Published online before print August 2, 2004, doi: 10.1161/01.CIR.0000138849.03311.C6
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Circulation. 2004;110:770-775.)
© 2004 American Heart Association, Inc.
Original Articles |
Troponin I Isoform Expression in Human and Experimental Atrial Fibrillation
From the Cardiovascular Research Institute Maastricht, University Maastricht, Maastricht, Netherlands (V.L.J.L.T., J.A., M.A.A., M.B., G.J.J.M.v.E.); Department of Biomedical Sciences, University of Padova, Padova, Italy (L.G.); Department of Medical Physiology, University Medical Centre Utrecht, Utrecht, Netherlands (H.M.W.v.d.V.); and Department of Cardiology, Thoraxcenter University Hospital, University of Groningen, Groningen, Netherlands (I.C.V.).
Correspondence to V.L.J.L. Thijssen, PhD, Angiogenesis Laboratory, Department of Pathology, Academic Hospital Maastricht, PO Box 5800, 6202 AZ Maastricht, Netherlands. E-mail v.thijssen{at}path.unimaas.nl
Received November 18, 2003; de novo received January 26, 2004; revision received March 23, 2004; accepted April 9, 2004.
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Background— Atrial fibrillation (AF) is accompanied by re-expression of fetal genes and activation of proteolytic enzymes. In this study both aspects were addressed with respect to troponin I (TnI) isoform expression.
Methods and Results— Western blotting and real-time reverse transcription–polymerase chain reaction were used to study TnI isoform expression in patients with paroxysmal or chronic AF and in goats after 1, 2, 4, 8, and 16 weeks of AF. In addition to cardiac TnI (cTnI), low expression of slow-twitch skeletal TnI (ssTnI) protein was found in 60% of patients in sinus rhythm or paroxysmal AF and in 8% of patients with chronic AF. In adult goat atrium, ssTnI protein expression was undetectable. Calcium-dependent degradation of cTnI protein was found in 1 or 2 of 6 animals after 1 to 4 weeks of AF. Although always low, ssTnI mRNA levels were significantly higher in patients who expressed ssTnI protein than in those who did not. Relative ssTnI mRNA expression was significantly lower in patients with paroxysmal AF and chronic AF than in those in sinus rhythm. In goats there was a tendency toward higher relative levels of ssTnI at the onset of AF followed by a normalization when AF had become sustained.
Conclusions— Atrial re-expression of ssTnI during paroxysmal AF in patients and during the first 2 weeks of pacing-induced AF in goats does not seem to be part of the process of AF-associated cardiomyocyte dedifferentiation but seems to result from transient cardiomyocyte stress at the onset of AF.
Key Words: atrial fibrillation • troponin I • myocytes, cardiac • gene expression • atrium
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Atrial fibrillation (AF) is accompanied by electric, structural, and contractile remodeling of the atrium that results in reduced atrial function. In both patients and animal models, it has been shown that the structural alterations are indicative of cardiomyocyte dedifferentiation.1–3 Atrial cardiomyocyte dedifferentiation is accompanied by protein expression and cellular organization patterns that are reminiscent of fetal cardiomyocytes, eg, titin, desmin, cardiotin,
-smooth muscle cell actin, and - and ß-myosin heavy chains.3–5 Using differential display, we also found downregulation of cardiac troponin I (cTnI) mRNA expression in the goat model of AF.5 In the adult heart, this cTnI is the main troponin isoform, whereas the fetal human heart predominantly expresses the slow-twitch skeletal TnI (ssTnI) isoform.6–9 Until now, re-expression of the ssTnI isoform has not been detected during cardiac disease.6,10,11 Recently, it was shown that activation of calpains was responsible for elevated TnI degradation during increased preload or hypoxia.12,13 Activation of calpains has also been found during AF.14 As a consequence, AF might result in calpain-controlled degradation of cTnI, which could affect the contractile function of the atrium. To elucidate the involvement of changes in TnI isoform expression in cardiomyocyte dedifferentiation and contractile dysfunction during AF, we analyzed TnI isoform composition at the protein and mRNA levels in patients with AF and in a goat model.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Human Tissue
Human tissue from right atrial appendages was obtained from patients with the following: (1) sinus rhythm (n=5) undergoing coronary bypass surgery; (2) mitral valve disease and sinus rhythm (n=4); (3) mitral valve disease and chronic AF (n=4); (4) lone paroxysmal AF (n=6); and (5) lone chronic AF (n=8). Atrial tissue was obtained during surgery, snap-frozen in liquid nitrogen, and stored at –80°C. The patients with lone AF underwent MAZE surgery, and none of these patients suffered from any underlying cardiac disease. Patients’ characteristics have been described previously.15,16 All the patients gave their written consent, and the study was approved by the institutional review board. Infarcted human heart samples were kindly provided by Dr F. Dal Monte, Cardiovascular Research Center, Massachusetts General Hospital, Boston.
Animal Tissue
The goat model of AF was essentially as described by Ausma et al.17 A total of 36 goats were used, and animal handling was performed according to the Dutch Law on Animal Experimentation and the European Directive for Protection of Vertebrate Animals Used for Experimental and Other Scientific Purposes. Right and left atrial appendages were obtained from animals that had remained in sinus rhythm or after 1, 2, 4, 8, and 16 weeks of AF (n=6 in each group). Hearts from fetuses (n=5) at different days of gestation (4 weeks before end term up to a few days before birth) were obtained from the abattoir. Tissues were immediately frozen in liquid nitrogen–precooled isopentane. From 1 adult animal, additional tissues were taken (skeletal muscle, diaphragm).
Western Blotting
Monoclonal antibodies that react specifically with the cTnI isoform (TI-1) or with both cTnI and ssTnI (TI-4) were used.18 Equal protein amounts were separated on polyacrylamide gels, transferred onto nitrocellulose filters, and incubated with primary antibody (TI-4, 1:3000; TI-1, 1:1000). After a second incubation with peroxidase-conjugated secondary antibody (1:5000), the peroxidase activity was determined by enhanced chemiluminescence. As control for TnI degradation, the homogenization of goat atrial sections was preceded by incubation in propionate buffer for 30 minutes at 37°C in the presence or absence of 10 mmol/L CaCl2 as previously described.19 Additional experiments were performed in the presence of the calpain inhibitor calpeptin (Z-Leu-Nle-CHO, Novabiochem).
Isolation of Goat cTnI and ssTnI cDNA
To obtain the goat-specific sequence for cTnI, a goat atrial cDNA library was screened according to standard procedures, with human cTnI used as a probe. The goat-specific sequence of ssTnI was obtained by rapid amplification of cDNA ends (5'RACE-kit, Life Technologies) from 1 µg of RNA isolated from goat diaphragm tissue. Gene-specific primer (GSP) sequences (GSP-1: CCCGCAGATCCATGGACACCTTGTG; GSP-2: CGCTTGAACTTCCCACGGAGGTC) were based on homologies between ssTnI of human, rat, and mouse.
Quantitative Real-Time Reverse Transcription–Polymerase Chain Reaction
Total RNA was isolated from a 30-mg atrial appendage with the use of the RNeasy mini kit (Qiagen). Genomic DNA contamination was removed by on-column DNase treatment with the RNase-free DNase set (Qiagen). After reverse transcription, quantitative real-time reverse transcription–polymerase chain reaction (RT-PCR) was performed with the Real-Time PCR Taqman Kit (Eurogentec) with the ABI PRISM 7700 Sequence Detection System apparatus and software (PE Applied Biosystems). Primer Express software (PE Applied Biosystems) was used to design the specific primers and probes, and all primers/probes were synthesized by Eurogentec (human cTnI: forward GCCCACCTCAAGCAGGTG, reverse TTGCGCCAGTCTCCCACCTC, probe TAMRA-AGAAGGAGGACACGGAGAAGGAAAACCG-DABCYL; human ssTnI: forward GCCCACCTCAAGCAGGTG, reverse CATCAGGCTCTTCAGCAAGAG, probe FAM-CCCAAGATCACTGCCTCCCGCA-DABCYL; goat cTnI: forward GCCCACCTCAAGCAGGTG, reverse TTGCGCCAGTCTCCTACCTC, probe TAMRA-AGAAGGAGGACACGGAGAAGGAAAACCG-DABCYL; goat ssTnI: forward CATGCCGGAAGTCGAGAGAAA, reverse CATCAGGCTCTTCAGCAGGAG, probe FAM-CCCAAGATCACTGCCTCCCGCA-DABCYL). Absolute mRNA amounts were calculated with the use of standard curves generated by quantitative RT-PCR on dilution series of cloned cTnI and ssTnI.
