun K. Hong, MD

From the Departments of Medicine (J.M.E., S.H.L., M.K., L.T., S.M., O.B., S.C.W., M.K.H.), Cell Biology (J.M.E.), and Pathology (N.M.F.), Weill Medical College of Cornell University, New York, NY; and the Department of Medicine (S.H.L.), Wonju Medical College of Yonsei University, Wonju, Korea.

Correspondence to Jay M. Edelberg, Weill Medical College of Cornell University, 525 E 68th St, A352, New York, NY 10021. E-mail jme2002{at}mail.med.cornell.edu

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Background— Compared with younger patients, myocardial infarction in the elderly has been associated with less favorable clinical outcomes, which may be attributable to a decline in angiogenic capacity in the aging heart.

Methods and Results— To test the hypothesis that the functional phenotype of cardiac microvascular endothelial cells is maintained partly by a cardiac myocyte platelet-derived growth factor (PDGF)-B–induced paracrine pathway, we conducted in vitro studies with murine cardiac cells. These studies demonstrated that unlike young endothelial cells, endothelial cells of the aging heart do not express PDGF-B when cultured in the presence of cardiac myocytes. The functional significance of this endothelial dysregulation was assessed with an ex vivo pinnal cardiac allograft model to demonstrate that senescent cardiac angiogenic activity was depressed (2 of 17 allografts were viable in 18-month-old mice versus 19 of 20 in 3-month-old mice; P<0.01). PDGF-AB pretreatment specifically restored the viability of the cardiac allografts in the aging hosts (13 of 13 allografts were viable; P<0.01 versus 18-month-old controls). Finally, in vivo studies in rat hearts demonstrated that pretreatment by intramyocardial delivery of PDGF-AB promotes angiogenesis and minimizes the extent of myocardial infarction in the aging hearts after coronary ligation (myocardial infarction size: 10.0±7.0% of left ventricular area in PDGF pretreatment [n=7] versus 17.6±5.6% in control [n=5] groups; P<0.03).

Conclusion— Aging hearts have impaired angiogenic function as a result of depressed PDGF-B production. Restoration of the dysregulated endothelial PDGF-mediated angiogenic pathway in the aging heart reverses the senescent impairment in cardioprotective angiogenic function and offers a foundation for developing novel therapies for cardiovascular disease in older individuals.

Key Words: endothelium • heart • angiogenesis • aging

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
Ischemic heart disease is the most common cause of morbidity and mortality in the population over the age of 65.^1–4 In younger individuals, myocardial ischemia induces the development of a collateral supply that partially protects the cardiac tissue from subsequent coronary events.^5–8 However, angiogenesis is impaired in the cardiac^4,9–13 and peripheral vascular beds of older individuals,^14,15 and this defect may underlie the increased severity of cardiovascular disease in the geriatric population. Therefore, elucidation of the cellular and molecular pathways that are impaired with aging is critical for developing specific strategies to prevent and reduce the pathogenesis of cardiovascular disease associated with advancing age.

Despite recent progress in our understanding of the molecular pathways regulating angiogenesis during embryonic development, the mechanistic alterations in angiogenic function in the senescent vasculature are not well understood. Previously, we described¹⁶ a platelet-derived growth factor (PDGF)-AB–mediated communication between cardiac microvascular endothelial cells (CMECs) and the neighboring cardiac myocytes. Cardiac myocytes induce CMECs to express the PDGF-B isoform, which combines with the constitutively expressed PDGF-A isoform to form the PDGF-AB heterodimer. This results in the induction of a cascade of molecular events that maintain vascular integrity, including the endothelial expression of vascular endothelial growth factor (VEGF) and VEGF receptor-2 (Flk-1, VEGFR-2). Therefore, dysregulation of these angiogenic pathways, which occurs in aging through alterations in cardiac PDGF-levels,¹⁷ may lead to angiogenic defects. On the basis of these previous observations, we hypothesized that interventions targeted at reestablishing the angiogenic potential in senescent cardiac endothelial function may attenuate the detrimental impact of obstructive vascular disease in the aging heart. Therefore, we focused our studies on defining the aging-associated changes that regulate angiogenic pathways in the cardiac endothelium.

In the present report, we extend our previous findings, demonstrating that endothelial dysregulation in the PDGF communication pathway underlies the impairment in senescent cardiac angiogenic potential. Moreover, reestablishment of the PDGF pathways to facilitate cardiac angiogenesis protects both young and aging rodent hearts from myocardial infarction.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Molecular Studies
To determine the molecular defects leading to impaired senescent cardiac angiogenic activity, samples of the ventricular myocardium were isolated from 3-month-old (n=3) and 18-month-old C57B61/L mice (n=3) (National Institute on Aging Colony; maintained by Harlan Sprague Dawley, Inc). Total RNA was isolated (RNeasy and QIAshedder kits, Qiagen) and analyzed by reverse transcriptase–polymerase chain reaction (RT-PCR) (Hotstar Taq PCR, Qiagen) for expression of PDGF-A, PDGF-B, and ß-actin. In order to dissect the physiological effects of aging on endothelial function, CMECs were isolated from 3- and 18-month-old wild-type mice. Moreover, transwell cocultures with fetal cardiac myocytes were used in order to control the myocyte contribution to the cardiac microvascular regulation of the different endothelial cells. CMECs were cultured from 3- and 18-month-old C57B61/L mice and cardiac myocytes from fetal murine hearts as previously described.^16,18,19 The CMEC cultures were expanded for 2 passages, confirmed by Di-Ac-LDL uptake and platelet endothelial cell adhesion molecule (PECAM) staining, and plated into 12-well dishes (10⁵ cells per well) (Costar). Cardiac myocytes (embryonic 15.5 days) were plated in 12-mm-0.4-µm pore transwells (10⁵ cells per transwell), transferred into CMEC-seeded wells on days 0, 1, and 2, and cultured for 3 days as previously described.¹⁶ At the termination of the coculture, total RNA was isolated from the CMEC wells and RT-PCR was performed. The following sets of oligonucleotide primers were used:

PDGF-A

Forward: 5'TCAAGGTGGCCAAAGTGGAG3'

Reverse: 5'CTCTCTGTGACAAGGAAGCT3'

PDGF-B

Forward: 5'ATCGCCGAGTGCAAGACGCG3'

Reverse: 5'AAGCACCATTGGCCGTCCGA3'

PDGF- Receptor

Forward: 5'ACAGAGACTGAGCGCTGACA3'

Reverse: 5'TTCCAAGAAGGAAGGAAGCA3'

PDGF-ß Receptor

Forward: 5'TGAGCTTCACCTATCAAGTTGC3'

Reverse: 5'GTGCCACCAAGGGAAAAGAT3'

VEGF

Forward: 5'GGATCCATGAACTTTCTGCTGCTGTCTTGG3'

Reverse: 5'TTCTGGCTTTGTCCTGTCTTTCTTTGG3'

Flk-1

Forward: 5'CAGCTTGCTCCTTCCTCATC3'

Reverse: 5'TCTGGAGAGCAAACCAACCA3'

PECAM

Forward: 5'CAAGCGGTCGTGAATGACAC3'

Reverse: 5'CACTGCCTTGACTGTCTTAAG3'

ß-actin

Forward: 5'GTGGGCCGCTCTAGGCACCAA 3'

Reverse: 5'CTCTTTGATGTCACGCACGATTTC3'

Cellular and secreted protein samples were isolated from additional CMEC cocultures and were applied to Nunc maxisorb plates (Roskilde) as previously described.¹⁶ Polyclonal antibodies to PDGF-A (sc-128) and PDGF-B (sc-7878, Santa Cruz Biotechnology); VEGF (AF 493-NA), Flk-1 (AF 644), PDGF- receptor (PDGFR-) (AF322), and PDGFR-ß (AF385, all R&D Systems); and PECAM (550274, BD Pharmigen) were then used. The plates were assayed as previously described to quantify the relevant cardiac myocyte–induced fold-changes in protein levels as a functional correlate to the senescent changes in endothelial gene expression dynamics.¹⁶ All studies were performed a minimum of 3 times.

Ex Vivo Cardiac Tissue Angiogenesis Studies
To test the physiological significance of the alterations in aging endothelial function, we used a cardiac allograft model, which allows the assessment of cardiac angiogenic potential in different age groups. In this model, allograft neovascularization is mediated by host endothelial cells recruited into the donor hearts, which recapitulate the cardiac myocyte–endothelial cell communication in vivo.¹⁸ Neonatal C57B61/L (24-hour-old) murine hearts were transplanted into the pinnae of both young adult and senescent C57B61/L mice as we have previously described (3-month-old mice, n=20; 18-month-old mice, n=17).^18,19 As controls, senescent mice were transplanted with inert silicon (1x1x2 mm³) to test wound-healing response (n=8) or neonatal pulmonary allografts to test cardiac-specific angiogenesis (n=8) in place of the neonatal cardiac tissue.

In addition, at the time of cardiac or pulmonary allograft transplantation, sets of young adult mice also were treated with single subcutaneous pinnal injections of antibodies to neutralize PDGF-AB (10 µg in 20 µL PBS, AB-20-NA, R&D Systems, n8 cardiac, 8 pulmonary allografts), PDGFR-, PDGFR-ß (10 µg in 20 µL PBS, AB-307-NA and AB385, R&D Systems, respectively; n=7 cardiac allografts), or nonimmune rabbit immunoglobulin G (10 µg in 20 µL PBS, AB-105-C, R&D Systems; n=8 cardiac, 8 pulmonary allografts). Sets of senescent hosts also were pretreated with subcutaneous pinnal injections of VEGF (R&D Systems, 100 ng per 20 µL PBS, n=12), PDGF-AB (R&D Systems, 100 ng per 20 µL PBS, n=13) or PBS alone (n=8) 1 day before receiving cardiac allograft transplants. Allograft viability was scored by pinnal and transplant integrity. Pinnal electrocardiograms also were recorded to further document cardiac allograft viability.¹⁹

In Vivo Rat Heart Model: PDGF-AB Enhancement of Angiogenic Function
Intracardiac Injections of PDGF-AB
Instead of using the murine heart, an in vivo rat model was chosen in order to allow a more comprehensive histological assessment of the role of PDGF-AB in promoting and restoring angiogenic activity in the endogenous heart. Sets of both young adult (4-month-old) and aging F344 (24-month-old) rats (National Institute on Aging Colony; maintained by Harlan Sprague Dawley, Inc) were anesthetized and underwent left intercostal thoracotomy. After identifying the left anterior descending artery (LAD), 100 ng of PDGF-AB in 50 µL PBS solution was injected through a 30-gauge needle using a 250-µL Hamilton syringe. Two injections (25 µL per injection, 2 mm apart) were made at the mid-left ventricular anterior wall. Control rats received PBS pretreatment. The chest wall was then closed, the lungs inflated, the rat extubated, and the tracheotomy closed.

Cardiac Angiogenic Assessment
Rats receiving pretreatments alone (PDGF-AB or control, 4 and 24 months old, n=3 each group) were euthanized 24 hours after injection, and hearts were excised, fixed, and sectioned for vascular density analysis, as previously described.^20–22 Blood vessels were highlighted by immunostaining for von Willebrand factor (vWF) (082, DAKO), visualized with diaminobenzidine (DAB). Vascular density was assessed by examining a single mid-papillary section (proximal to the injection site) from each heart and identifying all vWF-stained endothelial cell–lined structures in a total of 8 high-power fields (magnification x40) per region per heart. Vascular counts were performed by 2 investigators in a blinded fashion.

Myocardial Infarction Model
The pro-angiogenic and cardioprotective effects of PDGF-AB pretreatments were studied in a myocardial infraction model. One day after PDGF-AB (4-month-old rats, n=15; 24-month-old rats, n=7) or control (4-month-old rats, n=12; 24-month-old rats, n=5) intramyocardial injections, the rats were anesthetized, the heart exposed, and the LAD ligated just below left atrial appendage with 8-0 nylon sutures. Additional sets of 4-month-old rats were treated with PDGF-AB (n=3) or control (n=3) at the time of LAD ligation. Pallor and regional wall motion abnormality of the left ventricle confirmed occlusion. The chest wall was closed, and after recovery, the rats were returned to the animal facility and kept for 14 days. The rats then were euthanized and the hearts harvested, fixed, and sectioned as described above. Myocardial infarction size measured at the level of the mid-papillary heart muscles was scored by Masson’s trichrome staining, as previously described,^23,24 and the images were analyzed in a blinded fashion with ImageJ 1.22 software (NIH Image).^25,26 Infarction size was expressed as a percentage of the total left ventricle myocardial area. An independent pathologist (Dr Feirt) who was blinded to the treatment received reviewed these measurements.

Statistics
Differences were tested for statistical significance by the Student’s t test. A value of P<0.05 was considered significant.

	Results

Top Abstract Introduction Methods Results Discussion References

 
Induction of PDGF-B Is Impaired in Senescent Endothelial Cells
RT-PCR analysis revealed that PDGF-A was expressed in ventricular myocardial samples from both the young adult and senescent hearts (Figure 1A). PDGF-B expression, however, was detected only in young adult murine cardiac samples, which is in agreement with previous findings in the rat heart.¹⁷ Furthermore, transwell cocultures confirmed that CMECs of both young and senescent hearts constitutively expressed PDGF-A (Figure 1B and 1C). However, only the young adult CMECs expressed PDGF-B in the presence of the fetal cardiac myocytes, resulting in a significant increase in protein levels of PDGF-B in the CMECs of the 3- but not the 18-month-old hearts. Furthermore, PDGFR- was expressed in CMECs from both young adult and senescent hearts.

View larger version (34K): [in this window] [in a new window]   Figure 1. A, RT-PCR analysis of PDGF-A, PDGF-B, and ß-actin expression in ventricular myocardial samples isolated from young adult (3 m) and senescent mice (18 m). B, Gene expression profile of CMECs of 3- and 18-month-old mice cocultured in transwells with fetal cardiac myocytes for zero to 3 days. C, Fold-change in protein levels of CMECs of 3- and 18-month-old mice cultured in the presence vs the absence of fetal cardiac myocytes for 3 days.

In addition to the dysregulation of PDGF-B, the expression pattern of other pro-angiogenic genes was also altered in the CMECs from aging mice (Figure 1B and 1C). Unlike the young adult CMECs, in which VEGF was induced in the coculture with the cardiac myocytes, the endothelial cells derived from aging hearts expressed the growth factor when cultured in isolation. However, senescent CMEC VEGF mRNA, but not protein, levels decreased in the presence of the cardiac myocytes. Furthermore, the expression of Flk-1, the principal mitogenic receptor for VEGF, was altered significantly in the senescent cells.

PDGF-AB Restores Angiogenesis of Exogenous Cardiac Tissue
The potential functional significance of the endothelial dysregulation in senescent mice then was examined. These studies used a syngeneic neonatal murine cardiac allograft-pinnal transplant model that recapitulates PDGF-AB–PDGFR- pathway¹⁶ in the organ bed–specific regulation of endothelial cells recruited from host peripheral vascular beds,¹⁸ and is specifically enhanced by PDGF-AB.²⁷ Neutralization of PDGF-AB or PDGFR-, but not PDGFR-ß, in the young murine pinnae at the time of transplantation significantly reduced the viability of cardiac allografts, whereas pulmonary transplant engraftment was unaltered by neutralization of PDGF-AB (Table). Thus, the pinnal cardiac allograft model could provide a direct in vivo comparison of the cardiac myocyte/myocardial–induced angiogenic potential of the endothelium in young adult and senescent mice.

View this table: [in this window] [in a new window]   Table 1. PDGF in Pinnal Cardiac Allograft Vascularization

Although wound healing was preserved in the older hosts, as demonstrated by the integrity of silicon implants, our studies revealed that cardiac allograft survival was impaired markedly in the aging mice compared with the young adult mice (Figure 2). Moreover, the viability of the pulmonary allografts suggested that the aging-associated changes were the result of diminished senescent endothelial angiogenic function induced by the transplanted cardiac myocytes/myocardial tissue.

View larger version (20K): [in this window] [in a new window]   Figure 2. Representative examples of neonatal cardiac transplants into young adult (3 months old) (n=20) and senescent hosts (18 months old) (n=17). Senescent hosts were also transplanted with silicon (n=8), neonatal lungs (n=8), and neonatal hearts after pinnal pretreatment by injection of 100 ng of VEGF (n=12) or 100 ng of PDGF-AB (n=13). Arrow indicates viable/intact transplants. The majority of the cardiac allografts transplanted into the control and VEGF-pretreated senescent mice resulted in a necrotic loss of both allograft and host pinnal tissue beyond the transplant site (arrowhead). Allograft viability was scored by pinnal and transplant integrity. Cardiac allograft viability in young adult and PDGF-AB–pretreated senescent hosts was confirmed by pinnal electrocardiograms (5-s tracing). *P<0.01 vs young adult; **P<0.01 vs senescent adult and P<0.01 vs senescent adult treated with VEGF.

We also tested the potential of the various molecular mediators that are downregulated in the senescent endothelial cell–cardiac myocyte cocultures in an effort to restore cardiac angiogenic potential in the aging mice. The subcutaneous pinnal administration of VEGF at concentrations previously demonstrated to enhance auricular neovascularization²⁸ failed to improve the success of cardiac transplantation in the aging mice. However, reconstitution of PDGF-AB restored the capacity of the senescent host to neovascularize the transplanted cardiac tissue. These data suggest that the aging-associated decrease in endothelial cell PDGF-AB generation in response to cardiac myocytes underlies the impaired function in senescent cardiac angiogenic potential observed in vivo, and that the level of PDGF-AB expressed in the cardiac endothelium endogenous to the transplanted tissue is insufficient to induce effective revascularization in the senescent hosts.

PDGF-AB Promotes Cardiac Angiogenesis in the Endogenous Heart
To assess whether restoration or augmentation of the endogenous cardiac PDGF-AB pathways would rapidly enhance angiogenesis in the adult heart and offer a novel means of protecting the older heart from myocardial infarction, we used the rat heart, which, on the basis of size, provides better histological quantification than does the murine heart. Our studies revealed that PDGF-AB significantly increased vascular density in both the young and the aging intact heart (Figure 3), demonstrating the functional integrity of the angiogenic pathway downstream of PDGF-B induction in the senescent cardiac microvasculature.

View larger version (75K): [in this window] [in a new window]   Figure 3. A, Representative vWF (DAB) staining of vessels in 4- and 24-month-old rat hearts pretreated with vehicle or PDGF-AB 24 h before euthanization (magnification x200). B, Vascular density as determined by vWF staining for the sets of treated rats (number of vessels per high-power field [HPF; magnification x400]) (n=3 for each set). *P<0.05 vehicle vs control; vascular density differences between 4- and 24-month-old treatment sets are not statistically significant.

PDGF-AB Protects the Endogenous Heart From Myocardial Infarction
Our findings in the endogenous hearts suggested that PDGF-AB pretreatment could reduce the extent of myocardial infarction after LAD ligation significantly. Quantification of myocardial infarction size by Masson’s trichrome stain revealed that PDGF-AB reduced the size of myocardial infarction by approximately half in the young adults (Figure 4). Indeed, the infarction size in 24-month-old heart preinjected with PDGF-AB was approximately half the size of infarctions in control-injected hearts (Figure 5). Treatment at the time of coronary ligation, however, had no effect on myocardial infarction size (15.7±3.1%; n=3).

View larger version (30K): [in this window] [in a new window]   Figure 4. Representative Masson’s trichrome staining in 4-month-old rat hearts pretreated with PBS or PDGF-AB 24 h before LAD ligation. Graph shows myocardial infarct size scored 14 days after coronary artery ligation (control, n=13; PDGF-AB, n=12). *P<0.02, PDGF vs control.

View larger version (28K): [in this window] [in a new window]   Figure 5. Representative Masson’s trichrome staining in 24-month-old rat hearts pretreated with PBS or PDGF-AB 24 h before LAD ligation. Graph shows myocardial infarct size 14 days after coronary ligation (control, n=5; PDGF-AB, n=7). *P<0.03, PDGF vs control.

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
The results of the present studies suggest the following: (1) Endothelial expression of PDGF-B may be downregulated in the senescent heart; (2) endothelial dysregulation in the communication with cardiac myocytes may be the primary defect in the impaired cardiac angiogenic function in the aging heart; and (3) therapies directed at impaired senescent cardiac angiogenic function may protect the aging heart from myocardial infarction. Moreover, targeting of these pathways in the young rat heart provides similar angiogenic enhancement and cardioprotective effect, suggesting that studies of the molecular basis of the aging-associated dysregulation in cardiac angiogenic activity may lay the foundation for the development of novel strategies for the treatment of ischemic cardiovascular disease in both young and older individuals.

Mechanism of Impaired Angiogenesis in the Aging Heart
Thus far, the precise molecular and cellular defects leading to impaired senescent cardiac angiogenic activity have been unknown. Our studies reveal that aging-associated alterations in endothelial cells result in the inhibition of the PDGF-AB–induced cardiac communication pathway that governs cardiac angiogenic function. Furthermore, the endothelial cells in the aging vasculature may develop a deficiency in as yet unrecognized constitutive or inducible receptor(s) required for the generation of a permissive environment for cardiac angiogenic function. Alternatively, the senescent endothelium may have lost its paracrine mediators that sustain cardiac myocyte–dependent communication with the PDGFR-–expressing CMECs.¹⁶

Restoration of Angiogenic Potential
Our studies demonstrate that augmentation of the PDGF-AB–dependent pathways in the endogenous heart is sufficient to restore angiogenic potential and markedly reduces the extent of myocardial infarction in the aging heart. Because PDGF-AB restores angiogenic capacity in the intact hearts of all age groups, the critical downstream pathways in the endothelial cells from the senescent cardiac vasculature are likely to be intact. Such downstream components may include factors that act synergistically with VEGF and other pro-angiogenic factors to promote the formation of mature blood vessels to vascularize the cardiac allografts. Indeed, PDGF-AB may restore the expression patterns of genes that are dysregulated in the aging CMECs, such as VEGF, which is mediated by the PDGF-AB pathway in the young cardiac endothelial cells.¹⁶ Therefore, identification of the critical pro-angiogenic set of genes regulated by PDGF-AB pathways may provide a regimen tailored for the induction of angiogenic function specifically in the myocardium. Moreover, such a set of genes may provide a more potent approach for reversing senescent vascular impairment than the delivery of PDGF-AB alone, which may be limited by its actions on nonendothelial vascular cell types, such as smooth muscle cells, in which it promotes proliferation.²⁹ Further studies integrating aging-associated changes in cardiac myocytes^30–32 and smooth muscle cells³³ may help define additional targets to augment the actions of the endogenous PDGF-AB pathways to reverse the senescent cardiac vascular phenotype.

The findings of our present studies provide a unique insight into the molecular and cellular alterations in endothelial function that may contribute to the worse clinical outcome after a cardiac event in older individuals.^34,35 Augmentation or restoration of endothelial PDGF-AB–dependent pro-angiogenic pathways can reduce the size of infarct size after experimental coronary artery occlusion. The clinical translation of these findings will require future studies aimed at defining and potentially expanding the therapeutic window of this approach, testing under transient and chronic hypoxic conditions, and using relevant disease models that enhance the vascular pathology in the aging heart (eg, hypertension, diabetes, and hyperlipidemia). It is hoped that the integration of results of such studies with our present observations will provide further understanding of more precise pathways in myocardial angiogenesis and will facilitate the development of future therapeutic approaches for the treatment and possible prevention of ischemic heart disease.

	Acknowledgments

 
This work was supported by National Institutes of Health P01 HL59312, the Ellison Medical Foundation, the American Federation for Aging Research, the Society for Geriatric Cardiology, and a Weill Cornell Center for Aging Research and Clinical Care grant (Dr Edelberg); the American Heart Association-Student Research Grant (Manmeen Kaur); and the Michael Wolk Foundation (Dr Hong).

	Footnotes

 
This article originally appeared Online on December 31, 2001 (Circulation. 2001;104:r46–r51).

Received December 4, 2001; accepted December 5, 2001.

	References

Top Abstract Introduction Methods Results Discussion References

 

1. Sullivan LW. Healthy people 2000. N Engl J Med. 1990; 323: 1065–1067.
   
2. Wei JY. Age and the cardiovascular system. N Engl J Med. 1992; 327: 1735–1739.
   
3. American Heart Association. Heart and Stroke Facts Statistical Supplement. Dallas, Tex: American Heart Association; 1993–1995.
   
4. Azhar G, Gao W, Liu L, et al. Ischemia-reperfusion in the adult mouse heart: influence of age. Exp Gerontol. 1999; 34: 699–714.
   
5. Hirai T, Fujita M, Nakajima H, et al. Importance of collateral circulation for prevention of left ventricular aneurysm formation in acute myocardial infarction. Circulation. 1989; 79: 791–796.
   
6. Ejiri M, Fujita M, Sakai O, et al. Development of collateral circulation after acute myocardial infarction: its role in preserving left ventricular function. J Cardiol. 1990; 20: 31–37.
   
7. Kodama K, Kusuoka H, Sakai A, et al. Collateral channels that develop after an acute myocardial infarction prevent subsequent left ventricular dilation. J Am Coll Cardiol. 1996; 27: 1133–1139.
   
8. Banerjee AK, Madan Mohan SK, et al. Functional significance of coronary collateral vessels in patients with previous "Q" wave infarction: relation to aneurysm, left ventricular end diastolic pressure and ejection fraction. Int J Cardiol. 1993; 38: 263–271.
   
9. Hudlicka O, Brown MD. Postnatal growth of the heart and its blood vessels. J Vasc Res. 1996; 33: 266–287.
   
10. Isoyama S. Hypertension and age-related changes in the heart: implications for drug therapy. Drugs Aging. 1994; 5: 102–115.
    
11. Tomanek RJ, Aydelotte MR, Butters CA. Late-onset renal hypertension in old rats alters myocardial microvessels. Am J Physiol. 1990; 259: H1681–H1687.
    
12. Anversa P, Li P, Sonnenblick EH, Olivetti G. Effects of aging on quantitative structural properties of coronary vasculature and microvasculature in rats. Am J Physiol. 1994; 267: H1062–H1073.
    
13. Rakusan K, Nagai J. Morphometry of arterioles and capillaries in hearts of senescent mice. Cardiovasc Res. 1994; 28: 969–972.
    
14. Rivard A, Fabre JE, Silver M, et al. Age-dependent impairment of angiogenesis. Circulation. 1999; 99: 111–120.
    
15. Reed MJ, Corsa AC, Kudravi SA, et al. A deficit in collagenase activity contributes to impaired migration of aged microvascular endothelial cells. J Cell Biochem. 2000; 77: 116–126.
    
16. Edelberg JM, Aird WC, Wu W, et al. PDGF-mediates cardiac microvascular communication. J Clin Invest. 1998; 102: 837–843.
    
17. Sarzani R, Arnaldi G, Takasaki I, et al. Effects of hypertension and aging on platelet-derived growth factor and platelet-derived growth factor receptor expression in rat aorta and heart. Hypertension. 1991; 18: III93–III99.
    
18. Aird WC, Edelberg JM, Weiler-Guettler H, et al. Vascular bed-specific expression of an endothelial cell gene is programmed by the tissue microenvironment. J Cell Biol. 1997; 138: 1117–1124.
    
19. Edelberg JM, Aird WC, Rosenberg RD. Enhancement of murine cardiac chronotropy by the molecular transfer of the human beta2 adrenergic receptor cDNA. J Clin Invest. 1998; 101: 337–343.
    
20. Weidner N, Semple JP, Welch WR, et al. Tumor angiogenesis and metastasis–correlation in invasive breast carcinoma. N Engl J Med. 1991; 324: 1–8.
    
21. Sasaki H, Ray PS, Zhu L, et al. Hypoxia/reoxygenation promotes myocardial angiogenesis via an NF kappa B-dependent mechanism in a rat model of chronic myocardial infarction. J Mol Cell Cardiol. 2001; 33: 283–294.
    
22. Kawasuji M, Nagamine H, Ikeda M, et al. Therapeutic angiogenesis with intramyocardial administration of basic fibroblast growth factor. Ann Thorac Surg. 2000; 69: 1155–1161.
    
23. Raya TE, Gaballa M, Anderson P, et al. Left ventricular function and remodeling after myocardial infarction in aging rats. Am J Physiol. 1997; 273: H2652–H2658.
    
24. Liu L, Azhar G, Gao W, et al. Bcl-2, and Bax expression in adult rat hearts after coronary occlusion: age-associated differences. Am J Physiol. 1998; 275: R315–R322.
    
25. Tahepold P, Valen G, Starkopf J, et al. Pretreating rats with hyperoxia attenuates ischemia-reperfusion injury of the heart. Life Sci. 2001; 68: 1629–1640.
    
26. Okamura T, Miura T, Takemura G, et al. Effect of caspase inhibitors on myocardial infarct size and myocyte DNA fragmentation in the ischemia-reperfused rat heart. Cardiovasc Res. 2000; 45: 642–650.
    
27. Edelberg JM, Jacobson JT, Gidseg DS, et al. Enhanced myocyte-based biosensing of the blood-borne signals regulating chronotropy. J Appl Physiol. October 26, 2001. 10.1152/japplphysiol.00672.2001. Available at: http://jap.physiology.org. Accessed December 12, 2001.
    
28. Stepnick D, Peterson M, Bodgan C, et al. Effects of tumor necrosis factor alpha and vascular permeability factor on neovascularization of the rabbit ear. Arch Otolaryngol Head Neck Surg. 1995; 121: 667–672.
    
29. D’Amore P, Smith SR. Growth factor effects on cells of the vascular wall: a survey. Growth Factors. 1993; 8: 61–75.
    
30. Fraticelli A, Josephson R, Danziger R, et al. Morphological and contractile characteristics of rat cardiac myocytes from maturation to senescence. Am J Physiol. 1989; 257: H259–H265.
    
31. Bazan A, Van de Velde E, Fraeyman N. Effect of age on beta-receptors, Gs alpha- and Gi alpha- proteins in rat heart. Biochem Pharmacol. 1994; 48: 479–486.
    
32. Xiao RP, Spurgeon HA, F OC, Lakatta EG. Age-associated changes in beta-adrenergic modulation on rat cardiac excitation-contraction coupling. J Clin Invest. 1994; 94: 2051–2059.
    
33. Rivard A, Berthou-Soulie L, Principe N, et al. Age-dependent defect in vascular endothelial growth factor expression is associated with reduced hypoxia-inducible factor 1 activity. J Biol Chem. 2002; 275: 29643–29647.
    
34. Gottlieb S, Boyko V, Harpaz D, et al. Long-term (three-year) prognosis of patients treated with reperfusion or conservatively after acute myocardial infarction: Israeli Thrombolytic Survey Group. J Am Coll Cardiol. 1999; 34: 70–82.
    
35. Zimmerman FH, Cameron A, Fisher LD, et al. Myocardial infarction in young adults: angiographic characterization, risk factors and prognosis (Coronary Artery Surgery Study Registry) J Am Coll Cardiol. 1995; 26: 654–661.
    

This article has been cited by other articles:

				M. H. Chen, R. Kerkela, and T. Force Mechanisms of Cardiac Dysfunction Associated With Tyrosine Kinase Inhibitor Cancer Therapeutics Circulation, July 1, 2008; 118(1): 84 - 95. [Full Text] [PDF]

				T. Kinnaird, E. Stabile, S. Zbinden, M.-S. Burnett, and S. E. Epstein Cardiovascular risk factors impair native collateral development and may impair efficacy of therapeutic interventions Cardiovasc Res, May 1, 2008; 78(2): 257 - 264. [Abstract] [Full Text] [PDF]

				D. Leosco, G. Rengo, G. Iaccarino, E. Sanzari, L. Golino, G. D. Lisa, C. Zincarelli, F. Fortunato, M. Ciccarelli, V. Cimini, et al. Prior Exercise Improves Age-Dependent Vascular Endothelial Growth Factor Downregulation and Angiogenesis Responses to Hind-Limb Ischemia in Old Rats J. Gerontol. A Biol. Sci. Med. Sci., May 1, 2007; 62(5): 471 - 480. [Abstract] [Full Text] [PDF]

				V. L.T. Ballard and J. M. Edelberg Stem Cells and the Regeneration of the Aging Cardiovascular System Circ. Res., April 27, 2007; 100(8): 1116 - 1127. [Abstract] [Full Text] [PDF]

				R. R. Smith, L. Barile, H. C. Cho, M. K. Leppo, J. M. Hare, E. Messina, A. Giacomello, M. R. Abraham, and E. Marban Regenerative Potential of Cardiosphere-Derived Cells Expanded From Percutaneous Endomyocardial Biopsy Specimens Circulation, February 20, 2007; 115(7): 896 - 908. [Abstract] [Full Text] [PDF]

				B. A. Pallante, I. Duignan, D. Okin, A. Chin, M. C. Bressan, T. Mikawa, and J. M. Edelberg Bone Marrow Oct3/4+ Cells Differentiate Into Cardiac Myocytes via Age-Dependent Paracrine Mechanisms Circ. Res., January 5, 2007; 100(1): e1 - e11. [Abstract] [Full Text] [PDF]

				M. Iemitsu, S. Maeda, S. Jesmin, T. Otsuki, and T. Miyauchi Exercise training improves aging-induced downregulation of VEGF angiogenic signaling cascade in hearts Am J Physiol Heart Circ Physiol, September 1, 2006; 291(3): H1290 - H1298. [Abstract] [Full Text] [PDF]

				P. C.H. Hsieh, C. MacGillivray, J. Gannon;, F. U. Cruz, and R. T. Lee Local Controlled Intramyocardial Delivery of Platelet-Derived Growth Factor Improves Postinfarction Ventricular Function Without Pulmonary Toxicity Circulation, August 15, 2006; 114(7): 637 - 644. [Abstract] [Full Text] [PDF]

				M. Takahashi, T.-S. Li, R. Suzuki, T. Kobayashi, H. Ito, Y. Ikeda, M. Matsuzaki, and K. Hamano Cytokines produced by bone marrow cells can contribute to functional improvement of the infarcted heart by protecting cardiomyocytes from ischemic injury Am J Physiol Heart Circ Physiol, August 1, 2006; 291(2): H886 - H893. [Abstract] [Full Text] [PDF]

				D. A. Klibansky, A. Chin, I. J. Duignan, and J. M. Edelberg Synergistic targeting with bone marrow-derived cells and PDGF improves diabetic vascular function Am J Physiol Heart Circ Physiol, April 1, 2006; 290(4): H1387 - H1392. [Abstract] [Full Text] [PDF]

				D. Cai, J. M. Holm, I. J. Duignan, J. Zheng, M. Xaymardan, A. Chin, V. L. T. Ballard, J. N. Bella, and J. M. Edelberg BDNF-mediated enhancement of inflammation and injury in the aging heart Physiol Genomics, February 23, 2006; 24(3): 191 - 197. [Abstract] [Full Text] [PDF]

				J. Zheng, A. Chin, I. Duignan, K.-H. Won, M. K. Hong, and J. M. Edelberg Growth factor-mediated reversal of senescent dysfunction of ischemia-induced cardioprotection Am J Physiol Heart Circ Physiol, February 1, 2006; 290(2): H525 - H530. [Abstract] [Full Text] [PDF]

				V. L. Ballard and J. M. Edelberg Harnessing Hormonal Signaling for Cardioprotection Sci. Aging Knowl. Environ., December 21, 2005; 2005(51): re6 - re6. [Abstract] [Full Text] [PDF]

				J.-Y. Min, Y. Chen, S. Malek, A. Meissner, M. Xiang, Q. Ke, X. Feng, M. Nakayama, E. Kaplan, and J. P. Morgan Stem cell therapy in the aging hearts of Fisher 344 rats: Synergistic effects on myogenesis and angiogenesis J. Thorac. Cardiovasc. Surg., August 1, 2005; 130(2): 547 - 553. [Abstract] [Full Text] [PDF]

				Y. Cao, A. Hong, H. Schulten, and M. J. Post Update on therapeutic neovascularization Cardiovasc Res, February 15, 2005; 65(3): 639 - 648. [Abstract] [Full Text] [PDF]

				J. M. Edelberg, A. Wong, J. M. Holm, M. Xaymardan, I. Duignan, A. Chin, J. R. Kizer, and D. Cai Phage display identification of age-associated TNF{alpha}-mediated cardiac oxidative induction Physiol Genomics, August 11, 2004; 18(3): 255 - 260. [Abstract] [Full Text] [PDF]

				E. G. Lakatta and S. Schulman Age-associated cardiovascular changes are the substrate for poor prognosis with myocardial infarction J. Am. Coll. Cardiol., July 7, 2004; 44(1): 35 - 37. [Full Text] [PDF]

				H. Fujii, S. Tomita, T. Nakatani, S. Fukuhara, A. Hanatani, Y. Ohtsu, M. Ishida, C. Yutani, K. Miyatake, and S. Kitamura A novel application of myocardial contrast echocardiography to evaluate angiogenesis by autologous bone marrow cell transplantation in chronic ischemic pig model J. Am. Coll. Cardiol., April 7, 2004; 43(7): 1299 - 1305. [Abstract] [Full Text] [PDF]

				M. Xaymardan, L. Tang, L. Zagreda, B. Pallante, J. Zheng, J. L. Chazen, A. Chin, I. Duignan, P. Nahirney, S. Rafii, et al. Platelet-Derived Growth Factor-AB Promotes the Generation of Adult Bone Marrow-Derived Cardiac Myocytes Circ. Res., March 19, 2004; 94(5): e39 - e45. [Abstract] [Full Text] [PDF]

				M. Xaymardan, J. Zheng, I. Duignan, A. Chin, J. M. Holm, V. L.T. Ballard, and J. M. Edelberg Senescent Impairment in Synergistic Cytokine Pathways That Provide Rapid Cardioprotection in the Rat Heart J. Exp. Med., March 15, 2004; 199(6): 797 - 804. [Abstract] [Full Text] [PDF]

				M. J. Reed and J. M. Edelberg Impaired Angiogenesis in the Aged Sci. Aging Knowl. Environ., February 18, 2004; 2004(7): pe7 - 7. [Abstract] [Full Text]

				D. Cai, M. Xaymardan, J. M. Holm, J. Zheng, J. R. Kizer, and J. M. Edelberg Age-associated impairment in TNF-{alpha} cardioprotection from myocardial infarction Am J Physiol Heart Circ Physiol, July 11, 2003; 285(2): H463 - H469. [Abstract] [Full Text] [PDF]

				D. W. Losordo and A. Kawamoto Biological Revascularization and the Interventional Molecular Cardiologist: Bypass for the Next Generation Circulation, December 10, 2002; 106(24): 3002 - 3005. [Full Text] [PDF]

				J. M. Edelberg Auto Repair on the Aging Stem Cell Superhighway Sci. Aging Knowl. Environ., September 4, 2002; 2002(35): pe13 - 13. [Abstract] [Full Text]

				J. M. Edelberg, L. Tang, K. Hattori, D. Lyden, and S. Rafii Young Adult Bone Marrow-Derived Endothelial Precursor Cells Restore Aging-Impaired Cardiac Angiogenic Function Circ. Res., May 31, 2002; 90 (10): e89 - e93. [Abstract] [Full Text] [PDF]