| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Circulation. 2004;109:2792-2800.)
© 2004 American Heart Association, Inc.
Basic Science Reports |
From Medical Faculty of the Charité, Franz Volhard Clinic, HELIOS Klinikum-Berlin and Max Delbrück Center for Molecular Medicine, Berlin, Germany (I.M., A.F., D.N.M., E.S., R.D., B.P., F.C.L.); the Department of Internal Medicine and Nephrology, Hannover University Medical School, Hannover, Germany (J.-K.P., C.L., H.H.); and the Department of Internal Medicine III, University of Heidelberg, Heidelberg, Germany (C.V.).
Correspondence to Friedrich C. Luft, Wiltberg Strasse 50, 13125 Berlin, Germany. E-mail luft{at}fvk-berlin.de
Received February 10, 2003; de novo received October 14, 2003; revision received February 10, 2004; accepted February 24, 2004.
| Abstract |
|---|
|
|
|---|
Methods and Results We investigated the effects of Ang II (107 mol/L) and Ald (107 mol/L) on extracellular signalregulated kinase (ERK) and c-Jun N-terminal kinase (JNK) signaling in vascular smooth muscle cells (VSMCs) with Western blotting and confocal microscopy. Ang II induced ERK 1/2 and JNK phosphorylation by 2 minutes. Ald achieved the same at 10 minutes. Ang II+Ald had a potentiating effect by 2 minutes. Two oxygen radical scavengers and the epidermal growth factor receptor (EGFR) antagonist AG1478 reduced Ang II, Ald-, and combination-induced ERK1/2 phosphorylation. Preincubating the cells with the MR blocker spironolactone (106 mol/L) abolished Ang IIinduced ROS generation, EGFR transactivation, and ERK1/2 phosphorylation.
Conclusions Ald potentiates Ang IIinduced ERK-1/2 and JNK phosphorylation. Oxygen radicals, the MR, and the EGFR play a role in early signaling induced by Ang II and Ald in VSMCs. These in vitro data may help explain the effects of MR blockade on Ang IIinduced end-organ damage in vivo.
Key Words: angiotensin aldosterone receptors kinases reactive oxygen species
| Introduction |
|---|
|
|
|---|
| Methods |
|---|
|
|
|---|
Cell Culture
Aortic VSMCs were isolated from SD rats.12 Passages 2 to 4 were used for immunohistochemistry and passage 4 to 10 for Western blotting. VSMCs were phenotyped by staining for muscle-specific
-actin (Dako) and desmin (Boehringer-Mannheim). VSMCs were also analyzed for MR expression. TaqMan polymerase chain reaction (PCR) demonstrated RNA expression of the receptor (primer sequences as follows: MR-F, GCACTCACACCATCCCCG; MR-R, TCGTAGCCTGCATACACGGTC; MR-P, FAM-CCATGATCCTGGAGAACATCGAGCCT-TAMRA; data not shown). Cells were treated with Ang II (Sigma), Ald (Clinalfa), glutathione (GSH) (Sigma), or Tiron (4,5-dihydroxy-1,3-benzene-disulfonic acid; Sigma). The following blockers were used as indicated: AG 1478 (Calbiochem) and Spi (Sigma). All experiments were performed under 18-hour serum-free conditions.
Immunohistochemistry
Confocal microscopy was performed as described.12 At least 50 to 80 cells from each experiment were examined under each condition by 2 different investigators without knowledge of the origin of the specimens. Quantification was performed with histogram function in the MRC Laser Sharp software. The subcellular regions were outlined manually, and the calculated mean fluorescence intensity was obtained for the delineated regions. Data are presented as the mean fluorescence intensity in the respective cell area. Immunohistochemistry for collagen IV and phospho-ERK was performed.10,11 For collagen IV detection, we used an antibody from Southern Biotech (1:500), and for phospho-ERK, from Santa Cruz (1:100). Ten different areas per organ (n=5 per group) were analyzed semiquantitatively. The data are expressed in arbitrary units (0 to 5), based on the staining intensity.
Western Blot
The following primary antibodies were used: polyclonal ERK1/2 (NEB; 1:1000), phospho-ERK1/2 (NEB; 1:1000), phospho-Elk-1 (NEB; 1:1000), phospho-JNK (Dianova; 1:1000), and p-EGFR (NEB; 1:1000). Peroxidase-conjugated secondary antibodies were from Sigma (1:5000). Blots were developed with the chemiluminescence substrate and visualized on Kodak films. Three to 5 cell stimulation experiments of each protocol were performed and quantified. For semiquantification, the most intense band was defined as 100%. All other bands of the experiment were calculated as percentage of the maximum.
p42/44 MAP Kinase Assay
The kinase assay for ERK 1/2 (p42/44 kinase assay) was performed with a kit from New England BioLabs. Briefly, after stimulation, active mitogen-activated protein (MAP) kinase was selectively immunoprecipitated. The precipitate was incubated with ATP and Elk-1 fusion protein in a kinase buffer. This allows active MAP kinase to phosphorylate Elk-1. Elk-1 phosphorylation was measured by Western blotting and quantified as described above.
Dichlorofluorescein to Measure Intracellular Reactive Oxygen Species
Intracellular reactive oxygen species (ROS) production was measured in rat VSMCs by the method of Ohba et al.13 Briefly, cells were kept in serum-free conditions for 24 hours (0.1% BSA). Cells were preincubated with Spi 106 mol/L for 30 minutes or DMSO 10 µmol/L for 30 minutes. H2DCF-DA (2'7'-dichlorofluorescein-diacetate, Sigma, 5 µmol/L) was added, and cells were stimulated with Ang II 107 mol/L.
Statistics
Data are presented as mean±SEM. Statistical significance was tested by ANOVA, blood pressure and albuminuria by repeated-measures ANOVA and the Scheffé test, and ROS generation by SPSS. We used a general linear model with repeated measurements and post hoc by paired t test with the Bonferroni correction. A value of P<0.05 was considered statistically significant. The data were analyzed by use of StatView statistical software.
| Results |
|---|
|
|
|---|
|
Ald Potentiates Ang IIInduced ERK Phosphorylation
Ang II (107 mol/L) induced ERK phosphorylation in VSMCs with a maximal intensity after 2 minutes (Figure 2A). After Ald (107 mol/L), the maximal intensity of ERK phosphorylation was observed at 10 minutes (Figure 2B). The combination of Ang II and Ald resulted in a stronger ERK phosphorylation at 1 and 2 minutes than with Ang II or Ald alone (Figure 2, C andE). Western blot and confocal microscopy experiments showed that Ang II and Ald at a lower concentration (both 108 mol/L) still caused a similar potentiation (data not shown). Using the ERK1/2 MAP kinase assay, kinase activity was increased after Ang II and Ald alone as well as after the combination. However, the combination resulted in a higher MAP kinase activity, resulting in enhanced Elk-1 phosphorylation compared with the single compounds (Figure 2D). We also investigated Ang II and/or Ald-induced ERK phosphorylation in the presence of the protein synthesis inhibitors actinomycin D and cycloheximide. Neither inhibitor affected short-term ERK phosphorylation, supporting a nongenomic Ang II/Ald effect (data not shown).
|
Ald Potentiates Ang IIInduced JNK Phosphorylation
Ang II (107 mol/L) also induced JNK phosphorylation with a maximal intensity after 2 minutes, whereas the maximal intensity of JNK phosphorylation after Ald (107 mol/L) stimulation was observed at 10 minutes. When the cells were stimulated with the combination of both Ang II and Ald, a significantly stronger JNK phosphorylation was observed at 1 minute than with the single compounds alone (data not shown).
Ang II and Ald Signaling Is Mediated Through Oxygen Radicals
VSMCs were preincubated with GSH for 90 minutes before stimulation. GSH (2 mmol/L) preincubation suppressed both ERK (Figure 3, A through C) and JNK (Figure 3, D throughF) phosphorylation after stimulation with Ang II (107 mol/L), Ald (107 mol/L), and the combination of Ang II and Ald. To verify the effect, we preincubated the cells with a distinct oxygen radical scavenger, Tiron. Tiron preincubation (10 µmol/L) caused a similar suppression of ERK phosphorylation induced by Ang II (107 mol/L), Ald (107 mol/L), and the combination of Ang II and Ald (data not shown).
|
Effect of Spi on Ang II Signaling
Next, we preincubated VSMCs for 30 minutes with Spi. Thereafter, the cells were stimulated with Ang II (107 mol/L) for 10 minutes. Spi decreased Ang IIinduced ERK phosphorylation at 10 minutes but not at 2 minutes, as shown by Western blot (Figure 4A) and by confocal microscopy (Figure 4B). Consistent with this result, Ang IIinduced EGFR phosphorylation was reduced by Spi at 10 minutes (Figure 4B; P=0.01); no effect was observed at 2 minutes. Furthermore, we measured the effect of Spi on ROS production induced by Ang II (107 mol/L) and Ald (107 mol/L). Spi reduced Ang IIinduced ROS generation from 5 minutes onward (Figure 4C, P=0.05 at 5 minutes, 0.01 at 10 minutes). The Ald (107 mol/L)induced ERK phosphorylation was abolished with MR blockade (Figure 4D), whereas EGF (10 ng/mL)induced ERK phosphorylation was not influenced by Spi (Figure 4E). Spi did not inhibit EGF-induced ROS production (data not shown).
|
Ang II and Ald Signaling Is Mediated Through the EGFR
We preincubated VSMCs with increasing concentrations (10, 100, and 300 nmol/L) of AG 1478, a specific EGFR blocker. We then stimulated the cells with Ang II (107 mol/L), Ald (107 mol/L), and a combination of both compounds. ERK phosphorylation was diminished dose-dependently by blocking the EGFR in all protocols (Figure 5, A through C).
|
| Discussion |
|---|
|
|
|---|
The MR is expressed not only in the cortical collecting duct but also in many other tissues, including the heart.14 Northern blotting, RNAse protection assay, RT-PCR, in situ hybridization, immunohistochemistry, and Ald binding studies have been performed in cardiac tissue. However, precise cellular localization studies have not been entirely satisfactory. Endothelial cells, cardiac fibroblasts, VSMCs, and cardiomyocytes have all been implicated in terms of MR expression. The MR can be occupied not only by Ald but also by glucocorticoids. As a matter of fact, the MR may dimerize with the glucocorticoid receptor.15
Brilla et al16 and Young et al17 used different rat models and found that increased circulating Ald levels resulted in cardiac fibrosis. The DOCA-salt model results led to the suggestion that mineralocorticoid-mediated sodium entry into cardiac cells might be responsible.18 Further support came from the finding that Spi ameliorated the effects. Ang II regulates cardiac Ald production. Several studies were conducted to address the possibility that Ang II was responsible for cardiac fibrosis rather than Ald. Rocha et al18,19 showed that Ald infusion stimulates cardiac fibrosis in the rat. They suppressed Ang II production simultaneously with an ACE inhibitor. Benetos et al20 used a combined infusion of Spi and an ACE inhibitor in spontaneously hypertensive rats. They found that Spi reversed cardiac fibrosis. Earlier, we studied a similar rat model using Spi.21 In that study, we also found that Spi ameliorated cardiac hypertrophy and fibrosis, largely independently of blood pressure. Taken together, these studies support the notion that Ald induces cardiac fibrosis independently of other renin-angiotensin system components.
Ullian et al22 first suggested that Ald increases Ang II receptor number, increases Ang IIstimulated inositol phosphate responses, and prevents the Ang IIinduced downregulation of Ang II receptors. This group also showed enhanced phospholipase C
dependent signaling when VSMCs were preincubated with Ald for 24 hours before Ang II stimulation.23 In contrast to our findings, transcriptional regulation was involved in the studies by Ullian et al. We cannot exclude the possibility that genomic and nongenomic effects might have contributed to our in vivo observations. Nevertheless, the short duration of our in vitro experiments, as well as our results obtained with actinomycin D and cycloheximide, support a nongenomic effect.
Nongenomic effects have been reported for other steroids. Limbourg et al24 described a rapid and nontranscriptional activation of eNOS by corticosteroids that is transmitted via phosphatidylinositol 3-kinase and Akt. Nongenomic Ald-related effects have also been described in humans.6 For instance, Schmidt et al25 found that Ald, via nongenomic mechanisms, has diverse effects on the cardiovascular system that depend on the preexisting adrenergic state. Data from the rat remnant kidney model also support the idea that chronic Ald-related effects may include a nongenomic component. Greene et al26 studied 5/6 nephrectomy remnant kidney rats given AT1 receptor blockers with ACE inhibitors and compared them with remnant kidney rats given these drugs along with Ald. In the former group, Ang IIrelated effects were blocked, and the rats were protected. In the latter group, given Ald, the effects were not ameliorated. This group resembled the no-treatment remnant kidney group. In their study, MR blockade did not reverse the effects of Ald, suggesting that MR-independent effects were present. The effects that we observed appeared to be MR dependent, because Spi was capable of blocking the effects. In the case of the estrogen receptor, considerable evidence suggests that the receptor mediates both nuclear genomic and nonnuclear nongenomic effects.27,28 Exactly how nongenomic steroid-receptor signaling occurs is unclear.
Our data suggest that the MR interacts with Ang IIinduced signaling, influencing ROS production, EGFR transactivation, and ERK phosphorylation. Ang II signals primarily via the AT1 receptor. The AT1 receptor is coupled to heterotrimeric G proteins, and stimulation results in the release of oxygen free radicals, phosphorylation of MAP kinases and receptor tyrosine kinases, protein kinase C activation, and activation of the transcription factors AP-1 and NF-
B.29 Ang IIinduced ROS release has been suggested to function as a feed-forward mechanism.30 The early release depends on protein kinase C activation (H2O2; first peak at 30 seconds). The H2O2 activates src, which leads to EGFR activation. The activated EGFR mediates stimulation of PI3-K and the G-protein Rac. The latter binds to NADPH oxidase to activate generation of more O2 and H2O2, resulting in a sustained ROS generation that lasts up to 6 hours.30 Ald caused generation of ROS in VSMCs in vitro; however, this effect began later (6 to 8 minutes) than Ang IIinduced ROS generation. This result suggests that Ald does not influence the early generation of Ang IIinduced ROS production. The relevance of Ald-induced ROS production has also been shown in animal models. In aortic segments of Ald-infused rats, ROS levels were increased because of enhanced NADPH oxidase activity.31 Furthermore, rats receiving chronic Ald/salt treatment exhibited NADPH oxidase and NF-
B activation in their endothelial and inflammatory cells. The effect was ameliorated with MR blockade and antioxidants.32 In our study, both GSH and Tiron significantly inhibited Ang II/Ald signaling in VSMCs.
