| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Circulation. 2006;114:2482-2489.)
© 2006 American Heart Association, Inc.
Molecular Cardiology |
From the Kathleen B. and Mason I. Lowance Center for Human Immunology, Department of Medicine (A.N., K.S., I.C., J.J.G., C.M.W.), and Department of Surgery, Division of Vascular Surgery (E.L.C.), Emory University School of Medicine, Atlanta, Ga.
Correspondence to Cornelia M. Weyand, MD, PhD, Lowance Center for Human Immunology, Emory University School of Medicine, 101 Woodruff Circle, 1003 WMRB, Atlanta, GA 30322. E-mail cweyand{at}emory.edu
Received June 9, 2006; revision received September 13, 2006; accepted September 29, 2006.
| Abstract |
|---|
|
|
|---|
Methods and Results pDCs were identified in 53% of carotid atheromas (n=30) in which they localized to the shoulder region and produced the potent immunoregulatory cytokine interferon (INF)-
. IFN-
transcript concentrations in atheroma tissues correlated strongly with plaque instability (P<0.0001). Plaque-residing pDCs responded to pathogen-derived motifs, CpG-containing oligodeoxynucleotides binding to toll-like receptor 9, with enhanced IFN-
transcription (P=0.03) and secretion (P=0.007). IFN-
emerged as a potent regulator of T-cell function, even in the absence of antigen recognition. Specifically, IFN-
induced a 10-fold increase of tumor necrosis factorrelated apoptosis-inducing ligand (TRAIL) on the surface of CD4 T cells (P<0.0001) and enabled them to effectively kill vascular smooth muscle cells (P=0.0003).
Conclusions pDCs in atherosclerotic plaque sense microbial motifs and amplify cytolytic T-cell functions, thus providing a link between host-infectious episodes and acute immune-mediated complications of atherosclerosis.
Key Words: immune system inflammation lymphocytes muscle, smooth plaque rupture plasmacytoid dendritic cell toll-like receptor
| Introduction |
|---|
|
|
|---|
Dendritic cells (DCs) residing in the plaque may facilitate in situ T-cell activation.9 DCs activate T cells by presenting antigen and providing costimulatory signals. DCs also affect T cells in an antigen-independent way by secreting cytokines, such as interleukin (IL)-12, which regulate the recruitment of plaque-infiltrating CD4 T cells.10 DCs colocalize with T cells in the plaque, emphasizing their potential role in modulating T-cell function in vivo.11,12 The presence of DCs in rupture-prone areas of the atheroma raises the possibility that they interfere directly with tissue-damaging effector pathways.9,12
Clinical Perspective p 2489
The capacity of DCs to stimulate T cells depends crucially on their stage of maturation. Toll-like receptors (TLR) provide a powerful mechanism of DC maturation by recognizing pathogen-associated molecular patterns (PAMPs) that signal "danger" imposed by infection or tissue damage. Overexpression of TLR4 on circulating antigen-presenting cells in ACS and expression of TLR1, TLR2, and TLR4 in the atherosclerotic plaque have been described.1316 Candidate TLR ligands in the atherosclerotic plaque include microbes and (modified) autoantigens such as human heat shock protein 60 and oxidized low-density lipoprotein.1719
To date, studies have focused on CD11+ myeloid DCs in atherosclerotic plaques. However, DCs also include another major subtype, CD11CD123high plasmacytoid DCs (pDCs), which express TLR7 and TLR9.20 Oligodeoxynucleotides containing particular CpG motifs (CpG ODN) typically found in microbial DNA are recognized by TLR9 and facilitate abundant interferon (IFN)-
production.20
IFN-
is best known for its vital function in host immune responses that protect from infections. Specifically, IFN-
enhances cytotoxicity of CD8 and natural killer cells21 and induces the expansion and activation of Th1-polarized CD4 T cells.22,23 IFN-
amplifies the ability of CD4 T cells to kill tumor cells.24 Proapoptotic effects of CD4 T cells have recently been implicated in tissue-injurious responses in atherosclerotic plaques.25 TNF-related apoptosis-inducing ligand (TRAIL) is expressed on CD4 T cells and binds to death receptor (DR)5, which is upregulated on stressed VSMCs.8 DR5 ligation initiates the death pathway leading to VSMC apoptosis, a mechanism proposed to contribute to weakening of the fibrous cap.2628
We examined whether pDCs have immunoregulatory functions in the atherosclerotic plaque and respond to PAMPs. We further investigated the role of IFN-
in regulating T-cell function through the induction of TRAIL, a powerful mediator of apoptosis implicated in cell death associated with plaque vulnerability.
| Methods |
|---|
|
|
|---|
3 were classified as vulnerable. Twelve morphologically atheroma-free parts of the specimens were used as controls. The Emory University Institutional Review Board approved all protocols, and appropriate consent was obtained.