Statistical Analysis
Data are displayed as mean±SEM values of 3 independent experiments. Mean values were used for statistical analysis. Significant differences between the groups were analyzed by means of the Wilcoxon-Mann-Whitney rank sum test. All probability values are 2 sided, and probability values <0.05 were considered statistically significant. Statistical computations were performed in SPSS 10.0.5.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
TnI Protein Expression During AF
To establish whether AF can affect TnI isoform expression, we performed Western blotting on atrial tissue from patients with AF. The patients could be divided into 3 groups when atrial rhythmic activity was used as the sole selection criterion (Table 1): sinus rhythm (n=9), paroxysmal AF (n=6), and chronic AF (n=12). When the underlying disease was taken into account, 5 different groups could be distinguished: normal sinus rhythm (n=5), mitral valve disease and sinus rhythm (n=4), mitral valve disease and chronic AF (n=4), lone paroxysmal AF (n=6), and lone chronic AF (n=8). Western blot of human skeletal muscle with an antibody that recognizes both cardiac and skeletal TnI (TI-4) revealed 2 bands, representing ssTnI and fast-twitch skeletal TnI (fsTnI) (Figure 1A, top). In human cardiac tissue, a prominent band of lower mobility was detected, representing cTnI (Figure 1A, top). Several patients displayed a faint band with the same electrophoretic mobility as the ssTnI band in skeletal muscle. To distinguish between cTnI degradation and ssTnI expression, Western blotting was also performed with a cTnI-specific antibody (TI-1). No bands were detected with human skeletal muscle, proving TI-1 specificity. None of the atrial samples displayed reactivity with TI-1 on the minor band, at variance with infarcted myocardium (Figure 1A, bottom). The latter shows that cTnI degradation does not result in loss of the TI-1 epitope. Additionally, multiple degradation products reacted with TI-4 (lane MI Figure 1A, top). These results indicate that the additional band decorated by TI-4 in atrial samples corresponds to ssTnI.
|
|
To determine whether ssTnI re-expression could result from ongoing dedifferentiation, the TnI isoform expression was analyzed in the goat model, in which AF-induced dedifferentiation of atrial cardiomyocytes has been studied extensively. Western blotting with TI-4 on adult goat heart revealed a single cTnI band. In fetal heart, both cTnI and ssTnI isoforms were present, and skeletal muscle contained the ssTnI as well as the fsTnI isoforms (Figure 1B). TI-1 reacted only with the slower TnI isoform in fetal heart sample and with the isoform present in the adult heart, corresponding to cTnI (not shown). To determine whether TI-1 was able to detect cTnI degradation, atrial tissue from goats in sinus rhythm was treated with high levels of calcium. As observed for human infarcted myocardium, a cTnI degradation product retaining the T1-1 epitope could be observed (Figure 1C). This band was less intense in the presence of the calpain inhibitor calpeptin. On Western blot analysis with the TI-4 antibody, an additional band was detected in only a few atrial samples (not shown). The band was also detected by TI-1, indicative of cTnI degradation (Figure 1D). Western blot results are summarized in Table 2.
|
TnI mRNA Expression During AF
Next, quantitative RT-PCR was performed to analyze changes at the TnI mRNA expression levels in atrial tissue samples from patients and goats with AF. During normal sinus rhythm, the cTnI mRNA amount in human atrial tissue was approximately 600-fold higher than that of ssTnI mRNA (Table 3). Either mitral valve disease or AF increased this value to approximately 2200-fold (P<0.05), and the combination increased this value to 3500-fold (P<0.05). The amount of cTnI mRNA over ssTnI mRNA was lower in patients displaying an ssTnI band in Western blotting compared with those who did not (1200-fold versus 2600-fold; P<0.05).
|
To perform quantitative RT-PCR in the goat model, cDNAs of the different goat TnI isoforms were isolated. A partial cDNA encoding 330 nucleotides of the 3' end of cTnI (GenBank accession number: AY033589) was picked up from a goat atrium cDNA library. Overall homology with human cTnI was approximately 90% at the nucleotide level and 97% at the protein level (Figure 2A). A partial cDNA of ssTnI (GenBank accession number: AY033587) containing 330 nucleotides of the 5' end was isolated with the use of 5' RACE. Homologies at the nucleotide and the protein level were 88% and 93%, respectively (Figure 2B). Goat specific primers/probe combinations were designed for quantitative RT-PCR (Figure 2C). A control PCR with cTnI primers on a dilution series of the partial cTnI cDNA from the goat generated an amplicon of the expected size (Figure 2D, top right inset). Figure 2D shows the amplification plots obtained during quantitative RT-PCR on the same dilution series that was used to generate a standard curve (Figure 2D, top left inset). The standard curve had a linear detection range down to 10 pg DNA. Similar results were obtained for ssTnI (data not shown).
|
In fetal goats, atrial expression of cTnI mRNA was only 30-fold higher than that of ssTnI, whereas in adult goats, the cTnI mRNA expression level was approximately 11 000-fold higher. In animals that had been in AF, there were no significant changes in the atrial expression levels of cTnI and ssTnI mRNA. However, there appeared to be a tendency toward a lower cTnI over ssTnI expression at the onset of AF, followed by a normalization after longer periods of AF. This was confirmed by a significant difference in the level of expression after 2 weeks of AF compared with 16 weeks of AF (3200-fold versus 12 000-fold, respectively; P<0.05).
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Throughout cardiac development, 2 TnI isoforms are expressed in the heart.6,7 Expression of the slow-twitch skeletal isoform decreases around birth, together with an increase in expression of the cardiac isoform. Consequently, the TnI isoform expression pattern reflects the differentiation state of the cardiomyocyte, which might be used to monitor AF-induced cardiomyocyte dedifferentiation. In addition to cardiomyocyte dedifferentiation, a relation has been found between AF and the activity of calpain I,14 a protease involved in cTnI degradation.12,13 In this study the effect of AF on the atrial TnI composition in patients with AF and mitral valve disease was evaluated. The goat model of AF was included to study the alterations in TnI composition at the onset of AF.
Western blot analysis revealed ssTnI expression in most patient groups, except for patients with chronic AF in the absence of any underlying heart disease (lone chronic AF). Until now, there have been no reports regarding ssTnI expression in adult cardiac tissue, except by Gorza et al9 and Zhu et al,20 who detected ssTnI mRNA in cells of the conductive tissue throughout adulthood. Because there is no evidence for the existence of significant numbers of cells specialized in conduction within the atrial appendages that could account for the observed levels of ssTnI protein, the re-expression of ssTnI appeared to support the hypothesis that AF results in cardiomyocyte dedifferentiation.3–5 However, of 12 patients with chronic AF, only 1 displayed atrial ssTnI expression. This discrepancy might be a consequence of the persistent character of the atrial arrhythmic activity during chronic AF. In patients with lone paroxysmal AF, the repetitive cycles of AF followed by sinus rhythm might result in the repeated activation of ssTnI expression, whereas in patients with chronic AF, normalization of expression occurs. This is supported by the absence of ssTnI expression in the goat model, which is a model for chronic AF.
The fact that ssTnI expression was also observed in patients with sinus rhythm suggests that in these patients the underlying cardiac disease (coronary ischemia) also triggered ssTnI expression, possibly by repetitive atrial stress (eg, ischemia, stretch). The rationale behind re-expression of ssTnI is not known, but it has been suggested that myofilaments with ssTnI are more resistant to acidosis and have increased calcium sensitivity.21,22
AF is also accompanied by activation of calpain I,14 a calcium-dependent proteolytic enzyme for which cTnI has been shown to be a substrate.12,13,23 In the present study no sign of cTnI degradation was seen in any of the patients. It is possible that, although our cTnI-specific antibody can detect a cTnI degradation product in human infarct hearts, other proteolytic modifications, as described by McDonough et al,24 were not detected. However, cTnI degradation may also depend on the duration and severity of cardiac stress. Thomas et al25 did not find increased cTnI degradation in a swine model of stunned myocardium, representing mild cardiac stress. In most studies that find cTnI degradation, it was observed in the time frame immediately after an acute and severe cardiac stress.13,23,26 This would explain why some level of cTnI degradation was detected during the first 1 to 4 weeks of AF in the goats. The patients described in this study all suffered for prolonged periods of time from heart disease and/or AF. During such long periods of cardiac stress, cTnI might be protected from degradation through an increased expression of heat shock proteins27,28 or an increased cTnI phosphorylation.29
Further analysis of TnI isoform expression was performed by quantitative RT-PCR. During sinus rhythm, low levels of atrial ssTnI expression were detectable. Previous studies, in which in situ hybridization or Northern blotting was used, did not find any evidence for the presence of ssTnI mRNA in normal adult cardiac tissue or re-expression of ssTnI during cardiac disease.6,8,9 However, quantitative RT-PCR is more sensitive than these techniques. Calculation of the absolute TnI mRNA content in atrial tissue during sinus rhythm showed that cTnI was expressed at a 600-fold higher level than ssTnI. In patients with an ssTnI band on the Western blot, the relative expression of ssTnI was significantly higher than that in patients with no detectable ssTnI band.
Mitral valve disease, paroxysmal AF, or chronic AF increased the level of cTnI mRNA, which could have several causes. First, cTnI mRNA turn-over might be increased. Second, it might reflect cardiomyocyte hypertrophy, which has been shown to occur during AF.1,2 Third, cTnI expression upregulation could be a response to an altered calcium sensitivity of cTnI as a result of increased cTnI phosphorylation.30,31 Finally, the increased expression of cTnI might represent the response of the cardiomyocyte to counterbalance alterations in calcium homeostasis to maintain optimal contractile activity. The latter is supported by observations in patients with chronic AF, in whom the reduced contractile force could be completely restored by high calcium levels.32
On the basis of our observations, we propose the following model for TnI expression regulation (Figure 3). At the onset of AF, increased atrial activity and ischemia result in calcium overload, leading to decreased calcium sensitivity and to the activation of calpain I, causing cTnI degradation. Re-expression of ssTnI, which protects the cardiomyocyte from acidic stress and improves the calcium sensitivity, is a response to this unstable early phase. After a longer duration of AF, calcium homeostasis normalizes, ssTnI expression decreases, and protection against excessive cTnI degradation may be achieved by cTnI phosphorylation. In addition, the cTnI expression is upregulated, either as compensation for the decreased calcium sensitivity of phosphorylated cTnI or because of a hypertrophic response. During paroxysmal AF, the recurring AF episodes compromise the stabilization, which results in repeated activation of ssTnI expression and cTnI phosphorylation. Thus, rather than cardiomyocyte dedifferentiation, the expression of TnI isoforms appears to be involved in protection of the contractile apparatus against the cellular stress induced by AF. The mechanisms of this protective response, ie, cTnI degradation, ssTnI expression, cTnI re-expression, and cTnI phosphorylation, are likely to contribute to the contractile dysfunction.
|
|
Acknowledgments |
|---|
The authors would like to thank H. Kuijpers and M.-H. Lenders for their excellent technical assistance throughout this study.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
- Ausma J, Wijffels M, Thone F, Wouters L, Allessie M, Borgers M. Structural changes of atrial myocardium due to sustained atrial fibrillation in the goat. Circulation. 1997; 96: 3157–3163.
[Abstract/Free Full Text]
- Thijssen V, Ausma J, Borgers M. Structural remodelling during chronic atrial fibrillation: act of programmed cell survival. Cardiovasc Res. 2001; 52: 14–20.
[Abstract/Free Full Text]
- Rucker-Martin C, Pecker F, Godreau D, Hatem SN. Dedifferentiation of atrial myocytes during atrial fibrillation: role of fibroblast proliferation in vitro. Cardiovasc Res. 2002; 55: 38–52.[CrossRef][Medline]
[Order article via Infotrieve]
- Ausma J, Wijffels M, van Eys G, Koide M, Ramaekers F, Allessie M, Borgers M. Dedifferentiation of atrial cardiomyocytes as a result of chronic atrial fibrillation. Am J Pathol. 1997; 151: 985–997.[Abstract]
- Thijssen VL, van der Velden HM, van Ankeren EP, Ausma J, Allessie MA, Borgers M, van Eys GJ, Jongsma HJ. Analysis of altered gene expression during sustained atrial fibrillation in the goat. Cardiovasc Res. 2002; 54: 427–437.
[Abstract/Free Full Text]
- Sasse S, Brand NJ, Kyprianou P, Dhoot GK, Wade R, Arai M, Periasamy M, Yacoub MH, Barton PJ. Troponin I gene expression during human cardiac development and in end-stage heart failure. Circ Res. 1993; 72: 932–938.
[Abstract/Free Full Text]
- Bhavsar PK, Dhoot GK, Cumming DV, Butler-Browne GS, Yacoub MH, Barton PJ. Developmental expression of troponin I isoforms in fetal human heart. FEBS Lett. 1991; 292: 5–8.[CrossRef][Medline]
[Order article via Infotrieve]
- Hunkeler NM, Kullman J, Murphy AM. Troponin I isoform expression in human heart. Circ Res. 1991; 69: 1409–1414.
[Abstract/Free Full Text]
- Gorza L, Ausoni S, Merciai N, Hastings KE, Schiaffino S. Regional differences in troponin I isoform switching during rat heart development. Dev Biol. 1993; 156: 253–264.[CrossRef][Medline]
[Order article via Infotrieve]
- Bodor GS, Oakeley AE, Allen PD, Crimmins DL, Ladenson JH, Anderson PA. Troponin I phosphorylation in the normal and failing adult human heart. Circulation. 1997; 96: 1495–1500.
[Abstract/Free Full Text]
- McConnell BK, Moravec CS, Bond M. Troponin I phosphorylation and myofilament calcium sensitivity during decompensated cardiac hypertrophy. Am J Physiol. 1998; 274: H385–H396.[Medline]
[Order article via Infotrieve]
- Kositprapa C, Zhang B, Berger S, Canty JJ, Lee T. Calpain-mediated proteolytic cleavage of troponin I induced by hypoxia or metabolic inhibition in cultured neonatal cardiomyocytes. Mol Cell Biochem. 2000; 214: 47–55.[CrossRef][Medline]
[Order article via Infotrieve]
- Feng J, Schaus BJ, Fallavollita JA, Lee TC, Canty JM Jr. Preload induces troponin I degradation independently of myocardial ischemia. Circulation. 2001; 103: 2035–2037.
[Abstract/Free Full Text]
- Brundel BJ, Ausma J, van Gelder IC, Van der Want JJ, van Gilst WH, Crijns HJ, Henning RH. Activation of proteolysis by calpains and structural changes in human paroxysmal and persistent atrial fibrillation. Cardiovasc Res. 2002; 54: 380–389.
[Abstract/Free Full Text]
- Brundel BJ, Van Gelder IC, Henning RH, Tieleman RG, Tuinenburg AE, Wietses M, Grandjean JG, Van Gilst WH, Crijns HJ. Ion channel remodeling is related to intraoperative atrial effective refractory periods in patients with paroxysmal and persistent atrial fibrillation. Circulation. 2001; 103: 684–690.
[Abstract/Free Full Text]
- Tuinenburg AE, Brundel BJ, Van Gelder IC, Henning RH, Van Den Berg MP, Driessen C, Grandjean JG, Van Gilst WH, Crijns HJ. Gene expression of the natriuretic peptide system in atrial tissue of patients with paroxysmal and persistent atrial fibrillation. J Cardiovasc Electrophysiol. 1999; 10: 827–835.[Medline]
[Order article via Infotrieve]
- Ausma J, Dispersyn GD, Duimel H, Thone F, Ver Donck L, Allessie MA, Borgers M. Changes in ultrastructural calcium distribution in goat atria during atrial fibrillation. J Mol Cell Cardiol. 2000; 32: 355–364.[CrossRef][Medline]
[Order article via Infotrieve]
- Saggin L, Gorza L, Ausoni S, Schiaffino S. Troponin I switching in the developing heart. J Biol Chem. 1989; 264: 16299–16302.
[Abstract/Free Full Text]
- Gorza L, Menabo R, Vitadello M, Bergamini CM, Di Lisa F. Cardiomyocyte troponin T immunoreactivity is modified by cross-linking resulting from intracellular calcium overload. Circulation. 1996; 93: 1896–1904.
[Abstract/Free Full Text]
- Zhu L, Lyons GE, Juhasz O, Joya JE, Hardeman EC, Wade R. Developmental regulation of troponin I isoform genes in striated muscles of transgenic mice. Dev Biol. 1995; 169: 487–503.[CrossRef][Medline]
[Order article via Infotrieve]
- Wolska BM, Vijayan K, Arteaga GM, Konhilas JP, Phillips RM, Kim R, Naya T, Leiden JM, Martin AF, de Tombe PP, Solaro RJ. Expression of slow skeletal troponin I in adult transgenic mouse heart muscle reduces the force decline observed during acidic conditions. J Physiol. 2001; 536: 863–870.
[Abstract/Free Full Text]
- Westfall MV, Albayya FP, Metzger JM. Functional analysis of troponin I regulatory domains in the intact myofilament of adult single cardiac myocytes. J Biol Chem. 1999; 274: 22508–22516.
[Abstract/Free Full Text]
- Gao WD, Atar D, Liu Y, Perez NG, Murphy AM, Marban E. Role of troponin I proteolysis in the pathogenesis of stunned myocardium. Circ Res. 1997; 80: 393–399.[Medline]
[Order article via Infotrieve]
- McDonough JL, Labugger R, Pickett W, Tse MY, MacKenzie S, Pang SC, Atar D, Ropchan G, Van Eyk JE. Cardiac troponin I is modified in the myocardium of bypass patients. Circulation. 2001; 103: 58–64.
[Abstract/Free Full Text]
- Thomas SA, Fallavollita JA, Lee TC, Feng J, Canty JM Jr. Absence of troponin I degradation or altered sarcoplasmic reticulum uptake protein expression after reversible ischemia in swine. Circ Res. 1999; 85: 446–456.
[Abstract/Free Full Text]
- Van Eyk JE, Powers F, Law W, Larue C, Hodges RS, Solaro RJ. Breakdown and release of myofilament proteins during ischemia and ischemia/reperfusion in rat hearts: identification of degradation products and effects on the pCa-force relation. Circ Res. 1998; 82: 261–271.
[Abstract/Free Full Text]
- Vitadello M, Ausma J, Borgers M, Gambino A, Casarotto DC, Gorza L. Increased myocardial GRP94 amounts during sustained atrial fibrillation: a protective response? Circulation. 2001; 103: 2201–2206.
[Abstract/Free Full Text]
- Schafler AE, Kirmanoglou K, Pecher P, Hannekum A, Schumacher B. Overexpression of heat shock protein 60/10 in myocardium of patients with chronic atrial fibrillation. Ann Thorac Surg. 2002; 74: 767–770.
[Abstract/Free Full Text]
- McDonough JL, Arrell DK, Van Eyk JE. Troponin I degradation and covalent complex formation accompanies myocardial ischemia/reperfusion injury. Circ Res. 1999; 84: 9–20.
[Abstract/Free Full Text]
- Wattanapermpool J, Guo X, Solaro RJ. The unique amino-terminal peptide of cardiac troponin I regulates myofibrillar activity only when it is phosphorylated. J Mol Cell Cardiol. 1995; 27: 1383–1391.[CrossRef][Medline]
[Order article via Infotrieve]
- Noland TA Jr, Guo X, Raynor RL, Jideama NM, Averyhart-Fullard V, Solaro RJ, Kuo JF. Cardiac troponin I mutants: phosphorylation by protein kinases C and A and regulation of Ca(2+)-stimulated MgATPase of reconstituted actomyosin S-1. J Biol Chem. 1995; 270: 25445–25454.
[Abstract/Free Full Text]
- Schotten U, Ausma J, Stellbrink C, Sabatschus I, Vogel M, Frechen D, Schoendube F, Hanrath P, Allessie MA. Cellular mechanisms of depressed atrial contractility in patients with chronic atrial fibrillation. Circulation. 2001; 103: 691–698.
[Abstract/Free Full Text]
This article has been cited by other articles:
 |
|
 |
|
  J. P. Davis and S. B. Tikunova Ca2+ exchange with troponin C and cardiac muscle dynamics Cardiovasc Res, March 1, 2008; 77(4): 619 - 626. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. P. Davis, C. Norman, T. Kobayashi, R. J. Solaro, D. R. Swartz, and S. B. Tikunova Effects of Thin and Thick Filament Proteins on Calcium Binding and Exchange with Cardiac Troponin C Biophys. J., May 1, 2007; 92(9): 3195 - 3206. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. El-Armouche, P. Boknik, T. Eschenhagen, L. Carrier, M. Knaut, U. Ravens, and D. Dobrev Molecular Determinants of Altered Ca2+ Handling in Human Chronic Atrial Fibrillation Circulation, August 15, 2006; 114(7): 670 - 680. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||