The EGFR also holds a key position in Ang IIinduced signaling and is required for sustained Ang IIinduced NADPH oxidase activation and ROS generation.30,33 Ald also mediated its effects via the EGFR. Ald enhanced EGF signaling, resulting in potentiated ERK 1/2 phosphorylation and Ca2+ homeostasis in MDCK cells.7 Further evidence about the role of the EGFR in Ald signaling comes from studies with CHO cells that lack the EGFR and do not respond to EGF or Ald. In EGFR-transfected CHO cells, EGF caused ERK 1/2 and src phosphorylation. Ald potentiated this signaling.8 From our results, we conclude that VSMCs require a functioning EGFR for Ang II and Ald-induced tyrosine kinase signaling. The cytosolic tyrosine kinase c-src regulates trafficking of the EGFR out of the caveolae. This trafficking might be needed for EGFR internalization and transactivation.34 We did not investigate src-kinase phosphorylation. However, Ald potentiates Ang IIinduced tyrosine phosphorylation in VSMCs (A. Fiebeler, unpublished data, 2003), and c-src may be one of these tyrosine kinases. Altogether, the feed-forward model,30 as well as our findings, suggests that the interaction between Ang II and Ald is downstream of the first Ang IIinduced ROS production but upstream of the EGFR. Kinases such as src and their regulating phosphatases may well be an interconnection between the 2 signaling pathways.35
Our earlier studies in dTGR indicated that the NADPH oxidase is strongly activated in this model.11 Both NF-
B and AP-1 are activated, and both control the inducible expression of genes whose products are part of the inflammatory response. The JNK and ERK pathways are 2 members of the MAP kinase family that are also activated by ROS. The ERK pathway also modulates the expression of genes via phosphorylation of the transcription factor Elk-1, which controls the production of the c-Fos transcription factor. Nevertheless, not all Ang IIinduced MAP kinase activation is under control of the EGFR.36 Our data show that not only Ang II but also Ald participate in both JNK and ERK signaling. They suggest that blockade of both the AT1 and the MR receptor may be necessary to accrue maximal effects in terms of vascular protection.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
2. Zannad F, Alla F, Dousset B, et al. Limitation of excessive extracellular matrix turnover may contribute to survival benefit of spironolactone therapy in patients with congestive heart failure: insights from the Randomized Aldactone Evaluation Study (RALES). Rales Investigators. Circulation. 2000; 102: 27002706.
3. Pitt B, Remme W, Zannad F, et al. Eplerenone, a selective aldosterone blocker, in patients with left ventricular dysfunction after myocardial infarction. N Engl J Med. 2003; 348: 13091321.
4. Okuda M, Kawahara Y, Yokoyama M. Angiotensin II type 1 receptormediated activation of Ras in cultured rat vascular smooth muscle cells. Am J Physiol. 1996; 271: H595H601.[Medline] [Order article via Infotrieve]
5. Arriza JL, Weinberger C, Cerelli G, et al. Cloning of human mineralocorticoid receptor complementary DNA: structural and functional kinship with the glucocorticoid receptor. Science. 1987; 237: 268275.
6. Losel RM, Feuring M, Falkenstein E, et al. Nongenomic effects of aldosterone: cellular aspects and clinical implications. Steroids. 2002; 67: 493498.[CrossRef][Medline] [Order article via Infotrieve]
7. Gekle M, Freudinger R, Mildenberger S, et al. Aldosterone interaction with epidermal growth factor receptor signaling in MDCK cells. Am J Physiol. 2002; 282: F669F679.
8. Krug AW, Schuster C, Gassner B, et al. Human epidermal growth factor receptor-1 expression renders chinese hamster ovary cells sensitive to alternative aldosterone signaling. J Biol Chem. 2002; 277: 4589245897.
9. Eguchi S, Iwasaki H, Ueno H, et al. Intracellular signaling of angiotensin IIinduced p70 S6 kinase phosphorylation at Ser(411) in vascular smooth muscle cells: possible requirement of epidermal growth factor receptor, Ras, extracellular signalregulated kinase, and Akt. J Biol Chem. 1999; 274: 3684336851.
10. Park JK, Muller DN, Mervaala EM, et al. Cerivastatin prevents angiotensin IIinduced renal injury independent of blood pressure and cholesterol-lowering effects. Kidney Int. 2000; 58: 14201430.[CrossRef][Medline] [Order article via Infotrieve]
11. Muller DN, Shagdarsuren E, Park JK, et al. Immunosuppressive treatment protects against angiotensin IIinduced renal damage. Am J Pathol. 2002; 161: 16791693.
12. Haller H, Quass P, Lindschau C, et al. Platelet-derived growth factor and angiotensin II induce different spatial distribution of protein kinase C-
and -ß in vascular smooth muscle cells. Hypertension. 1994; 23: 848852.
13. Ohba M, Shibanuma M, Kuroki T, et al. Production of hydrogen peroxide by transforming growth factor-beta 1 and its involvement in induction of egr-1 in mouse osteoblastic cells. J Cell Biol. 1994; 126: 10791088.
14. Lombes M, Oblin ME, Gasc JM, et al. Immunohistochemical and biochemical evidence for a cardiovascular mineralocorticoid receptor. Circ Res. 1992; 71: 503510.
15. Trapp T, Holsboer F. Heterodimerization between mineralocorticoid and glucocorticoid receptors increases the functional diversity of corticosteroid action. Trends Pharmacol Sci. 1996; 17: 145149.[CrossRef][Medline] [Order article via Infotrieve]
16. Brilla CG, Matsubara LS, Weber KT. Anti-aldosterone treatment and the prevention of myocardial fibrosis in primary and secondary hyperaldosteronism. J Mol Cell Cardiol. 1993; 25: 563575.[CrossRef][Medline] [Order article via Infotrieve]
17. Young M, Fullerton M, Dilley R, et al. Mineralocorticoids, hypertension, and cardiac fibrosis. J Clin Invest. 1994; 93: 25782583.[Medline] [Order article via Infotrieve]
18. Rocha R, Martin-Berger CL, Yang P, et al. Selective aldosterone blockade prevents angiotensin II/saltinduced vascular inflammation in the rat heart. Endocrinology. 2002; 143: 48284836.
19. Rocha R, Chander PN, Khanna K, et al. Mineralocorticoid blockade reduces vascular injury in stroke-prone hypertensive rats. Hypertension. 1998; 31: 451458.
20. Benetos A, Levy BI, Lacolley P, et al. Role of angiotensin II and bradykinin on aortic collagen following converting enzyme inhibition in spontaneously hypertensive rats. Arterioscler Thromb Vasc Biol. 1997; 17: 31963201.
21. Fiebeler A, Schmidt F, Muller DN, et al. Mineralocorticoid receptor affects AP-1 and nuclear factor-
B activation in angiotensin IIinduced cardiac injury. Hypertension. 2001; 37: 787793.
22. Ullian ME, Schelling JR, Linas SL. Aldosterone enhances angiotensin II receptor binding and inositol phosphate responses. Hypertension. 1992; 20: 6773.
23. Ullian ME, Fine JJ. Mechanisms of enhanced angiotensin IIstimulated signal transduction in vascular smooth muscle by aldosterone. J Cell Physiol. 1994; 161: 201208.[CrossRef][Medline] [Order article via Infotrieve]
24. Limbourg FP, Huang Z, Plumier JC, et al. Rapid nontranscriptional activation of endothelial nitric oxide synthase mediates increased cerebral blood flow and stroke protection by corticosteroids. J Clin Invest. 2002; 110: 17291738.[CrossRef][Medline] [Order article via Infotrieve]
25. Schmidt BM, Georgens AC, Martin N, et al. Interaction of rapid nongenomic cardiovascular aldosterone effects with the adrenergic system. J Clin Endocrinol Metab. 2001; 86: 761767.
26. Greene EL, Kren S, Hostetter TH. Role of aldosterone in the remnant kidney model in the rat. J Clin Invest. 1996; 98: 10631068.[Medline] [Order article via Infotrieve]
27. Simoncini T, Genazzani AR, Liao JK. Nongenomic mechanisms of endothelial nitric oxide synthase activation by the selective estrogen receptor modulator raloxifene. Circulation. 2002; 105: 13681373.
28. Ho KJ, Liao JK. Nonnuclear actions of estrogen. Arterioscler Thromb Vasc Biol. 2002; 22: 19521961.
29. Wolf G, Butzmann U, Wenzel UO. The renin-angiotensin system and progression of renal disease: from hemodynamics to cell biology. Nephron. 2003; 93: P3P13.[CrossRef][Medline] [Order article via Infotrieve]
30. Seshiah PN, Weber DS, Rocic P, et al. Angiotensin II stimulation of NAD(P)H oxidase activity: upstream mediators. Circ Res. 2002; 91: 406413.
31. Virdis A, Neves MF, Amiri F, et al. Spironolactone improves angiotensin-induced vascular changes and oxidative stress. Hypertension. 2002; 40: 504510.
32. Sun Y, Zhang J, Lu L, et al. Aldosterone-induced inflammation in the rat heart: role of oxidative stress. Am J Pathol. 2002; 161: 17731781.
33. Kagiyama S, Eguchi S, Frank GD, et al. Angiotensin IIinduced cardiac hypertrophy and hypertension are attenuated by epidermal growth factor receptor antisense. Circulation. 2002; 106: 909912.
34. Carpenter G. The EGF receptor: a nexus for trafficking and signaling. Bioessays. 2000; 22: 697707.[CrossRef][Medline] [Order article via Infotrieve]
35. Griendling KK, Harrison DG. Dual role of reactive oxygen species in vascular growth. Circ Res. 1999; 85: 562563.
36. Eguchi S, Dempsey PJ, Frank GD, et al. Activation of MAPKs by angiotensin II in vascular smooth muscle cells: metalloprotease-dependent EGF receptor activation is required for activation of ERK and p38 MAPK but not for JNK. J Biol Chem. 2001; 276: 79577962.
This article has been cited by other articles:
![]() |
C. A. Lemarie, S. M.C. Simeone, A. Nikonova, T. Ebrahimian, M.-E. Deschenes, T. M. Coffman, P. Paradis, and E. L. Schiffrin Aldosterone-Induced Activation of Signaling Pathways Requires Activity of Angiotensin Type 1a Receptors Circ. Res., October 23, 2009; 105(9): 852 - 859. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Hirata, N. Maeda, A. Hiuge, T. Hibuse, K. Fujita, T. Okada, S. Kihara, T. Funahashi, and I. Shimomura Blockade of mineralocorticoid receptor reverses adipocyte dysfunction and insulin resistance in obese mice Cardiovasc Res, October 1, 2009; 84(1): 164 - 172. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-K. Park, S. Theuer, T. Kirsch, C. Lindschau, U. Klinge, A. Heuser, R. Plehm, M. Todiras, P. Carmeliet, H. Haller, et al. Growth Arrest Specific Protein 6 Participates in DOCA-Induced Target-Organ Damage Hypertension, August 1, 2009; 54(2): 359 - 364. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Xu, Y. He, M. Vokurkova, and R. M. Touyz Endothelial Cells Negatively Modulate Reactive Oxygen Species Generation in Vascular Smooth Muscle Cells: Role of Thioredoxin Hypertension, August 1, 2009; 54(2): 427 - 433. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bunda, Y. Wang, T. F. Mitts, P. Liu, S. Arab, M. Arabkhari, and A. Hinek Aldosterone Stimulates Elastogenesis in Cardiac Fibroblasts via Mineralocorticoid Receptor-independent Action Involving the Consecutive Activation of G{alpha}13, c-Src, the Insulin-like Growth Factor-I Receptor, and Phosphatidylinositol 3-Kinase/Akt J. Biol. Chem., June 12, 2009; 284(24): 16633 - 16647. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Huang, A. Zhang, G. Ding, and R. Chen Aldosterone-induced mesangial cell proliferation is mediated by EGF receptor transactivation Am J Physiol Renal Physiol, June 1, 2009; 296(6): F1323 - F1333. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Luther, Z. Wang, J. Ma, N. Makhanova, H.-S. Kim, and N. J. Brown Endogenous Aldosterone Contributes to Acute Angiotensin II-Stimulated Plasminogen Activator Inhibitor-1 and Preproendothelin-1 Expression in Heart But Not Aorta Endocrinology, May 1, 2009; 150(5): 2229 - 2236. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Whaley-Connell, J. Habibi, Y. Wei, A. Gutweiler, J. Jellison, C. E. Wiedmeyer, C. M. Ferrario, and J. R. Sowers Mineralocorticoid receptor antagonism attenuates glomerular filtration barrier remodeling in the transgenic Ren2 rat Am J Physiol Renal Physiol, May 1, 2009; 296(5): F1013 - F1022. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-G. Wei, Y. Yu, Z.-H. Zhang, and R. B. Felder Angiotensin II upregulates hypothalamic AT1 receptor expression in rats via the mitogen-activated protein kinase pathway Am J Physiol Heart Circ Physiol, May 1, 2009; 296(5): H1425 - H1433. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. J. Brown Salt in the Wound J. Am. Soc. Nephrol., January 1, 2009; 20(1): 5 - 6. [Full Text] [PDF] |
||||
![]() |
S. J. Nicholls, E. M. Tuzcu, D. M. Brennan, J.-C. Tardif, and S. E. Nissen Cholesteryl Ester Transfer Protein Inhibition, High-Density Lipoprotein Raising, and Progression of Coronary Atherosclerosis: Insights From ILLUSTRATE (Investigation of Lipid Level Management Using Coronary Ultrasound to Assess Reduction of Atherosclerosis by CETP Inhibition and HDL Elevation) Circulation, December 9, 2008; 118(24): 2506 - 2514. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Di Zhang, A. N. D. Cat, C. Soukaseum, B. Escoubet, A. Cherfa, S. Messaoudi, C. Delcayre, J.-L. Samuel, and F. Jaisser Cross-Talk Between Mineralocorticoid and Angiotensin II Signaling for Cardiac Remodeling Hypertension, December 1, 2008; 52(6): 1060 - 1067. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-G. Wei, Y. Yu, Z.-H. Zhang, R. M. Weiss, and R. B. Felder Mitogen-Activated Protein Kinases Mediate Upregulation of Hypothalamic Angiotensin II Type 1 Receptors in Heart Failure Rats Hypertension, October 1, 2008; 52(4): 679 - 686. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Yamada, M. Kushibiki, T. Osanai, H. Tomita, and K. Okumura Vasoconstrictor effect of aldosterone via angiotensin II type 1 (AT1) receptor: possible role of AT1 receptor dimerization Cardiovasc Res, July 1, 2008; 79(1): 169 - 178. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Molnar, C. Lindschau, G. Dubrovska, P. R. Mertens, T. Kirsch, M. Quinkler, M. Gollasch, S. Wresche, F. C. Luft, D. N. Muller, et al. Glucocorticoid-Related Signaling Effects in Vascular Smooth Muscle Cells Hypertension, May 1, 2008; 51(5): 1372 - 1378. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Grossmann, R. Freudinger, S. Mildenberger, B. Husse, and M. Gekle EF Domains Are Sufficient for Nongenomic Mineralocorticoid Receptor Actions J. Biol. Chem., March 14, 2008; 283(11): 7109 - 7116. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. L. Schiffrin New Twist to the Role of the Renin-Angiotensin System in Heart Failure: Aldosterone Upregulates Renin-Angiotensin System Components in the Brain Hypertension, March 1, 2008; 51(3): 622 - 623. [Full Text] [PDF] |
||||
![]() |
Y. Yu, S.-G. Wei, Z.-H. Zhang, E. Gomez-Sanchez, R. M. Weiss, and R. B. Felder Does Aldosterone Upregulate the Brain Renin-Angiotensin System in Rats With Heart Failure? Hypertension, March 1, 2008; 51(3): 727 - 733. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Bauersachs and D. Fraccarollo More NO-No More ROS: Combined Selective Mineralocorticoid Receptor Blockade and Angiotensin-Converting Enzyme Inhibition for Vascular Protection Hypertension, March 1, 2008; 51(3): 624 - 625. [Full Text] [PDF] |
||||
![]() |
N. J. Brown Aldosterone and Vascular Inflammation Hypertension, February 1, 2008; 51(2): 161 - 167. [Full Text] [PDF] |
||||
![]() |
C. L. Sartorio, D. Fraccarollo, P. Galuppo, M. Leutke, G. Ertl, I. Stefanon, and J. Bauersachs Mineralocorticoid Receptor Blockade Improves Vasomotor Dysfunction and Vascular Oxidative Stress Early After Myocardial Infarction Hypertension, November 1, 2007; 50(5): 919 - 925. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. P. Brandes Avoiding Vicious Circles: Mineralocorticoid Receptor Antagonism Prevents Vascular Oxidative Stress Early After Myocardial Infarction Hypertension, November 1, 2007; 50(5): 842 - 843. [Full Text] [PDF] |
||||
![]() |
S. A. Cooper, A. Whaley-Connell, J. Habibi, Y. Wei, G. Lastra, C. Manrique, S. Stas, and J. R. Sowers Renin-angiotensin-aldosterone system and oxidative stress in cardiovascular insulin resistance Am J Physiol Heart Circ Physiol, October 1, 2007; 293(4): H2009 - H2023. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. N Muller Mechanisms of hypertension-induced target organ damage Journal of Renin-Angiotensin-Aldosterone System, September 1, 2007; 8(3): 148 - 150. [PDF] |
||||
![]() |
S. Bunda, P. Liu, Y. Wang, K. Liu, and A. Hinek Aldosterone Induces Elastin Production in Cardiac Fibroblasts through Activation of Insulin-Like Growth Factor-I Receptors in a Mineralocorticoid Receptor-Independent Manner Am. J. Pathol., September 1, 2007; 171(3): 809 - 819. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Grossmann, A. W. Krug, R. Freudinger, S. Mildenberger, K. Voelker, and M. Gekle Aldosterone-induced EGFR expression: interaction between the human mineralocorticoid receptor and the human EGFR promoter Am J Physiol Endocrinol Metab, June 1, 2007; 292(6): E1790 - E1800. [Abstract] [Full Text] [PDF] |
||||
![]() |
Wenxia Chai, Y. M Hoedemaekers, R. H. van Schaik, M. van Fessem, I. M Garrelds, J. J Saris, D. Dooijes, F. J ten Cate, M. M. Kofflard, and A. J. Danser Cardiac aldosterone in subjects with hypertrophic cardiomyopathy Journal of Renin-Angiotensin-Aldosterone System, December 1, 2006; 7(4): 225 - 230. [Abstract] [PDF] |
||||
![]() |
C. Ruster and G. Wolf Renin-Angiotensin-Aldosterone System and Progression of Renal Disease J. Am. Soc. Nephrol., November 1, 2006; 17(11): 2985 - 2991. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Lemarie, P.-L. Tharaux, B. Esposito, A. Tedgui, and S. Lehoux Transforming Growth Factor-{alpha} Mediates Nuclear Factor {kappa}B Activation in Strained Arteries Circ. Res., August 18, 2006; 99(4): 434 - 441. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Johar, A. C. Cave, A. Narayanapanicker, D. J. Grieve, and A. M. Shah Aldosterone mediates angiotensin II-induced interstitial cardiac fibrosis via a Nox2-containing NADPH oxidase FASEB J, July 1, 2006; 20(9): 1546 - 1548. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Suzuki, M. Iwai, M. Mogi, A. Oshita, T. Yoshii, J. Higaki, and M. Horiuchi Eplerenone With Valsartan Effectively Reduces Atherosclerotic Lesion by Attenuation of Oxidative Stress and Inflammation Arterioscler Thromb Vasc Biol, April 1, 2006; 26(4): 917 - 921. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Chai, I. M. Garrelds, R. de Vries, and A.H. Jan Danser Cardioprotective Effects of Eplerenone in the Rat Heart: Interaction With Locally Synthesized or Blood-Derived Aldosterone? Hypertension, April 1, 2006; 47(4): 665 - 670. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. L. Schiffrin Effects of Aldosterone on the Vasculature Hypertension, March 1, 2006; 47(3): 312 - 318. [Full Text] [PDF] |
||||
![]() |
S. Keidar, A. Gamliel-Lazarovich, M. Kaplan, E. Pavlotzky, S. Hamoud, T. Hayek, R. Karry, and Z. Abassi Mineralocorticoid Receptor Blocker Increases Angiotensin-Converting Enzyme 2 Activity in Congestive Heart Failure Patients Circ. Res., October 28, 2005; 97(9): 946 - 953. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Miyata, M. Rahman, T. Shokoji, Y. Nagai, G.-X. Zhang, G.-P. Sun, S. Kimura, T. Yukimura, H. Kiyomoto, M. Kohno, et al. Aldosterone Stimulates Reactive Oxygen Species Production through Activation of NADPH Oxidase in Rat Mesangial Cells J. Am. Soc. Nephrol., October 1, 2005; 16(10): 2906 - 2912. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Chai, I. M. Garrelds, R. de Vries, W. W. Batenburg, J. P. van Kats, and A.H. Jan Danser Nongenomic Effects of Aldosterone in the Human Heart: Interaction With Angiotensin II Hypertension, October 1, 2005; 46(4): 701 - 706. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Nagai, K. Miyata, G.-P. Sun, M. Rahman, S. Kimura, A. Miyatake, H. Kiyomoto, M. Kohno, Y. Abe, M. Yoshizumi, et al. Aldosterone Stimulates Collagen Gene Expression and Synthesis Via Activation of ERK1/2 in Rat Renal Fibroblasts Hypertension, October 1, 2005; 46(4): 1039 - 1045. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ishizawa, Y. Izawa, H. Ito, C. Miki, K. Miyata, Y. Fujita, Y. Kanematsu, K. Tsuchiya, T. Tamaki, A. Nishiyama, et al. Aldosterone Stimulates Vascular Smooth Muscle Cell Proliferation Via Big Mitogen-Activated Protein Kinase 1 Activation Hypertension, October 1, 2005; 46(4): 1046 - 1052. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. E. Callera, A. C. I. Montezano, A. Yogi, R. C. Tostes, Y. He, E. L. Schiffrin, and R. M. Touyz c-Src-Dependent Nongenomic Signaling Responses to Aldosterone Are Increased in Vascular Myocytes From Spontaneously Hypertensive Rats Hypertension, October 1, 2005; 46(4): 1032 - 1038. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-J. Min, M. Mogi, J.-M. Li, J. Iwanami, M. Iwai, and M. Horiuchi Aldosterone and Angiotensin II Synergistically Induce Mitogenic Response in Vascular Smooth Muscle Cells Circ. Res., September 2, 2005; 97(5): 434 - 442. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sugiyama, T. Yoshimoto, K. Tsuchiya, N. Gochou, Y. Hirono, T. Tateno, N. Fukai, M. Shichiri, and Y. Hirata Aldosterone Induces Angiotensin Converting Enzyme Gene Expression via a JAK2-Dependent Pathway in Rat Endothelial Cells Endocrinology, September 1, 2005; 146(9): 3900 - 3906. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Pilz, E. Shagdarsuren, M. Wellner, A. Fiebeler, R. Dechend, P. Gratze, S. Meiners, D. L. Feldman, R. L. Webb, I. M. Garrelds, et al. Aliskiren, a Human Renin Inhibitor, Ameliorates Cardiac and Renal Damage in Double-Transgenic Rats Hypertension, September 1, 2005; 46(3): 569 - 576. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Blancafort, E. I. Chen, B. Gonzalez, S. Bergquist, A. Zijlstra, D. Guthy, A. Brachat, R. H. Brakenhoff, J. P. Quigley, D. Erdmann, et al. Genetic reprogramming of tumor cells by zinc finger transcription factors PNAS, August 16, 2005; 102(33): 11716 - 11721. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Ma, F. Albornoz, C. Yu, D. W. Byrne, D. E. Vaughan, and N. J. Brown Differing Effects of Mineralocorticoid Receptor-Dependent and -Independent Potassium-Sparing Diuretics on Fibrinolytic Balance Hypertension, August 1, 2005; 46(2): 313 - 320. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Susic, J. Varagic, J. Ahn, L. C. Matavelli, and E. D. Frohlich Beneficial Cardiovascular Actions of Eplerenone in the Spontaneously Hypertensive Rat Journal of Cardiovascular Pharmacology and Therapeutics, July 1, 2005; 10(3): 197 - 203. [Abstract] [PDF] |
||||
![]() |
C. Grossmann, A. Benesic, A. W. Krug, R. Freudinger, S. Mildenberger, B. Gassner, and M. Gekle Human Mineralocorticoid Receptor Expression Renders Cells Responsive for Nongenotropic Aldosterone Actions Mol. Endocrinol., July 1, 2005; 19(7): 1697 - 1710. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Fiebeler, J. Nussberger, E. Shagdarsuren, S. Rong, G. Hilfenhaus, N. Al-Saadi, R. Dechend, M. Wellner, S. Meiners, C. Maser-Gluth, et al. Aldosterone Synthase Inhibitor Ameliorates Angiotensin II-Induced Organ Damage Circulation, June 14, 2005; 111(23): 3087 - 3094. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Nishiyama, L. Yao, Y. Fan, M. Kyaw, N. Kataoka, K. Hashimoto, Y. Nagai, E. Nakamura, M. Yoshizumi, T. Shokoji, et al. Involvement of Aldosterone and Mineralocorticoid Receptors in Rat Mesangial Cell Proliferation and Deformability Hypertension, April 1, 2005; 45(4): 710 - 716. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. E. Callera, R. M. Touyz, R. C. Tostes, A. Yogi, Y. He, S. Malkinson, and E. L. Schiffrin Aldosterone Activates Vascular p38MAP Kinase and NADPH Oxidase Via c-Src Hypertension, April 1, 2005; 45(4): 773 - 779. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Michea, A. M. Delpiano, C. Hitschfeld, L. Lobos, S. Lavandero, and E. T. Marusic Eplerenone Blocks Nongenomic Effects of Aldosterone on the Na+/H+ Exchanger, Intracellular Ca2+ Levels, and Vasoconstriction in Mesenteric Resistance Vessels Endocrinology, March 1, 2005; 146(3): 973 - 980. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. He, G. Yao, C. Savoia, and R. M. Touyz Transient Receptor Potential Melastatin 7 Ion Channels Regulate Magnesium Homeostasis in Vascular Smooth Muscle Cells: Role of Angiotensin II Circ. Res., February 4, 2005; 96(2): 207 - 215. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Pitt A New HOPE for Aldosterone Blockade? Circulation, September 28, 2004; 110(13): 1714 - 1716. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2004 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |