This Article Abstract Full Text (PDF) All Versions of this Article: 110/23/3540    most recent 01.CIR.0000136824.73458.20v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Deonarain, R. Articles by Fish, E. N. Search for Related Content PubMed PubMed Citation Articles by Deonarain, R. Articles by Fish, E. N. Pubmed/NCBI databases Gene GEO Profiles HomoloGene UniGene Substance via MeSH Medline Plus Health Information Cardiomyopathy Related Collections Animal models of human disease Gene expression Genetically altered mice

(Circulation. 2004;110:3540-3543.)
© 2004 American Heart Association, Inc.

Heart Failure

Protective Role for Interferon-ß in Coxsackievirus B3 Infection

Raj Deonarain, PhD; Dante Cerullo, MSc; Koichi Fuse, MD, PhD; Peter P. Liu, MD; Eleanor N. Fish, PhD

From the Toronto General Research Institute (R.D., P.P.L., E.N.F.) and Heart & Stroke/Richard Lewar Centre of Excellence, University of Toronto (D.C., K.F., P.P.L.), Toronto, Ontario, Canada.

Correspondence to Eleanor N. Fish, Toronto General Research Institute, University Health Network, 67 College St, Room 424, Toronto, Ontario M5G 2M1 Canada. E-mail en.fish{at}utoronto.ca

Received March 18, 2004; de novo received May 5, 2004; revision received June 4, 2004; accepted June 4, 2004.

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Background— Coxsackievirus-induced myocarditis can be a serious cause of heart failure. In the absence of a specific antiviral therapy, modulating the host immune response may be protective. Interferons (IFNs)- and -ß perform a fundamental role in innate and adaptive antiviral responses, thereby presenting as candidate therapeutics for coxsackievirus infections.

Methods and Results— To examine the contribution of IFN-ß in protection from coxsackievirus B3 (CVB3) infection, mice lacking the IFN-ß gene were infected with 10³ plaque-forming units of CVB3. In contrast to wild-type mice that exhibit an intact IFN-ß response, we observed increased susceptibility to infection (70% mortality), a downregulation of IFN-stimulated gene targets (2'-5' oligoadenylate synthetase, serine/threonine protein kinase, the GTPase Mx), and cardiomyocyte breakdown and disruption in the IFN-ß^–/– mice.

Conclusions— Viewed together, these results clearly demonstrate that IFN-ß is important in mediating protection against CVB3-induced myocarditis.

Key Words: interferon beta • coxsackievirus • interferon-stimulated genes

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
Coxsackievirus group B (CVB), enteroviruses of the Picornaviridae family, are one of the primary etiologic agents of viral myocarditis.¹ The pathogenesis of CVB3-induced myocarditis is triphasic: (1) virus infection that directly damages myocytes, (2) an immune phase with accompanying inflammatory cell infiltration, and (3) repair, fibrosis, and cardiac remodeling.² Evidence supporting CVB as an important causative agent in myocarditis includes in situ and polymerase chain reaction (PCR) detection of viral RNA in hearts of patients with myocarditis,^3–5 isolation of infectious virus from acute myocarditic patients,⁶ and demonstration of virus-induced cell death in CVB3-infected myocytes.⁷

The type I IFNs (, ß, , and ) are cytokines that interact with and signal through a common receptor complex composed of 2 transmembrane chains, IFNAR1 and IFNAR2. Signaling through the receptor invokes a phosphorylation cascade, culminating in the transcription of a group of genes collectively known as interferon-stimulated genes (ISGs).⁸ Studies with IFNAR1^–/– mice revealed that these mice were highly susceptible to CVB3 infection,⁹ suggestive of a protective role of type I IFNs in CVB3 pathogenesis and viral spread. In vivo¹⁰ and in vitro¹¹ studies demonstrate the efficacy of type I IFNs in inhibiting coxsackievirus replication. Notably, in vitro investigations identified IFN-ß as exhibiting superior antiviral activity against CVB3 compared with IFN-. To further distinguish the role of IFN-ß from IFN-, we examined the course of CVB3 infection in IFN-ß^–/– mice.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Mouse Strains, Cells, and Virus
IFN-ß^+/+ and IFN-ß^–/– mice (mixed 129/SvxC57Bl/6 background, 129/Bl6F₂)^12,13 were maintained in a sterile, pathogen-free environment according to the Animal Care Committee guidelines of the Toronto General Research Institute. CVB3 strain, Charles Gauntt, was propagated in HeLa cells and cultured in RPMI supplemented with FCS, 100 U/mL penicillin, and 100 µg/mL streptomycin. Progeny virus was purified from cell supernatants by centrifugation at 1000g for 10 minutes. Viral titer was determined by plaque assay.¹⁴

Infection of Mice and Measurement of Viral Load
Mice (8 to 10 weeks) were inoculated ip with 10³ plaque-forming units (PFU) CVB3. At indicated times, mice were euthanized, and hearts, spleens, and livers were aseptically removed, weighed, and frozen in liquid nitrogen. After 3 freeze-thaw cycles, viral titers were determined by plaque assay in HeLa cells, expressed as PFU per gram of tissue.¹⁴ The lower limit of detection, 1 plaque, corresponds to 10 PFU/g.

Histopathology
Heart tissue harvested from CVB3-infected mice was fixed in 10% (vol/vol) formalin (Sigma), embedded in paraffin, and sectioned at 4 µm. Cross-sectioned tissues were stained with hematoxylin and eosin.

RNA Extraction and cDNA Synthesis
Total RNA was extracted with Trizol (GIBCO, BRL). Complimentary DNA was synthesized from 1 µg total RNA with AMV–reverse transcriptase in a 20-µL reaction. (Reverse Transcriptase System, Promega).

Real-Time Quantitative PCR
Real-time PCR analyses were carried out with the Prism 7700 Sequence Detection System (Applied Biosystems). PCR primer and probe sequences were designed with Primer Express software (Applied Biosystems). Primer and probe sequences were as follows: 2'-5' oligoadenylate synthetase (OAS): forward, TGAGCGCCCCCCATCT; reverse, CATGACCCAGGACATCAAAGG; probe, AGGAGGTGGAGTTTGATGTGCTG. Mx: forward, CAATGATCCTTTAGCTGCTAACCTTA; reverse, GTTTACAA AGGGCTTGCTTGCT; probe, TCAGAATGTTGCCTTTAGACTGTGG. Serine/threonine protein kinase (PKR): forward, GGCTC CTGTGTGGGAAGTCA; reverse, TATGCCAAAAGCCAGAGTCCTT; probe, AGAGCCCCCAAAGCCAACTGGATG. GAPDH gene expression levels were determined with the Taqman rodent GAPDH VIC–labeled reagents kit (Applied Biosystems), specifically for standardizing gene expression levels to a housekeeping gene. Cycling reaction conditions consisted of the following: 50°C for 2 minutes, 95°C for 10 minutes, followed by 95°C for 15 seconds and 60°C for 1 minute cycled 40 times. Reactions were performed in 96-well MicroAmp Optical plates in a final volume of 25 µL. Each reaction mix included 200 ng cDNA, 1x Taqman master mix, 0.3 µmol/L forward and reverse primers, and 0.25 µmol/L FAM-labeled probe. Nontemplate controls and standards were included in each plate. All data were analyzed with the SDS 1.0 software (Applied Biosystems).

	Results

Top Abstract Introduction Methods Results Discussion References

 
Aggressive CVB3 Infection in IFN-ß^–/– Mice
To examine the role of IFN-ß in susceptibility to CVB3 infection, we infected IFN-ß^+/+ (n=6) and IFN-ß^–/– (n=6) mice with 10³ PFU of CVB3 ip. Three of 6 IFN-ß^–/– mice died within 4 days of infection, and by day 5, another mouse died (Figure 1A). In contrast, all of the IFN-ß^+/+ mice survived to 15 days after infection, at which time all animals were euthanized. The difference in mortality rates between IFN-ß^+/+ and IFN-ß^–/– mice is significant (P=0.001, Cox proportional hazards). In a subsequent time course experiment, we examined CVB3 tissue tropism during disease progression. By day 4 after CVB3 infection, virus was detected in the spleens, livers, and hearts of all animals (Figure 1B). Notably, viral titers were markedly elevated in the spleens and livers of the IFN-ß^–/– compared with the IFN-ß^+/+ mice. Although virus was cleared from the spleens and livers of the IFN-ß^+/+ mice by day 7 after CVB3 infection, virus persisted in the spleens of IFN-ß^–/– mice to day 10 and in their livers to day 7. These findings are consistent with an earlier study in IFNAR1^–/– mice, for which IFN-mediated viral inhibition is important for early clearance of hepatic virus.⁹ Viral titers measured in the hearts of the IFN-ß^–/– mice clearly increased until day 10, whereas titers decreased in the IFN-ß^+/+ mice.

View larger version (23K): [in this window] [in a new window]   Figure 1. Aggressive CVB3 infection in IFN-ß–/– mice. A, Survival of IFN-ß+/+ () and IFN-ß–/– (•) mice (n=6 per group) after CVB3 injection (103 PFU ip). B, Viral titers in heart, liver, and spleen harvested from IFN-ß+/+ and IFN-ß–/– mice measured on days 4, 7, and 10 after infection. Data are expressed as mean±SEM. *P0.05 (Mann Whitney U test). C, Gene expression levels for 2'-5' OAS, Mx, and PKR in cardiac tissue from IFN-ß+/+ and IFN-ß–/– mice on days 4, 7, and 10 after CVB3 infection. Data are expressed as mean±SEM from 3 independent experiments. *P0.05; **P0.01; ***P0.001(Student t test).

IFN-ß^–/– Mice Exhibit a Compromised IFN-Induced Response to CVB3 Infection
Induction of ISGs is required for type I IFN-mediated viral clearance. Accordingly, we examined gene expression levels for antiviral-specific ISGs, namely the 2'-5'OAS, PKR, and the GTPase Mx in CVB3-infected heart tissues. In all cases, gene expression levels for 2'-5'OAS, PKR, and Mx were lower in IFN-ß^–/– compared with IFN-ß^+/+ mice (Figure 1C). We observed that PKR gene expression is maximal at day 4 after CVB3 infection, whereas 2'-5' OAS and Mx gene expression levels peak at day 7 after CVB3 infection.

CVB3-Infected IFN-ß^–/– Mice Exhibit More Severe Pathology
Histological examination of cardiac pathology confirmed a more pronounced severity of disease in IFN-ß^–/– mice compared with IFN-ß^+/+ mice (Figure 2). By day 4 after CVB3 infection, myocyte architecture is clearly disrupted in tissue from IFN-ß^–/– mice (Figure 2b and 2c) compared with tissue from IFN-ß^+/+ mice (Figure 2a). Examination of myocyte architecture in tissues from IFN-ß^–/– mice that had died on day 4 (Figure 2c) or had survived (Figure 2b) identified similar loss of organization. Notably, by day 7 after infection, myocyte architecture is disrupted in all mice (Figure 2d and 2e). We observed the area of myocardial lesions to be more extensive in IFN-ß^–/– than IFN-ß^+/+ tissue throughout the course of disease, with concomitant extensive cellular infiltration into the cardiac tissue of IFN-ß^–/– mice. Cellular infiltration was maximal in IFN-ß^–/– mice on day 7 and declined by day 10 after infection. At day 10, areas of pallor and persistent foci were consistently observed in IFN-ß^–/– mice tissue, indicative of virally mediated myocyte necrosis, which was absent in tissue from IFN-ß^+/+ mice (Figure 2f and 2g).

View larger version (118K): [in this window] [in a new window]   Figure 2. Histological analysis of CVB3-infected heart tissues. Representative hematoxylin and eosin–stained sections of hearts from IFN-ß+/+ (a, d, f) and IFN-ß–/– (b, e, g) mice harvested on days 4, 7, and 10 after CVB3 infection. Except for the tissue in c, namely sectioned tissue from a mouse that had died from infection, all sections are representative of tissues harvested from mice experiencing nonfatal infections. Magnification, x40.

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
The rapid induction of IFN-ß is a critical component of any innate immune response to viral infection. IFN-ß–mediated antiviral and immune modulatory responses determine the extent of virus spread and disease progression. IFN-induced viral clearance from different organs requires both the direct antiviral effects of IFN, ie, inhibition of viral replication in infected cells, and the induction of specific immune responses.⁸ In this study, we show that cardiotropic CVB3 infection is more aggressive in IFN-ß^–/– than in IFN-ß^+/+ mice, likely because of the blunted IFN response to infection. We provide evidence for an incomplete IFN response to CVB3 infection of heart tissue, specifically in the context of ISGs implicated in mediating IFN-inducible antiviral responses: 2'-5' OAS, Mx, and PKR. The dsRNA-activated 2'-5' OAS and PKR invoke the degradation of viral RNA and inhibit viral RNA translation, respectively,^15,16 and dsRNA is an intermediate of viral replication. The GTPase Mx limits CVB infection by preventing the accumulation of viral RNA and capsid protein.¹⁷

In contrast to A/J mice, which are highly susceptible to CVB3 infection,¹⁸ 129/Sv and C57Bl/6 mice are reportedly relatively resistant to infection.^9,19 In agreement, our mixed-strain 129/Bl6F₂ IFN-ß^+/+ mice exhibited minimal symptoms of disease, as evidenced by no mortality and limited cardiac histopathology. Therefore, we infer that the aggressive disease observed in the IFN-ß^–/– mice specifically reflects the absence of IFN-ß, unrelated to the mouse strain.

In accordance with findings in IFNAR1^–/– mice infected with CVB3,⁹ we observed high viral loads in spleen, liver, and hearts early during the course of infection in IFN-ß^–/– mice. Apparently, these high viral loads correlate with severity of disease for both IFNAR1^–/– and IFN-ß^–/– mice. Specifically, failure to clear virus rapidly from spleen and liver is associated with fatal disease. Notably, the mortality rate in IFNAR1^–/– mice infected with CVB3 is higher than what we observe for IFN-ß^–/– mice. Because IFNAR1^–/– mice cannot respond to either IFN- or IFN-ß yet IFN-ß^–/– mice will elicit a virus-inducible IFN- response, albeit a severely restricted one,¹³ we attribute the lower mortality rate in the IFN-ß^–/– mice to a residual IFN- antiviral response.

Given that cardiomyocytes do not regenerate adequately, the extent of the antiviral and immune response to infection is critical in determining outcome with regard to cardiac damage and cardiac function. In our studies, we observe considerable cellular infiltration and myocarditis by day 7 after CVB3 infection for IFN-ß^–/– mice. In contrast, the extent of cellular infiltration and severity of myocardial lesions were less in the IFN-ß^+/+ mice. Previous studies have identified T cells as the predominant cells infiltrating CVB3-infected myocardium, providing evidence for T cell–mediated cardiac damage.¹⁸ Specifically, T-cell effector functions may promote tissue damage via excessive cytokine activation and cytotoxic responses. Our findings in IFN-ß^–/– mice would support a role for destructive elements associated with extensive cellular infiltration of the myocardium. Viewed together, these data confirm a critical role for IFN-ß in mediating protection from CVB3 infection and subsequent cardiomyopathy.

	Acknowledgments

 
This work was supported by Canadian Institutes of Health Research (CIHR) grant MOP 15094 to Dr Fish and CIHR and Heart and Stroke Foundation grants to Dr Liu. Dr Liu holds the Heart & Stroke/Polo Chair Professor of Medicine and Physiology at the University of Toronto. We thank Dr W.H. Wen for valuable technical assistance.

	References

Top Abstract Introduction Methods Results Discussion References

 

1. Baboonian C, Davies MJ, Booth JC, et al. Coxsackie B viruses and human heart disease. Curr Top Microbiol Immunol. 1997; 223: 31–52.[Medline] [Order article via Infotrieve]
   
2. Liu PP, Mason JW. Advances in the understanding of myocarditis. Circulation. 2001; 104: 1076–1082.[Free Full Text]
   
3. Klingel K, Rieger P, Mall G, et al. Visualization of enteroviral replication in myocardial tissue by ultrastructural in situ hybridization: identification of target cells and cytopathic effects. Lab Invest. 1998; 78: 1227–1237.[Medline] [Order article via Infotrieve]
   
4. Heim A, Grumbach I, Hake S, et al. Enterovirus heart disease of adults: a persistent, limited organ infection in the presence of neutralizing antibodies. J Med Virol. 1997; 53: 196–204.[CrossRef][Medline] [Order article via Infotrieve]
   
5. Archard LC, Khan MA, Soteriou BA, et al. Characterization of Coxsackie B virus RNA in myocardium from patients with dilated cardiomyopathy by nucleotide sequencing of reverse transcription-nested polymerase chain reaction products. Hum Pathol. 1998; 29: 578–584.[CrossRef][Medline] [Order article via Infotrieve]
   
6. Gelfand HM. The occurrence in nature of the Coxsackie and ECHO viruses. Prog Med Virol. 1961; 3: 193–244.[Medline] [Order article via Infotrieve]
   
7. Herzum M, Ruppert V, Kuytz B, et al. Coxsackievirus B3 infection leads to cell death of cardiac myocytes. J Mol Cell Cardiol. 1994; 26: 907–913.[CrossRef][Medline] [Order article via Infotrieve]
   
8. Brierley MM, Fish EN. IFN-/ß receptor interactions to biologic outcomes: understanding the circuitry. J Interferon Cytokine Res. 2002; 22: 835–845.[CrossRef][Medline] [Order article via Infotrieve]
   
9. Wessely R, Klingel K, Knowlton KU, et al. Cardioselective infection with coxsackievirus B3 requires intact type I interferon signaling: implications for mortality and early viral replication. Circulation. 2001; 103: 756–761.[Abstract/Free Full Text]
   
10. Padalko E, Nuyens D, De Palma A, et al. The interferon inducer ampligen [poly(I)-poly(C12U)] markedly protects mice against Coxsackie B3 virus-induced myocarditis. Antimicrob Agents Chemother. 2004; 48: 267–274.[Abstract/Free Full Text]
    
11. Heim A, Stille-Seigener M, Pring-Akerblom P, et al. Recombinant interferons beta and gamma have a higher antiviral activity than interferon-alpha in coxsackievirus B3-infected carrier state cultures of human myocardial fibroblasts. J Interferon Cytokine Res. 1996; 16: 283–287.[Medline] [Order article via Infotrieve]
    
12. Deonarain R, Verma A, Porter AC, et al. Critical roles for IFN-beta in lymphoid development, myelopoiesis, and tumor development: links to tumor necrosis factor alpha. Proc Natl Acad Sci U S A. 2003; 100: 13453–13458.[Abstract/Free Full Text]
    
13. Deonarain R, Alcami A, Alexiou M, et al. Impaired antiviral response and alpha/beta interferon induction in mice lacking beta interferon. J Virol. 2000; 74: 3404–3409.[Abstract/Free Full Text]
    
14. Van Houten N, Bouchard PE, Moraska A, et al. Selection of an attenuated coxsackievirus B3 variant, using a monoclonal antibody reactive to myocyte antigen. J Virol. 1991; 65: 1286–1290.[Abstract/Free Full Text]
    
15. Panet A. Regulation of the antiviral and anticellular activities of interferon by exogenous double-stranded RNA. Mol Cell Biochem. 1983; 52: 153–160.[Medline] [Order article via Infotrieve]
    
16. Stewart MJ, Blum MA, Sherry B. PKR’s protective role in viral myocarditis. Virology. 2003; 314: 92–100.[CrossRef][Medline] [Order article via Infotrieve]
    
17. Chieux V, Chehadeh W, Harvey J, et al. Inhibition of coxsackievirus B4 replication in stably transfected cells expressing human MxA protein. Virology. 2001; 283: 84–92.[CrossRef][Medline] [Order article via Infotrieve]
    
18. Opavsky MA, Penninger J, Aitken K, et al. Susceptibility to myocarditis is dependent on the response of ß T lymphocytes to coxsackieviral infection. Circ Res. 1999; 85: 551–558.[Abstract/Free Full Text]
    
19. Opavsky MA, Martino T, Rabinovitch M, et al. Enhanced ERK-1/2 activation in mice susceptible to coxsackievirus-induced myocarditis. J Clin Invest. 2002; 109: 1561–1569.[CrossRef][Medline] [Order article via Infotrieve]
    

This article has been cited by other articles:

				Y.-X. Wang, V. da Cunha, J. Vincelette, K. White, S. Velichko, Y. Xu, C. Gross, R. M. Fitch, M. Halks-Miller, B. R. Larsen, et al. Antiviral and myocyte protective effects of murine interferon-beta and -{alpha}2 in coxsackievirus B3-induced myocarditis and epicarditis in Balb/c mice Am J Physiol Heart Circ Physiol, July 1, 2007; 293(1): H69 - H76. [Abstract] [Full Text] [PDF]

				R. Burdeinick-Kerr, J. Wind, and D. E. Griffin Synergistic Roles of Antibody and Interferon in Noncytolytic Clearance of Sindbis Virus from Different Regions of the Central Nervous System J. Virol., June 1, 2007; 81(11): 5628 - 5636. [Abstract] [Full Text] [PDF]

				Y. Maekawa, M. Ouzounian, M. A. Opavsky, and P. P. Liu Connecting the Missing Link Between Dilated Cardiomyopathy and Viral Myocarditis: Virus, Cytoskeleton, and Innate Immunity Circulation, January 2, 2007; 115(1): 5 - 8. [Full Text] [PDF]

				T. Yajima, H. Yasukawa, E.-S. Jeon, D. Xiong, A. Dorner, M. Iwatate, M. Nara, H. Zhou, D. Summers-Torres, M. Hoshijima, et al. Innate Defense Mechanism Against Virus Infection Within the Cardiac Myocyte Requiring gp130-STAT3 Signaling Circulation, November 28, 2006; 114(22): 2364 - 2373. [Abstract] [Full Text] [PDF]

				K. E. Thomas, C. L. Galligan, R. D. Newman, E. N. Fish, and S. N. Vogel Contribution of Interferon-beta to the Murine Macrophage Response to the Toll-like Receptor 4 Agonist, Lipopolysaccharide J. Biol. Chem., October 13, 2006; 281(41): 31119 - 31130. [Abstract] [Full Text] [PDF]

				N. Gerlach, S. Schimmer, S. Weiss, U. Kalinke, and U. Dittmer Effects of type I interferons on friend retrovirus infection. J. Virol., April 1, 2006; 80(7): 3438 - 3444. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 110/23/3540    most recent 01.CIR.0000136824.73458.20v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Deonarain, R. Articles by Fish, E. N. Search for Related Content PubMed PubMed Citation Articles by Deonarain, R. Articles by Fish, E. N. Pubmed/NCBI databases Gene GEO Profiles HomoloGene UniGene Substance via MeSH Medline Plus Health Information Cardiomyopathy Related Collections Animal models of human disease Gene expression Genetically altered mice