Immunohistochemistry
Frozen carotid plaque tissues were cut into 5-µm sections, fixed in acetone for 10 minutes, and dried. Endogenous peroxidase was blocked, and 5% of the appropriate animal serum was added to inhibit nonspecific staining. Slides were stained with the following antibodies for 1 hour at room temperature: mouse anti-human IFN-
(1:400; BD Pharmingen, San Jose, Calif), mouse anti-human CD123 for pDCs (1:100; BD Pharmingen), mouse anti-human TLR9 (1:100; Imgenex, San Diego, Calif), mouse anti-human CD3 for T cells (1:200; Dako, Carpenteria, Calif), mouse anti-human CD11c for myeloid DCs (1:200; Dako), and rabbit anti-human von Willebrand factor (vWF) for endothelial cells (1:1000; Dako). A biotin-conjugated goat anti-mouse (Dako) or sheep anti-rabbit (Abcam, Cambridge, Mass) antibody served as secondary antibody (1:125 to 1:600, 30 minutes at room temperature). Brown color was developed with the use of a peroxidase solution (ABC-peroxidase kit; Vector Laboratories, Burlingame, Calif) and 3,3'-diaminobenzidine (DAB) (Dako) as chromogen. For double staining, red color was developed with the use of an alkaline phosphatase solution (ABC-AP kit; Vector Laboratories) and Vector Red (Vector Laboratories). Levamisole was used to inhibit endogenous alkaline phosphatase activity. Slides were counterstained with hematoxylin (Vector Laboratories) for 2 minutes.
Quantitative Reverse Transcriptase Polymerase Chain Reaction
Total RNA was isolated from shock-frozen endarterectomy and cell culture samples with the use of TRIzol (Invitrogen Life Technologies, Grand Island, NY) and transformed into cDNA with avian myeloblastosis virus reverse transcription (RT) (Roche Molecular Biochemicals). cDNA was amplified with primers specific for IFN-
(5'-A T G C G G A C T C C A T C T T G-3' and 5'-C G T G A C C T G G T G T A T G A G -3'), TRAIL (5'-A C C A A C G A G C T G A A G C A G A T-3' and 5'-C A A G T G C A A G T T G C T C A G G A-3'), TLR9 (5'-T G A A G A C T T C A G G C C C A A C T G-3' and 5'-T G C A C G G T C A C C A G G T T G T-3'), and ß-actin (5'-A T G G C C A C G G C T G C T T C C A G C-3' and 5'-C A T G G T G G T G C C G C C A G A C A G-3'), as described elsewhere.20 Amplifications were performed in a Mx3000 polymerase chain reaction (PCR) machine (Stratagene, Cedar Creek, Tex) under the following cycling conditions: denaturation at 94°C for 10 minutes, followed by 40 cycles at 95°C for 30 seconds, 55°C for 60 seconds, and 72°C for 60 seconds. For each sample, PCR reactions were done in triplicate. The level of gene expression was determined by interpolation with a standard curve. cDNA copy numbers are expressed relative to 2x105 ß-actin copies.
Stimulation of Explanted Atherosclerotic Plaque Tissue
Fresh tissue from 6 soft lipid-rich carotid plaques was cut into small pieces. For each plaque, equal numbers of nonadjacent plaque pieces were randomly distributed into wells of a 48-well plate filled with RPMI medium that contained 10% fetal calf serum. Tissue fragments were stimulated with 100 µg/mL synthetic CpG ODN (2006, TCGTCGTTTTGTCGTTTTGTCGT) for 24 hours. Stimulations were done in duplicate. After stimulation, tissue was shock-frozen for RNA isolation. In addition, IFN-
was measured in supernatants with an enzyme-linked immunosorbent assay (PBL Biomedical Laboratories, Piscataway, NJ).
Cells
Peripheral blood mononuclear cells were isolated from fresh blood with the use of Ficoll-Hypaque (Amersham Biosciences, Piscataway, NJ). CD4 T cells were isolated by negative selection (RosetteSep, StemCell Technologies, purity
94%). T-cell lines were isolated from carotid artery plaques by culturing tissue fragments with 50 U/mL recombinant IL-2 (Proleukin Chiron, Emeryville, Calif). Every 7 days, tissue-derived T cells were stimulated with 1x106/mL irradiated peripheral blood mononuclear cells, 1.5x105/mL irradiated Epstein-Barr virustransformed B cells, 30 ng/mL anti-CD3 monoclonal antibody (Ortho Diagnostics), and 50 U/mL recombinant human IL-2. Tissue-derived CD4 T cells were memory T cells and lacked CD28 (data not shown). T cells were stimulated for 2 hours with IFN-
(200 U/mL, PBL, Biomedical Laboratories) or with 250 ng/mL anti-CD3 monoclonal antibody in the presence of FcRII+ P815 cells. Human coronary smooth muscle cells (SMCs) (Cambrex, Walkersville, Md) were grown in SmGM-2 smooth muscle medium (Cambrex).
Flow Cytometry
Multicolor flow cytometry analysis was performed by staining peripheral blood mononuclear cells and T cells for 30 minutes with peridinin chlorophyll proteinconjugated anti-CD4 monoclonal antibody, phycoerythrin-conjugated anti-TRAIL monoclonal antibody, and respective isotype control antibodies (all Becton Dickinson, Franklin Lakes, NJ). Cells were analyzed with a FACSCalibur flow cytometer (Becton Dickinson) and WinMDI software (Scripps Research Institute).
Apoptosis Assays
Confluent coronary SMCs grown in collagen-coated 96-well plates were pretreated for 1 hour with the nuclear binding dye 6'-diamidino-2-phenylindole (DAPI) (1 µg/mL; Sigma-Aldrich, St Louis, Mo). Freshly isolated T cells or resting T-cell lines pretreated for 2 hours with IFN-
(200 U/mL) were added at varying effector-to-target ratios for 4 hours at 37°C in phenol redfree RPMI medium supplemented with 2% fetal calf serum. Untreated T cells served as controls. Apoptosis was assessed as previously described,8 and apoptotic nuclear changes determined by DAPI staining were confirmed by annexin V membrane staining (1 µg/mL; Molecular Probes, Eugene, Ore). To inhibit TRAIL-mediated apoptosis, T cells were treated with a mouse anti-human TRAIL monoclonal antibody (25 µg/mL, RIK-2, Becton Dickinson) or IgG1 mouse control antibody before being added to coronary SMCs. Apoptosis rates observed in coronary SMCs without T cells (<5%) were subtracted. A minimum of 3 pictures per experiment were taken with a fluorescence microscope with 200-fold magnification and analyzed by an observer blinded for treatment using ImageJ (W. Rasband, National Institutes of Health).
Statistical Analysis
The normal distribution of data was tested with the Kolmogorov-Smirnov test. Normally distributed data were analyzed with t tests for independent samples or t tests for paired samples (eg, for stimulation data). In case of skewed distribution (eg, RT-PCR results), corresponding nonparametric tests (Mann-Whitney U tests or Wilcoxon signed rank tests) were used. Correlations were analyzed with the Pearson correlation coefficient. A general linear model procedure was used to analyze experiments with repeated measures (eg, various effector-to-target ratios in cytotoxic assays). All analyses were calculated with the use of the SPSS software package 12.0 for Windows (SPSS, Inc, Chicago, Ill).
The authors had full access to and take full responsibility for the integrity of the data. All authors have read and agree to the manuscript as written.
| Results |
|---|
|
|
|---|
Producing pDCs in the Atherosclerotic Plaque
producing cells were restricted to these atheroma regions (Figure 1B, 1D). Double staining demonstrated that pDCs were the main source of IFN-
(>90%) (Figure 1C, 1D). The number of pDCs was 10-fold higher in unstable than in stable plaques (P<0.0001; Figure 1E). ECs, which can express low CD123 levels, were identified through the vWF marker and remained negative for IFN-
(data not shown).
|
IFN-
in the Vulnerable Atheroma
IFN-
production in the atherosclerotic plaque was confirmed at the transcription level by quantitative RT-PCR. Tissue extracts were prepared from 30 plaques and 12 unaffected parts of carotid arteries. Plaques showed higher concentrations of IFN-
transcripts than normal vessel walls (P<0.0001; Figure 2). To assess the relation between plaque vulnerability and IFN-
tissue levels, endarterectomy samples were graded according to the presence of thrombus, lipid content, and density of the inflammatory infiltrate (TLI score). IFN-
mRNA levels were markedly higher in plaques with high TLI scores than in noninflamed, nonthrombosed plaques (P<0.0001; Figure 2).
|
The TLR9 Ligand CpG ODN Induces IFN-
in Atherosclerotic Plaques
Immunohistochemical staining revealed TLR9 expression in the atherosclerotic plaque (Figure 3A). TLR9 transcripts correlated closely with IFN-
production in atheroma tissue, indicating a possible role for TLR9 in the activation of plaque-residing pDCs (r=0.83, P<0.0001; Figure 3B). To assess whether TLR9 in the lesion mediates responses to PAMPs, we stimulated plaque tissue with the macromolecule CpG ODN. Twenty-four fresh tissues from 6 lipid-rich plaques were examined in organ culture. Two tissue pieces from each plaque were randomly selected for stimulation with CpG ODN (n=12), and 2 pieces from each served as controls (n=12). CpG ODN stimulation resulted in a 2.5-fold increase of IFN-
mRNA levels compared with unstimulated control tissue (P=0.03; Figure 3C). In addition, IFN-
concentrations secreted into the supernatant were significantly higher in the CpG ODNstimulated tissues (P=0.007; Figure 3D). In contrast, CpG ODN stimulation of stable plaques failed to induce IFN-
secretion (n=12 per group; P=0.57).
|
IFN-
Induces TRAIL on CD4 T Cells
CD4 T cells are the dominant lymphocyte population in the atheroma, and IFN-
may modulate their function by affecting TRAIL surface expression.24 IFN-
producing cells and T cells were typically positioned in close vicinity (Figure 4A, 4B). Examining 30 endarterectomy samples for TRAIL and IFN-
transcript levels revealed a close correlation of both markers (r=0.67, P<0.0001; Figure 4C). In addition, plaque tissue activation with CpG ODN was associated with a significant increase in TRAIL mRNA compared with unstimulated controls (n=12 per group) (P=0.004; Figure 4D).
|
Immunomodulatory effects of IFN-
in CD4 T cells were examined in peripheral blood CD4 T cells collected from 31 ACS patients. Two hours of stimulation was sufficient to upregulate TRAIL surface expression on CD4 T cells by 10-fold (P<0.0001; Figure 4E and 4F). Remarkably, IFN-
much more efficiently brought TRAIL to the T-cell surface than did triggering of the T-cell receptor through anti-CD3 antibody (Figure 4E). IFN-
exposure not only enhanced TRAIL surface expression, but it also markedly increased transcription of the TNF-like molecule (P=0.009; Figure 4G).
IFN-
mediated TRAIL upregulation on CD4 T cells was not unique for ACS patients. Rather, peripheral blood CD4 T cells collected from age- and sex-matched controls responded similarly. However, IFN-
induced TRAIL upregulation in plaque-derived CD4 T cells was more pronounced, with >90% of CD4 T cells positive for TRAIL (data not shown).
IFN-
Induces TRAIL-Mediated SMC Apoptosis
To explore the functional relevance of IFN-
induced TRAIL expression on CD4 T cells, we investigated the death-inducing functions of such CD4 T cells. Coronary SMCs, which express the TRAIL receptor DR5, were chosen as targets. Plaque-derived CD4 T cells were added to coronary SMC monolayers for 4 hours at different effector to target ratios. CD4 T cells induced coronary SMC apoptosis very effectively (Figure 5A). Coronary SMC apoptosis was quantified by assessing the frequency of cells with typical nuclear changes of apoptosis through DAPI staining and by staining with the apoptosis membrane marker annexin. As shown in Figure 5B, coronary SMCs with intense DAPI staining of the nucleus double stained for annexin. IFN-
amplified CD4 T-cell killing ability at all effector to target ratios (P=0.002; Figure 5A). Incubating coronary SMCs with IFN-
alone did not induce apoptosis. Using peripheral CD4 T cells from 10 ACS patients, we found a consistent increase of coronary SMC apoptosis after pretreating CD4 T cells with IFN-
(P=0.0003; Figure 5C). Detection of apoptotic coronary SMCs by annexin confirmed enhanced coronary SMC apoptosis with IFN-
pretreated CD4 T cells compared with untreated CD4 T cells (23±3.5% versus 15±2.6%; P=0.005). Apoptosis could be inhibited by blocking with a neutralizing antibody specific for TRAIL in a dose-dependent manner (P=0.0002; Figure 5D), documenting that CD4 T cells utilize TRAIL to trigger the SMC death pathway.
|
| Discussion |
|---|
|
|
|---|
,31,32 inducing the release of matrix-degrading proteases. CD4 effector cells also have the ability to directly kill plaque-residing cells, including ECs and VSMCs.7,8 T cells are generally controlled through TCRs by recognizing antigen, yet a unique subset of CD4 T cells characterized by CD28 loss can be activated independently from TCRs.5 In this report we provide data that IFN-
released in the plaque controls CD4 T-cell cytotoxic effector functions. The efficacy of IFN-
in rapidly modulating CD4 T-cell function is not only independent from antigen recognition; it also outperforms signals initiated by TCR cross-linking. Indeed, plaque-residing CD4 T cells are remarkably sensitive to the IFN-
action. IFN-
biases CD4 T cells toward harming matrix-producing and structure-stabilizing VSMCs and thus emerges as a critical contributor to plaque instability.
The innate cytokine IFN-
is released when DCs sense microbial products, mechanistically linking host infections and plaque destabilization. The ability of IFN-
to profoundly modulate T-cell effector functions immediately raises the question of the source of IFN-
in the plaque environment. Immunohistochemical studies (Figure 1) in the atheroma support the notion that pDCs are the dominant producer of IFN-
.33,34 Most plaque tissues contain IFN-
producing pDCs preferentially located in the shoulder region. This observation is in accordance with recent data indicating that pDCs are not limited to lymphoid organs but are often encountered in inflamed skin or lung tissues.33,35 CCL5 and CCL3 abundantly expressed in atherosclerotic plaques10 may attract pDCs expressing their corresponding chemokine receptor CCR5.36 Whether DC recruitment reflects local infection or is a consequence of chronic inflammation remains to be investigated.
A close correlation between IFN-
and TLR9 transcripts indicated the relevance of TLR9 triggering for activating plaque pDCs. Upregulation of IFN-
transcripts and protein after stimulation of plaque explants with the TLR9 ligand CpG ODN confirmed the functional relevance of TLR9 triggering for activation of IFN-
producing cells in the intact tissue. With regard to human pathogens, viruses such as herpes simplex virus type 1, cytomegalovirus, and influenza virus stimulate pDCs to produce IFN-
via well-understood signaling pathways involving myeloid differentiation factor 88 and IFN regulatory factor 7.34,37,38 IFN-
production also plays a critical role in response to bacterial infections.39 The sensitivity of IFN-
producing cells to multiple pathogens correlates well with the concept of the infectious burden, emphasizing the importance of numerous infections rather than the role of a single and specific pathogen.40 Multiple suspects have been found in the plaque,4143 but data presented here would also allow systemic disease to modulate plaque inflammation. Circulating "danger" signals may trigger pDCs to produce IFN-
, potentially explaining the link between acute infections and inflammatory activation of vulnerable plaques.44
IFN-
released in close vicinity to lymphocytes in the atheroma effectively induced the expression of the apoptosis mediator TRAIL on CD4 T cells. Additional upregulation of TRAIL transcripts indicates that IFN-
not only induces surface expression of vesicle-stored TRAIL but also its transcription. As previously shown, CD4 T cells from ACS patients kill coronary SMCs in a TRAIL-dependent manner.8 In this report we demonstrate that IFN-
stimulation of CD4 T cells from ACS patients translates into even more pronounced coronary SMC apoptosis, a process that could be blocked by TRAIL-specific antibodies. Coronary SMCs abundantly express DR5 and are therefore susceptible to TRAIL.8 VSMC loss may result in structural weakening and rupture of the atheroma cap.2628 Moreover, apoptotic VSMCs induce thrombin generation,45 accelerating the thrombotic occlusion of the artery.28 TRAIL may also induce apoptosis of other plaque-residing cells such as ECs.46 When the unique and powerful ability of IFN-
to induce TRAIL expression on CD4 T cells is considered, IFN-
induced, T cellmediated apoptosis of plaque-residing cells appears to be an important mechanism in plaque destabilization. The presence of IFN-
producing pDCs in the plaque shoulder and the association of IFN-
transcript with plaque vulnerability emphasize the potential role of IFN-
in inducing plaque rupture. Immunoregulatory function for IFN-
in coronary artery disease is also suggested by the recent recognition that complications of coronary disease are markedly accelerated in systemic lupus erythematosus, a syndrome characterized by the overexpression of IFN-
.47,48
The association of immune effector functions critically involved in host protection, such as the potent antiviral and antitumor effects of IFN-
via TRAIL-mediated killing of tumor cells or infected cells,24 with tissue injury reemphasizes the ambiguity of immune effector pathways. The coexistence of protective and harmful immune functions raises concerns about the cost-benefit ratio of therapeutic interventions targeting such pathways. Enhancing TRAIL-dependent immune reactions in cancer and hepatitis C may indeed put patients with coexisting advanced atherosclerosis at risk for plaque instability.
Our data suggest a model of plaque injury in which pattern recognition receptors such as TLR9 respond to infectious molecular patterns from both viral and bacterial sources and amplify tissue-damaging immune responses in the inflamed plaque. By releasing IFN-
, pDCs not only enhance host protection, but they also enable tissue-injurious effector functions that threaten the tissue integrity of the plaque. This mechanism of tissue damage requires the presence of IFN-
responsive CD4 T cells in the plaque and sensitivity by plaque-residing cells, including VSMCs and ECs, to TRAIL, a requirement that is met in unstable lesions. TLR9 ligands initiating a cascade of events leading to cellular loss in the plaque may be derived from local sources in the plaque but also from infections distant from the vessel wall lesion. Transient peaks in circulating PAMPs may be sufficient to trigger plaque inflammation and plaque disruption. Protection from plaque instability may therefore require shielding the host from infectious episodes. Similarly, targeting pathways relevant in the immune-mediated injury of the plaque holds the promise for novel therapeutic interventions.
| Acknowledgments |
|---|
Sources of Funding
This work was funded in part by grants from the National Institutes of Health (RO1 AI 44142, R01 EY 11916, R01 HL 63919, and RO1 AG 15443) and a grant from "Fonds zur Foerderung der wissenschaftlichen Forschung" (J2236-B14).
Disclosures
None.
| References |
|---|
|
|
|---|
2. Hansson GK. Inflammation, atherosclerosis, and coronary artery disease. N Engl J Med. 2005; 352: 16851695.
3. Libby P, Theroux P. Pathophysiology of coronary artery disease. Circulation. 2005; 111: 34813488.
4. Naghavi M, Libby P, Falk E, Casscells SW, Litovsky S, Rumberger J, Badimon JJ, Stefanadis C, Moreno P, Pasterkamp G, Fayad Z, Stone PH, Waxman S, Raggi P, Madjid M, Zarrabi A, Burke A, Yuan C, Fitzgerald PJ, Siscovick DS, de Korte CL, Aikawa M, Juhani Airaksinen KE, Assmann G, Becker CR, Chesebro JH, Farb A, Galis ZS, Jackson C, Jang IK, Koenig W, Lodder RA, March K, Demirovic J, Navab M, Priori SG, Rekhter MD, Bahr R, Grundy SM, Mehran R, Colombo A, Boerwinkle E, Ballantyne C, Insull W Jr, Schwartz RS, Vogel R, Serruys PW, Hansson GK, Faxon DP, Kaul S, Drexler H, Greenland P, Muller JE, Virmani R, Ridker PM, Zipes DP, Shah PK, Willerson JT. From vulnerable plaque to vulnerable patient: a call for new definitions and risk assessment strategies: part I. Circulation. 2003; 108: 16641672.
5. Raines EW. Antigen-independent targeting of long-lived CD4+ cytolytic T effector cells to lesions of atherosclerosis. Circ Res. 2006; 98: 434436.
6. Nakajima T, Schulte S, Warrington KJ, Kopecky SL, Frye RL, Goronzy JJ, Weyand CM. T-cell-mediated lysis of endothelial cells in acute coronary syndromes. Circulation. 2002; 105: 570575.
7. Pryshchep S, Sato K, Goronzy JJ, Weyand CM. T cell recognition and killing of vascular smooth muscle cells in acute coronary syndrome. Circ Res. 2006; 98: 11681176.
8. Sato K, Niessner A, Kopecky SL, Frye RL, Goronzy JJ, Weyand CM. TRAIL-expressing T cells induce apoptosis of vascular smooth muscle cells in the atherosclerotic plaque. J Exp Med. 2006; 203: 239250.
9. Lord RS, Bobryshev YV. Clustering of dendritic cells in athero-prone areas of the aorta. Atherosclerosis. 1999; 146: 197198.[CrossRef][Medline] [Order article via Infotrieve]
10. Zhang X, Niessner A, Nakajima T, Ma-Krupa W, Kopecky SL, Frye RL, Goronzy JJ, Weyand CM. Interleukin 12 induces T-cell recruitment into the atherosclerotic plaque. Circ Res. 2006; 98: 524531.
11. Bobryshev YV, Lord RS. Mapping of vascular dendritic cells in atherosclerotic arteries suggests their involvement in local immune-inflammatory reactions. Cardiovasc Res. 1998; 37: 799810.
12. Yilmaz A, Lochno M, Traeg F, Cicha I, Reiss C, Stumpf C, Raaz D, Anger T, Amann K, Probst T, Ludwig J, Daniel WG, Garlichs CD. Emergence of dendritic cells in rupture-prone regions of vulnerable carotid plaques. Atherosclerosis. 2004; 176: 101110.[CrossRef][Medline] [Order article via Infotrieve]
13. Edfeldt K, Swedenborg J, Hansson GK, Yan ZQ. Expression of toll-like receptors in human atherosclerotic lesions: a possible pathway for plaque activation. Circulation. 2002; 105: 11581161.
14. Methe H, Kim JO, Kofler S, Weis M, Nabauer M, Koglin J. Expansion of circulating Toll-like receptor 4-positive monocytes in patients with acute coronary syndrome. Circulation. 2005; 111: 26542661.
15. Xu XH, Shah PK, Faure E, Equils O, Thomas L, Fishbein MC, Luthringer D, Xu XP, Rajavashisth TB, Yano J, Kaul S, Arditi M. Toll-like receptor-4 is expressed by macrophages in murine and human lipid-rich atherosclerotic plaques and upregulated by oxidized LDL. Circulation. 2001; 104: 31033108.
16. Michelsen KS, Doherty TM, Shah PK, Arditi M. TLR signaling: an emerging bridge from innate immunity to atherogenesis. J Immunol. 2004; 173: 59015907.
17. Muhlestein JB, Anderson JL. Chronic infection and coronary artery disease. Cardiol Clin. 2003; 21: 333362.[CrossRef][Medline] [Order article via Infotrieve]
18. Xu Q. Role of heat shock proteins in atherosclerosis. Arterioscler Thromb Vasc Biol. 2002; 22: 15471559.
19. Miller YI, Chang MK, Binder CJ, Shaw PX, Witztum JL. Oxidized low density lipoprotein and innate immune receptors. Curr Opin Lipidol. 2003; 14: 437445.[CrossRef][Medline] [Order article via Infotrieve]
20. Kadowaki N, Ho S, Antonenko S, de Waal Malefyt R, Kastelein RA, Bazan F, Liu Y-J. Subsets of human dendritic cell precursors express different toll-like receptors and respond to different microbial antigens. J Exp Med. 2001; 194: 863870.
21. Colonna M, Trinchieri G, Liu YJ. Plasmacytoid dendritic cells in immunity. Nat Immunol. 2004; 5: 12191226.[CrossRef][Medline] [Order article via Infotrieve]
22. Kadowaki N, Antonenko S, Lau JY, Liu YJ. Natural interferon alpha/beta-producing cells link innate and adaptive immunity. J Exp Med. 2000; 192: 219226.
23. Cella M, Facchetti F, Lanzavecchia A, Colonna M. Plasmacytoid dendritic cells activated by influenza virus and CD40L drive a potent TH1 polarization. Nat Immunol. 2000; 1: 305310.[CrossRef][Medline] [Order article via Infotrieve]
24. Kayagaki N, Yamaguchi N, Nakayama M, Eto H, Okumura K, Yagita H. Type I interferons (IFNs) regulate tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) expression on human T cells: a novel mechanism for the antitumor effects of type I IFNs. J Exp Med. 1999; 189: 14511460.
25. Michowitz Y, Goldstein E, Roth A, Afek A, Abashidze A, Ben Gal Y, Keren G, George J. The involvement of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) in atherosclerosis. J Am Coll Cardiol. 2005; 45: 10181024.
26. Davies MJ, Richardson PD, Woolf N, Katz DR, Mann J. Risk of thrombosis in human atherosclerotic plaques: role of extracellular lipid, macrophage, and smooth muscle cell content. Br Heart J. 1993; 69: 377381.
27. Geng YJ, Libby P. Evidence for apoptosis in advanced human atheroma: colocalization with interleukin-1 beta-converting enzyme. Am J Pathol. 1995; 147: 251266.[Abstract]
28. Bennett MR. Apoptosis of vascular smooth muscle cells in vascular remodelling and atherosclerotic plaque rupture. Cardiovasc Res. 1999; 41: 361368.
29. Depre C, Wijns W, Robert AM, Renkin JP, Havaux X. Pathology of unstable plaque: correlation with the clinical severity of acute coronary syndromes. J Am Coll Cardiol. 1997; 30: 694702.[Abstract]
30. Benagiano M, Azzurri A, Ciervo A, Amedei A, Tamburini C, Ferrari M, Telford JL, Baldari CT, Romagnani S, Cassone A, DElios MM, Del Prete G. T helper type 1 lymphocytes drive inflammation in human atherosclerotic lesions. Proc Natl Acad Sci U S A. 2003; 100: 66586663.
31. Liuzzo G, Goronzy JJ, Yang H, Kopecky SL, Holmes DR, Frye RL, Weyand CM. Monoclonal T-cell proliferation and plaque instability in acute coronary syndromes. Circulation. 2000; 101: 28832888.
32. Liuzzo G, Vallejo AN, Kopecky SL, Frye RL, Holmes DR, Goronzy JJ, Weyand CM. Molecular fingerprint of interferon-gamma signaling in unstable angina. Circulation. 2001; 103: 15091514.
33. Farkas L, Beiske K, Lund-Johansen F, Brandtzaeg P, Jahnsen FL. Plasmacytoid dendritic cells (natural interferon-alpha/beta-producing cells) accumulate in cutaneous lupus erythematosus lesions. Am J Pathol. 2001; 159: 237243.
34. Asselin-Paturel C, Trinchieri G. Production of type I interferons: plasmacytoid dendritic cells and beyond. J Exp Med. 2005; 202: 461465.
35. de Heer HJ, Hammad H, Soullie T, Hijdra D, Vos N, Willart MA, Hoogsteden HC, Lambrecht BN. Essential role of lung plasmacytoid dendritic cells in preventing asthmatic reactions to harmless inhaled antigen. J Exp Med. 2004; 200: 8998.
36. Diacovo TG, Blasius AL, Mak TW, Cella M, Colonna M. Adhesive mechanisms governing interferon-producing cell recruitment into lymph nodes. J Exp Med. 2005; 202: 687696.
37. Honda K, Yanai H, Negishi H, Asagiri M, Sato M, Mizutani T, Shimada N, Ohba Y, Takaoka A, Yoshida N, Taniguchi T. IRF-7 is the master regulator of type-I interferon-dependent immune responses. Nature. 2005; 434: 772777.[CrossRef][Medline] [Order article via Infotrieve]
38. Cella M, Jarrossay D, Facchetti F, Alebardi O, Nakajima H, Lanzavecchia A, Colonna M. Plasmacytoid monocytes migrate to inflamed lymph nodes and produce large amounts of type I interferon. Nat Med. 1999; 5: 919923.[CrossRef][Medline] [Order article via Infotrieve]
39. Decker T, Muller M, Stockinger S. The yin and yang of type I interferon activity in bacterial infection. Nat Rev Immunol. 2005; 5: 675687.[CrossRef][Medline] [Order article via Infotrieve]
40. Shah PK. Link between infection and atherosclerosis: who are the culprits: viruses, bacteria, both, or neither? Circulation. 2001; 103: 56.
41. Benditt EP, Barrett T, McDougall JK. Viruses in the etiology of atherosclerosis. Proc Natl Acad Sci U S A. 1983; 80: 63866389.
42. Chiu B, Viira E, Tucker W, Fong IW. Chlamydia pneumoniae, cytomegalovirus, and herpes simplex virus in atherosclerosis of the carotid artery. Circulation. 1997; 96: 21442148.
43. Ott SJ, El Mokhtari NE, Musfeldt M, Hellmig S, Freitag S, Rehman A, Kuhbacher T, Nikolaus S, Namsolleck P, Blaut M, Hampe J, Sahly H, Reinecke A, Haake N, Gunther R, Kruger D, Lins M, Herrmann G, Folsch UR, Simon R, Schreiber S. Detection of diverse bacterial signatures in atherosclerotic lesions of patients with coronary heart disease. Circulation. 2006; 113: 929937.
44. Smeeth L, Thomas SL, Hall AJ, Hubbard R, Farrington P, Vallance P. Risk of myocardial infarction and stroke after acute infection or vaccination. N Engl J Med. 2004; 351: 26112618.
45. Flynn PD, Byrne CD, Baglin TP, Weissberg PL, Bennett MR. Thrombin generation by apoptotic vascular smooth muscle cells. Blood. 1997; 89: 43784384.
46. Li JH, Kirkiles-Smith NC, McNiff JM, Pober JS. TRAIL induces apoptosis and inflammatory gene expression in human endothelial cells. J Immunol. 2003; 171: 15261533.
47. Karrar A, Sequeira W, Block JA. Coronary artery disease in systemic lupus erythematosus: a review of the literature. Semin Arthritis Rheum. 2001; 30: 436443.[CrossRef][Medline] [Order article via Infotrieve]
48. Bennett L, Palucka AK, Arce E, Cantrell V, Borvak J, Banchereau J, Pascual V. Interferon and granulopoiesis signatures in systemic lupus erythematosus blood. J Exp Med. 2003; 197: 711723.
| Footnotes |
|---|
This article has been cited by other articles:
![]() |
F. Angelot, E. Seilles, S. Biichle, Y. Berda, B. Gaugler, J. Plumas, L. Chaperot, F. Dignat-George, P. Tiberghien, P. Saas, et al. Endothelial cell-derived microparticles induce plasmacytoid dendritic cell maturation: potential implications in inflammatory diseases Haematologica, November 1, 2009; 94(11): 1502 - 1512. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Schulte, A. Yilmaz, K. Shimada, M. C. Fishbein, E. L. Lowe, S. Chen, M. Wong, T. M. Doherty, T. Lehman, T. R. Crother, et al. Involvement of Innate and Adaptive Immunity in a Murine Model of Coronary Arteritis Mimicking Kawasaki Disease J. Immunol., October 15, 2009; 183(8): 5311 - 5318. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Shao, H. Fujii, I. Colmegna, H. Oishi, J. J. Goronzy, and C. M. Weyand Deficiency of the DNA repair enzyme ATM in rheumatoid arthritis J. Exp. Med., June 8, 2009; 206(6): 1435 - 1449. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Niessner, P. J. Hohensinner, K. Rychli, S. Neuhold, G. Zorn, B. Richter, M. Hulsmann, R. Berger, D. Mortl, K. Huber, et al. Prognostic value of apoptosis markers in advanced heart failure patients Eur. Heart J., April 1, 2009; 30(7): 789 - 796. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Yilmaz and M. Arditi Giant Cell Arteritis: Dendritic Cells Take Two T's to Tango Circ. Res., February 27, 2009; 104(4): 425 - 427. [Full Text] [PDF] |
||||
![]() |
J. Deng, W. Ma-Krupa, A. T. Gewirtz, B. R. Younge, J. J. Goronzy, and C. M. Weyand Toll-Like Receptors 4 and 5 Induce Distinct Types of Vasculitis Circ. Res., February 27, 2009; 104(4): 488 - 495. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Bobik Secretory phospholipase A2 type IIA: a regulator of immune function in atherosclerosis? Cardiovasc Res, January 1, 2009; 81(1): 9 - 10. [Full Text] [PDF] |
||||
![]() |
I. E. Dumitriu, E. T. Araguas, C. Baboonian, and J. C. Kaski CD4+CD28null T cells in coronary artery disease: when helpers become killers Cardiovasc Res, January 1, 2009; 81(1): 11 - 19. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Kavurma, N. Y. Tan, and M. R. Bennett Death Receptors and Their Ligands in Atherosclerosis Arterioscler Thromb Vasc Biol, October 1, 2008; 28(10): 1694 - 1702. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Pryshchep, W. Ma-Krupa, B. R. Younge, J. J. Goronzy, and C. M. Weyand Vessel-Specific Toll-Like Receptor Profiles in Human Medium and Large Arteries Circulation, September 16, 2008; 118(12): 1276 - 1284. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Kavurma, M. Schoppet, Y. V. Bobryshev, L. M. Khachigian, and M. R. Bennett TRAIL Stimulates Proliferation of Vascular Smooth Muscle Cells via Activation of NF-{kappa}B and Induction of Insulin-like Growth Factor-1 Receptor J. Biol. Chem., March 21, 2008; 283(12): 7754 - 7762. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Han, K. Shimada, W. Ma-Krupa, T. L. Johnson, R. M. Nerem, J. J. Goronzy, and C. M. Weyand Vessel Wall-Embedded Dendritic Cells Induce T-Cell Autoreactivity and Initiate Vascular Inflammation Circ. Res., March 14, 2008; 102(5): 546 - 553. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Niessner, M. S. Shin, O. Pryshchep, J. J. Goronzy, E. L. Chaikof, and C. M. Weyand Synergistic Proinflammatory Effects of the Antiviral Cytokine Interferon-{alpha} and Toll-Like Receptor 4 Ligands in the Atherosclerotic Plaque Circulation, October 30, 2007; 116(18): 2043 - 2052. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. F. Denny, S. Thacker, H. Mehta, E. C. Somers, T. Dodick, F. J. Barrat, W. J. McCune, and M. J. Kaplan Interferon-{alpha} promotes abnormal vasculogenesis in lupus: a potential pathway for premature atherosclerosis Blood, October 15, 2007; 110(8): 2907 - 2915. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Methe and M. Weis Atherogenesis and inflammation--was Virchow right? Nephrol. Dial. Transplant., July 1, 2007; 22(7): 1823 - 1827. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2006 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |