Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 2008;117:1065-1074
Published online before print February 11, 2008, doi: 10.1161/CIRCULATIONAHA.107.731679
CLINICAL PERSPECTIVE
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
117/8/1065    most recent
CIRCULATIONAHA.107.731679v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Saliez, J.
Right arrow Articles by Dessy, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Saliez, J.
Right arrow Articles by Dessy, C.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*CALCIUM COMPOUNDS
*CALCIUM, ELEMENTAL
*NITRIC OXIDE
Related Collections
Right arrow Endothelium/vascular type/nitric oxide
Right arrow Other Vascular biology
Right arrowRelated Article

(Circulation. 2008;117:1065-1074.)
© 2008 American Heart Association, Inc.


Molecular Cardiology

Role of Caveolar Compartmentation in Endothelium-Derived Hyperpolarizing Factor–Mediated Relaxation

Ca2+ Signals and Gap Junction Function Are Regulated by Caveolin in Endothelial Cells

J. Saliez, BSc; C. Bouzin, PhD*; G. Rath, PhD*; P. Ghisdal, PhD; F. Desjardins, PhD; R. Rezzani, PhD; L.F. Rodella, PhD; J. Vriens, PhD; B. Nilius, MD, PhD; O. Feron, PhD; J-L. Balligand, MD, PhD; C. Dessy, PhD

From the Unit of Pharmacology and Therapeutics, Université catholique de Louvain, Medical School, Brussels, Belgium (J.S., C.B., G.R., P.G., F.D., O.F., J-L.B., C.D.); Division of Human Anatomy, Department of Biomedical Sciences and Biotechnology, University of Brescia, Brescia, Italy (R.R., L.F.R.); and KU Leuven, Department of Molecular Cell Biology, Division of Physiology, Campus Gasthuisberg, Leuven, Belgium (J.V., B.N.).

Correspondence to Chantal Dessy, Department of Medicine, Unit of Pharmacology and Therapeutics, FATH 5349, Université catholique de Louvain, 52 Avenue Mounier, B-1200 Brussels, Belgium. E-mail chantal.dessy{at}uclouvain.be

Received August 2, 2007; accepted December 14, 2007.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background— In endothelial cells, caveolin-1, the structural protein of caveolae, acts as a scaffolding protein to cluster lipids and signaling molecules within caveolae and, in some instances, regulates the activity of proteins targeted to caveolae. Specifically, different putative mediators of the endothelium-derived hyperpolarizing factor (EDHF)–mediated relaxation are located in caveolae and/or regulated by the structural protein caveolin-1, such as potassium channels, calcium regulatory proteins, and connexin 43, a molecular component of gap junctions.

Methods and Results— Comparing relaxation in vessels from caveolin-1 knockout mice and their wild-type littermates, we observed a complete absence of EDHF-mediated vasodilation in isolated mesenteric arteries from caveolin-1 knockout mice. The absence of caveolin-1 is associated with an impairment of calcium homeostasis in endothelial cells, notably, a decreased activity of Ca2+-permeable TRPV4 cation channels that participate in nitric oxide– and EDHF-mediated relaxation. Moreover, morphological characterization of caveolin-1 knockout and wild-type arteries showed fewer gap junctions in vessels from knockout animals associated with a lower expression of connexins 37, 40, and 43 and altered myoendothelial communication. Finally, we showed that TRPV4 channels and connexins colocalize with caveolin-1 in the caveolar compartment of the plasma membrane.

Conclusions— We demonstrated that expression of caveolin-1 is required for EDHF-related relaxation by modulating membrane location and activity of TRPV4 channels and connexins, which are both implicated at different steps in the EDHF-signaling pathway.


Key Words: calcium • endothelium • endothelium-derived factors • gap junctions • microcirculation


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Vascular tone is fine-tuned by neural, endothelial, and physical stimuli that induce dilatory or constrictive responses of vascular smooth muscle cells. Endothelial cells release various relaxing factors, but they also control vascular tone by generating hyperpolarization of the underlying smooth muscle cells.1 Nitric oxide (NO) production by endothelial NO synthase (eNOS) is tightly regulated by enzyme interaction with the caveolar component caveolin-1.2 Caveolae are 50- to 100-nm-diameter plasmalemmal vesicles that act as signaling platforms that integrate the effects of numerous signaling proteins. Caveolin-1 also favors a compartmentation of plasma membrane components that is mandatory for coupling between agonist stimulation of receptors and downstream activation of eNOS.3,4

Clinical Perspective p 1074

The existence of a NO- and prostacyclin-independent component of endothelium-dependent relaxation has been demonstrated in several conduit and resistance arteries. This relaxation is associated with vascular smooth muscle cell hyperpolarization and was then attributed to an endothelium-derived hyperpolarizing factor (EDHF).5 Whereas NO-mediated relaxation is predominant in large vessels, EDHF implication becomes more prominent as vessel diameter is reduced. Several endothelium-derived factors with hyperpolarizing activity have been identified: epoxy-eicosatrienoic acids (EETs), K+ ions, and H2O2 (for review, see Reference 1). It has also been shown that hyperpolarization generated in endothelial cells could spread to the adjacent smooth muscle cells through myoendothelial gap junctions.6 A hallmark of the EDHF-mediated response is its initiation by an elevation of intracellular calcium ([Ca2+]i) in endothelial cells.7 Moreover, it has been clearly demonstrated that the opening of Ca2+-activated potassium channels (KCa; most probably the IKCa and SKCa channels expressed either on the endothelium or on the smooth muscle cells) is the end-cellular event mediating the hyperpolarization and the subsequent EDHF relaxation.8

In endothelial cells, a number of molecules responsible for Ca2+ handling have been shown to be compartmentalized in caveolae. Direct measurements of Ca2+ waves in endothelial cells have suggested that caveolae could be the sites that initiate Ca2+ entry and Ca2+-dependent signal transduction.9 The role of caveolin-1 in the regulation of calcium entry in endothelial cells has been shown recently.10 Indeed, caveolae are enriched with regulatory molecules like the inositol trisphosphate receptor (IP3R),10,11 Ca2+ ATPase,12 heterotrimeric GTP binding protein,13 and some isoforms of the transient receptor potential channel (TRP).10,14–16 Some of the proposed EDHF, as the EETs, seem to interact directly or in a membrane-delimited fashion with these Ca2+-regulatory proteins.17 A recent interesting finding showed that EETs activate TRPV4 channels and Ca2+ influx in endothelial cells, leading to vascular relaxation.18

Moreover, it has been demonstrated recently that the gap junction protein connexin (Cx43) and caveolin-1 partially colocalize in cells where they are endogenously expressed, mainly at junctional membranes of contacting cells.19 Major ion channels are also enriched in caveolar domains; furthermore, caveolin-1 interaction can directly modulate the opening probability of some channels such as the "big-conductance" Ca2+-dependent potassium channels (BKCa), a potential end effector of EDHF-mediated relaxation.20

In this study, we investigated the potential regulatory role of caveolin-1 on EDHF-related relaxation, considering the hypothesis that EDHF effectors could either locate in caveolar microdomains and/or be regulated by interactions with caveolin-1. We sought to define the relative roles of the different endothelial vasorelaxant factors in caveolin-1 knockout (KO) mice and to specifically identify whether caveolin-1 modulates the signaling pathways responsible for EDHF relaxation.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
An expanded Methods section is available in the online-only Data Supplement.

Animals
All experimental protocols were approved by the local Ethics Committee.

Measurements of Contractile Tension and Vessel Membrane Potential
Superior mesenteric artery segments were mounted in a wire myograph. Contractile tension or smooth muscle membrane potential was measured as described previously.21,22

Human Umbilical Vein Endothelial Cell Culture and Transfections
Human umbilical vein endothelial cells (HUVECs) were transfected with small-interfering RNA (siRNA) (AACGAGAAGCAAGTGTACGAC, QIAGEN) with the use of lipofectin (Invitrogen) according to the manufacturer’s protocol.

Measurement of [Ca2+]i in Endothelial Cells
[Ca2+]i was determined with the fluorescent Ca2+ indicator fura 2 as described previously.23

Subcellular Fractionation and Western Blotting
HUVECs and isolated aortas from wild-type (WT) mice were lysed in Na2CO3 (0.5 mol/L) (pH 11) buffer. Subcellular fractionation was made by isopycnic ultracentrifugation as described previously.24 Proteins harvested in the subcellular fractions or vessel lysates were processed for immunoblotting as described previously.23 Membranes were (re)probed with antibodies against TRPV4 channel (Alomone Labs), Cx37 (CX37-A11, Chemicon, Temecula, Calif), Cx40 (CX40-AB1726, Chemicon), Cx43 (clone CXN-6, Sigma, St Louis, Mo), and β-actin (Sigma).

Immunoprecipitation
HUVECs were lysed in ice-cold precipitation buffer. Insoluble material was removed by centrifugation. Then 500 µg of protein from lysates was subjected to immunoprecipitation. Polyclonal antibodies to TRPV4 or caveolin-1 were added to cell lysate for 1 night at 4°C. Immunoglobulin and bound proteins were precipitated with G-sepharose beads and collected for Western blotting.

Circadian Variation, Blood Pressure, and Frequency Analysis of Blood Pressure by Implanted Telemetry
Blood pressure (BP) signals from the aortic arch were measured in conscious, unrestrained animals with surgically implanted, miniaturized telemetry devices (Datascience Corp). Spectral analysis of BP recordings was performed with the use of a fast Fourier transformation algorithm.

Immunohistology
Cryosliced aortas were probed with primary antibodies against Cx43 (MAB3068, Chemicon), Cx40 (AB1726, Gentaur), and Cx37 (CX37A11-A, Gentaur) and with secondary antibodies coupled with TRITC or FITC fluorophores (Jackson ImmunoResearch).

Electron Microscopy
For immunogold staining, ultrathin sections of mice mesenteric arteries were probed with primary antibodies against Cx37, Cx43, and Cx40 and with secondary antibodies coupled with gold beads. The density of gold labeling, expressed as the number of gold particles per square micrometer, was determined in different compartments in vessel cells by counting the number of gold particles over each cell compartment.

Dye Transfer
Calcein transfer from endothelial cells to smooth muscle cells was evaluated as described previously.25 Results were expressed as immunogold particles per square micrometer.

Statistical Analysis
All results are expressed as mean±SEM. Statistical comparisons were analyzed by Student t test or ANOVA where appropriate. A value of P<0.05 was considered significant.

The authors had full access to and take full responsibility for the integrity of the data. All authors have read and agree to the manuscript as written.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Absence of Caveolin-1 Is Associated With Increase in NO-Mediated Relaxation and Impairment of EDHF-Mediated Relaxation
To evaluate NO-mediated relaxation, superior mesenteric arteries from caveolin-1 WT and KO mice were contracted with a high-KCl solution (to exclude possible interaction with any EDHF) in the presence of indomethacin (10 µmol/L) and exposed to acetylcholine (30 µmol/L). As shown in Figure 1A, maximal NO-mediated relaxation was significantly increased in arteries from caveolin-1 KO mice compared with the WT littermates (65.4±5.8%, n=3 vs 42.3±2.8%, n=7; P<0.01). The contraction was similar in both groups (data not shown).


Figure 1188878
View larger version (20K):
[in this window]
[in a new window]

 
Figure 1. Endothelial relaxation in caveolin-1 KO and WT mice mesenteric arteries. A, Maximal NO-mediated relaxation evoked by acetylcholine (30 µmol/L) on superior mesenteric arteries from caveolin-1 (cav-1) WT and KO mice (n=3 to 7; **P<0.01). B, Relaxation evoked by acetylcholine on caveolin-1 WT (•) and KO ({circ}) superior mesenteric arteries preincubated with L-NA (100 µmol/L) and indomethacin (10 µmol/L) and contracted with phenylephrine (1 µmol/L) (n=6 to 8; *P<0.05, **P<0.01). C, Mean smooth muscle cell membrane potential recorded in mesenteric arteries from caveolin-1 WT (gray columns) and KO mice (white columns) before and after acetylcholine (3 µmol/L) treatment (hatched columns) (*P<0.05 vs caveolin-1 WT resting potential; #P<0.05 vs caveolin-1 WT with acetylcholine 3 µmol/L) in presence of indomethacin (10 µmol/L). D, Mean smooth muscle cell membrane potential recorded in mesenteric arteries from caveolin-1 WT (gray columns) and KO mice (white columns) in presence of L-NA (100 µmol/L) and indomethacin (10 µmol/L) before and after acetylcholine (3 µmol/L) stimulation (hatched columns) (*P<0.05 vs caveolin-1 WT resting potential with L-NA; n=3 to 9).

To evaluate EDHF-related relaxation, preconstricted arteries (phenylephrine, 1 µmol/L) were exposed to acetylcholine (10 nmol/L to 10 µmol/L) in the presence of a NOS inhibitor (N{omega}-nitro-L-arginine [L-NA], 100 µmol/L) and indomethacin (10 µmol/L). An EDHF-dependent relaxation amounting to 30.9±8.0% (n=8) of maximal contraction was observed in caveolin-1 WT arteries, whereas it was completely absent in arteries from caveolin-1 KO mice (n=6) (Figure 1B).

EDHF-related relaxation is mediated by a smooth muscle cell hyperpolarization that leads to reduction of the open probability of voltage-dependent Ca2+ channels and to subsequent decrease in [Ca2+]i. Indeed, treatment of WT superior mesenteric arteries with acetylcholine (3 µmol/L) evoked smooth muscle cell hyperpolarization, which was absent in caveolin-1 KO arteries (WT: from –51.8±2.0 mV, n=6 to –60.3±0.9 mV, n=4; caveolin-1 KO: from –49.9±1.3 mV, n=11 to –51.7±1.6 mV, n=6) (Figure 1C). Notably, smooth muscle cell resting membrane potential was similar in both strains (WT: –51.3±2.0 mV, n=6; caveolin-1 KO: –49.9± 1.3 mV, n=11). To exclude a possible modulation of the membrane potential by NO, a similar protocol was applied to arteries preincubated with L-NA (100 µmol/L). Resting potential was unchanged under these conditions in both artery types (WT: –51.7±1.1 mV, n=9; caveolin-1 KO: –50.7±1.1 mV, n=8). Acetylcholine-evoked hyperpolarization was maintained in WT vessels and remained absent in caveolin-1 KO arteries (Figure 1D).

Because NO could directly inhibit EDHF relaxation,26 we measured the EDHF-mediated relaxation on WT vessels precontracted with phenylephrine and exposed to the exogenous NO donor S-nitroso-N-acetyl-D,L-penicillamine (SNAP). The phenylephrine dose was adapted to obtain a similar amplitude of contraction in the presence or the absence of SNAP. In our experimental setup, exogenous NO did not reduce the EDHF-dependent relaxation evoked by acetylcholine (EDHF maximal relaxation: 34.2±4.1%, n=11; EDHF maximal relaxation with SNAP: 42.1±5.5%, n=11, not shown).

Absence of Caveolin-1 Induces Impairment of Ca2+ Entry in Endothelial Cells
To evaluate the role of caveolin-1 in Ca2+ homeostasis in endothelial cells, caveolin-1 expression was downregulated by transfecting HUVECs with siRNA directed against caveolin-1 (caveolin-1-siRNA cells). An 80% to 95% reduction in caveolin expression was reached versus control (Figure IA in the online-only Data Supplement). Because acetylcholine muscarinic receptor expression is not stable in HUVECs, ATP (10 µm) was chosen to stimulate these cells. ATP treatment induced a transient increase in [Ca2+]i followed by a plateau; the biphasic Ca2+ response was similar in shape and amplitude in endothelial cells treated with caveolin-1-siRNA (data not shown). In the absence of extracellular calcium (Ca2+ 0 mmol/L, EGTA 3 mmol/L), ATP-induced [Ca2+]i increase, corresponding to the release of intracellular stores, was similar in both groups (Figure 2A). In contrast, the Ca2+ signal evoked by normal extracellular Ca2+ concentration restoration (1.3 mmol/L) was significantly reduced in caveolin-1-siRNA cells (Figure 2B). These results suggest a role of caveolin-1 in Ca2+ entry in endothelial cells. Similar results were obtained with cultured endothelial cells freshly isolated from caveolin-1 WT and caveolin-1 KO mouse aortas (Figure IB and IC in the online-only Data Supplement).


Figure 2188878
View larger version (16K):
[in this window]
[in a new window]

 
Figure 2. Effect of caveolin-1 suppression on Ca2+ handling in HUVECs. A, [Ca2+]i increase evoked by ATP (10 µmol/L) in Ca2+-free medium in HUVECs transfected or not with siRNA targeted against caveolin-1 (cav). B, Increase in [Ca2+]i measured in the same cells after extracellular [Ca2+] restoration (1.3 mmol/L). Results were expressed as percentage of the initial Ca2+ response to ATP. *P<0.05; n=4 to 6.

TRPV4 Channels Participate in EDHF- Mediated Relaxation
We investigated whether TRPV4-dependent Ca2+ entry could play a functional role in the endothelium-dependent relaxation by measuring EDHF and NO-mediated relaxations in TRPV4 KO and WT mice. As shown in Figure 3A, the EDHF-mediated dilation was significantly altered in TRPV4 KO arteries compared with their WT control. The NO-mediated relaxation was also slightly but significantly reduced in TRPV4 KO arteries (Figure 3B). In contrast, endothelial-independent relaxation remained unchanged (Figure II in the online-only Data Supplement).


Figure 3188878
View larger version (35K):
[in this window]
[in a new window]

 
Figure 3. Role of TRPV4 channel in endothelium function. A, Carbachol evoked relaxation on TRPV4 WT (•) and KO ({circ}) superior mesenteric arteries, preincubated with L-NA (100 µmol/L) and indomethacin (10 µmol/L) and precontracted with phenylephrine (500 nmol/L) (n=8 to 11 rings, 3 to 5 mice; ***P<0.001). B, Carbachol evoked relaxation on TRPV4 WT (•) and KO ({circ}) superior mesenteric arteries precontracted with high-KCl solution (n=12 to 18 rings, 3 to 5 mice; **P<0.01) in presence of indomethacin (10 µmol/L). C, [Ca2+]i increase evoked by 4{alpha}PDD (10 µmol/L) in HUVECs transfected (open column) or not (filled column) with caveolin-1 (cav-1)–targeted siRNA (*P<0.05; n=8). ctrl indicates control. D, Subcellular fractionation of HUVECs separated by ultracentrifugation on sucrose gradients; each fraction (1 to 10 fractions of equal volumes and increasing densities) was analyzed by immunoblotting for TRPV4, eNOS, caveolin-1, and β-actin. Representative data of 4 or 5 different experiments are shown. E, Immunoprecipitation (IP) with caveolin-1 and TRPV4. HUVECs were lysed, homogenized, and subjected to immunoprecipitation with the respective antibodies. Protein complex was detected by immunoblotting. L indicates total cell lysate; IP, immunoprecipitate; and C, negative control. Representative data of 4 different experiments are shown. F, SBP from TRPV4 WT (n=3) and KO (n=3) mice. Data were expressed as day vs night mean measurements. Mean values of SBP were calculated for each 60-minute sequence of recording during the 24-hour period. G, Spectral analysis of SBP variability (SBPV) in TRPV4 WT (n=3) and KO (n=3) mice. After normalization to whole power spectra, area under the curve for the variability of SBP was calculated for each group. Results are presented for specific frequency bands, that is, very low frequency (VLF) of variability of SBP (0.05 to 0.4 Hz; reflecting neurohumoral control) (*P<0.05; **P<0.01 vs night period).

TRPV4 channels activity was then evaluated in HUVECs. The obtained data provided evidence that the selective TRPV4 opener 4{alpha}PDD (10 µmol/L) evoked an increase in [Ca2+]i (195.9±36.1 nmol/L; n=8). This increase was significantly blocked when the cells were pretreated with caveolin-1-siRNA (88.7±14.3 nmol/L; P<0.05; n=8) (Figure 3C).

Because TRPV4 channel activity seems partly regulated by caveolin-1 and/or a caveolar location, we sought to evaluate a possible enrichment of TRPV4 in the caveolae-enriched low-density fractions. Therefore, cellular fractionation by sucrose gradient and isopycnic centrifugation were performed on HUVECs. Figure 3D reveals that a large proportion of TRPV4 channels are found in caveolae-enriched low-density fractions, suggesting that these channels most probably reside in caveolae. This hypothesis was confirmed on coimmunoprecipitation of caveolin-1 and TRPV4, supporting an association between both proteins (Figure 3E).

The phenotype of TRPV4 KO and WT mice was further characterized by the evaluation of circadian variation, BP, and frequency analysis of BP with miniaturized telemetry devices implanted in conscious, freely moving mice. The systolic BP (SBP) profile of both WT and KO mice exhibited a physiological circadian variation, with lower pressure during the day (corresponding to the resting period in mice). Their 24-hour as well as night or day mean SBP levels were also identical (Figure 3F). Spectral analysis of the 24-hour SBP recordings was performed, and the variability of SBP in the very-low-frequency band (0.05 to 0.4 Hz; reflecting neurohumoral control, including NO) was measured (Figure 3G). The very-low-frequency variability of SBP of TRPV4 KO was not significantly different from WT, suggesting compensatory mechanisms to the altered NO and EDHF signaling cascades.

Integrity of Gap Junctions Is Compromised in the Absence of Caveolin-1
Because the dramatically altered EDHF-related relaxation observed in caveolin-1 KO mice could not be recapitulated by the absence of TRPV4 channels, we then focused on gap junctions as another caveolae-associated effector of the EDHF pathway.

In caveolin-1 WT arteries, EDHF-dependent relaxation is mediated at least partly by spread of EDHF hyperpolarization through gap junctions, as demonstrated by the inhibition of EDHF-dependent relaxation in the presence of a blocker of gap junctions, carbenoxolone (100 µmol/L) (maximal EDHF relaxation with carbenoxolone: 8.4±3.0% [n=7]; without carbenoxolone: 26.0±4.7% [n=19]) (Figure III in the online-only Data Supplement).

To explore gap junctions in caveolin-1 KO and WT mice, immunoblotting of Cx40, Cx43, and Cx37 was performed. Decreased expression of all 3 connexins was evident in aortas from KO versus WT mice (Figure 4A). Moreover, electron microscopy showed that in contrast to WT arteries, morphological characterization of caveolin-1 KO vessels presented large collagen fibers between smooth muscle cells and a discontinuity between the endothelium and the media (Figure 4B). Immunofluorescence experiments also revealed that the vascular gap-junction components Cx40, Cx43, and Cx37 were differentially expressed in WT aorta and caveolin-1 KO aorta. In WT vessels, the signal for Cx40 and Cx37 was found mainly in the endothelial cells, whereas Cx43 staining was detected throughout the vascular wall (Figure 4C to 4E). Cx40, Cx43, and Cx37 in superior mesenteric arteries were then analyzed by electron microscopy. As illustrated in Figure 4F to 4H, in caveolin-1 KO mouse arteries, the amount and location of gap junctions detected by immunogold were altered in comparison to WT arteries. The specific staining for Cx40 in WT superior mesenteric arteries showed myoendothelial gap junctions and homocellular gap junctions between endothelial cells (Figure 4F, left panel). In contrast, morphologically altered junctions appeared between caveolin-1 KO smooth muscle cells and endothelial cells, with collagen fibers separating both cellular types (Figure 4F, right panel). Cx40 staining in caveolin-1 KO arteries was significantly decreased, reaching 34.8±0.3 immunogold particles per square micrometer versus 50.8±0.2 immunogold particles per square micrometer in WT mice (P<0.001). Cx43 staining revealed abundant gap junctions at the plasma membrane of the WT endothelial cells, connecting endothelial and smooth muscle cells. The total amount of gap junctions stained by Cx43 immunogold was decreased in caveolin-1 KO arteries (31.9±0.3 versus 48.9±0.4 immunogold particles per square micrometer; P<0.001) (Figure 4G). Similar results were observed after Cx37 staining. The myoendothelial gap junctions evidenced in WT vessels in Figure 4H (left panel) are located in projections arising from endothelial cells. Cx37 staining did not reveal any endothelial gap junction in caveolin-1 KO superior mesenteric arteries, and only a faint signal was evidenced between smooth muscle cells (Figure 4H, right panel) (global quantification for Cx37: 28.3±0.2 immunogold particles per square micrometer versus 45.0±0.2 immunogold particles per square micrometer in WT; P<0.001).


Figure 4188878
View larger version (58K):
[in this window]
[in a new window]

 
Figure 4. Gap junctions in caveolin-1 WT and KO mice. A, Protein lysates from caveolin-1 (cav-1) WT and KO arteries were resolved by Western blotting for Cx37, Cx40, Cx43, and β-actin. Images are representative of 3 independent experiments. B, Electron micrograph showing gap junctions (arrows) in superior mesenteric arteries from caveolin-1 WT (left) and KO mice (right). SMC indicates smooth muscle cells; EC, endothelial cells; and *, collagen fibers. C, D, and E, Immunofluorescence staining of Cx40, Cx43, and Cx37 (white arrows) in isolated aorta from caveolin-1 WT (left) and KO (right) mice. Autofluorescence of lamina elastica appears in red or green depending on the emission/excitation filters used. Nuclei were counterstained with DAPI blue. F, G, and H, Immunogold staining for Cx40, Cx43, and Cx37, respectively, in caveolin-1 WT (left) and KO (right) large mesenteric arteries. Arrows indicate gap junctions. Magnification x5200 except for G (right panel), x7000.

These results suggest that caveolin-1 absence might interfere with the expression of the different isotypes of connexins at the plasma membrane and/or with functional gap-junction formation. A specific staining for Cx37 located both in gap junctions and in caveolae-like cytosolic vesicles within endothelial cells was detected in aorta isolated from WT-type mice analyzed by electron microscopy (Figure 5A). To further evaluate the potential interaction between caveolin-1 and the connexins, a possible enrichment of these gap junction–forming proteins in caveolar low-density fractions was assessed by subcellular fractionation of HUVECs. As illustrated by Figure 5B, Cx43 was found in the low-density fraction, suggesting a colocalization of caveolin-1 and connexins. Immunoprecipitation assays confirmed the interaction between caveolin-1 and Cx43 and extend this observation to Cx40 (Figure 5C). When subcellular fractionation was performed on endothelial cells pretreated with caveolin-1–targeted siRNA, a decreased expression of Cx40 in the subcellular fractions containing the lipid rafts was observed even if a residual expression of caveolin-1 persisted (control HUVECs: 69.9±11.0% of total protein, n=4; siRNA-transfected HUVECs: 24.7±15.9% of total protein, n=3; residual expression of caveolin-1 in siRNA-transfected HUVECs: 14.9±6.1% of control HUVECs, n=4).


Figure 5188878
View larger version (38K):
[in this window]
[in a new window]

 
Figure 5. Cx37, Cx40, and Cx43 colocalized with caveolin in endothelial cells. A, Cx37 in caveolin-1 WT aorta. Left, Immunogold staining, magnification x73 000. Right, Micrograph, magnification x13 000. Arrows indicate gap junctions; arrowheads represent caveolar Cx37 location. B, Subcellular fractionation of HUVECs separated by ultracentrifugation on sucrose gradients; each fraction (1-10) was analyzed by immunoblotting for Cx43, caveolin-1 (cav-1), and β-actin. Representative of 4 or 5 different experiments is shown. C, HUVECs were lysed, homogenized, and subjected to immunoprecipitation with caveolin-1 antibodies. Protein complex was detected by immunoblotting with Cx40 and Cx43 antibodies. L indicates total cell lysate; IP, immunoprecipitate; and C, negative control. Representative of 3 different experiments is shown.

To evaluate myoendothelial gap-junction functionality in KO and WT vessels, superior mesenteric arteries were perfused with calcein-AM (10 µmol/L), a membrane-permeant fluorescent probe that can penetrate endothelial cells but that is rapidly cleaved into nonpermeant calcein, making its diffusion dependent on functional gap junctions. This dye transfer was evaluated by microscopy on cryopreserved slices of these arteries. As shown in Figure 6, in caveolin-1 WT artery, the calcein staining penetrated through the entire vascular wall (Figure 6A), whereas it remained limited to the endothelium in caveolin-1 KO vessels (Figure 6B). Complete inhibition of calcein diffusion by carbenoxolone confirmed the dependence of this readout on functional gap junctions (Figure 6C).


Figure 6188878
View larger version (29K):
[in this window]
[in a new window]

 
Figure 6. Gap-junction function in caveolin-1 (cav-1) WT and KO vessels. Caveolin-1 WT (A) and caveolin-1 KO (B) mesenteric arteries were perfused with calcein-AM (10 µmol/L). Penetration of the dye into subjacent smooth muscle cells was observed with pseudo-confocal microscopy. The nuclei are stained with DAPI blue. C, Calcein diffusion in the media is expressed as percentage of total vessel surface (*P<0.05; **P<0.01).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
The endothelium controls vascular tone not only by releasing NO and prostaglandin I2 but also by generating hyperpolarization of the adjacent smooth muscle cells. This response was first attributed to the EDHF, but it is now clearly demonstrated that EDHF includes different mechanisms.1 The present study provides new insights in the understanding of the signaling pathway leading to EDHF-related relaxation. The seminal findings of this work are the absence of an EDHF-induced smooth muscle hyperpolarization and of the associated vascular relaxation in caveolin-1 KO arteries. This observation led us to identify different mechanisms related to EDHF regulation and dependent on caveolae integrity: (1) Ca2+ entry via TRPV4 participates in EDHF-signaling initiation; (2) this TRPV4-dependent Ca2+ entry requires TRPV4 and caveolin-1 colocalization in endothelial cells; and (3) in the absence of caveolin-1, connexins and gap junctions are dramatically reduced at myoendothelial junctions, leading to an alteration of small molecules (and more probably electric) transfers from endothelium to smooth muscle cells.

Absence of caveolin-1 expression is associated with a structural disorganization of the plasma membrane, and the caveolar loss could interfere with intracellular signaling cascades. As suggested previously, NO and EDHF-mediated relaxations are initiated by a [Ca2+]i increase in endothelial cells, but the threshold needed to induce EDHF relaxation is higher than that inducing NO-mediated dilation.7 Consequently, small changes in Ca2+ homeostasis of endothelial cells would first affect EDHF relaxation. To explore the role of caveolin-1 in Ca2+ signal transduction in endothelial cells, [Ca2+]i measurements were made in HUVECs transfected with caveolin-1 siRNA and stimulated with ATP. In the absence of caveolin-1 expression, Ca2+ entry through the plasma membrane was found to be reduced, suggesting that caveolar integrity and/or caveolin is required for Ca2+ entry to occur.

A role for caveolae in Ca2+ handling was first suggested in endothelial cells by visualizing Ca2+ waves originating from caveolar structures.9 Moreover, a number of studies have shown that disruption of caveolae, eg, with methyl-β-cyclodextrin, significantly inhibits capacitive calcium entry.15,27 Even though we could speculate on the specificity of such treatments, these observations corroborate the preferential location of several Ca2+ regulatory proteins in the caveolae.9 Interestingly, members of the TRP channel family have recently been reported to reside in caveolae.10,14,28 TRPC1, which seems to be involved in capacitive calcium entry,29 also coimmunoprecipitates with caveolin-1,15,27 suggesting that the 2 proteins physically interact and that TRPC1 resides in the caveolae. Indeed, caveolin-1 helps to localize TRPC1 to the membrane and seems to directly regulate TRPC1 channel function through its scaffolding domain.30,31 Very recently, Fleming and collaborators32 demonstrated that overexpression of Cyp2C9 enhanced the agonist-induced translocation of TRPC6-V5 to caveolin-1–rich areas of the endothelial cell membrane, which was prevented by Rp-cAMPS and mimicked by 1,12-EET. A recent study has also shown that caveolin-1 is associated with a dynamic protein complex consisting of TRPC4, TRPC1, and IP3R under acetylcholine stimulation in murine lung endothelial cells.10

In endothelial and smooth muscle cells, [Ca2+]i is increased after stimulation with EETs,18 compounds proposed to act as an EDHF.33 This effect is mediated by TRPV4 channel activation.18,34,35 Moreover, TRPV4 channels have been proposed to be regulated by products of cytoplasmic phospholipase A2 and to contribute to endothelial-dependent vasorelaxation.17,35 It was further documented that Ca2+ entry through the endothelial TRPV4 channels triggers NO- and EDHF-dependent vasorelaxation.18,36 In addition, TRPV4 channels seem to be involved in endothelial mechanosensing of shear stress–induced vasodilation and therefore may represent a novel pharmacological target for hypertension treatment.36 In our study, we have shown that the NO- and EDHF-dependent relaxation induced by carbachol is altered in arteries from TRPV4 KO mice, confirming an important role of this channel in endothelial vasorelaxation. In endothelial cells, muscarinic cholinergic receptor activation may stimulate phospholipase C activation, leading to IP3 and diacylglycerol formation and to Ca2+ entry. This could in turn activate phospholipase A2 to generate arachidonic acid and EETs via the epoxygenase CYP 2J/2C. EETs would activate TRPV4 channels, which will mediate Ca2+ influx and subsequent KCa activation.

Moreover, we have demonstrated that specific TRPV4 activation by 4{alpha}PDD evokes an increase of [Ca2+]i, which is smaller in endothelial cells transfected with caveolin-1-siRNA compared with controls. These data suggested a functional interaction between caveolin-1 and TRPV4. Subcellular fractionation of aorta tissue and endothelial cells revealed a colocalization of TRPV4 and caveolin-1 in the caveolae-enriched membrane fractions. On immunoprecipitation, a complex of TRPV4 and caveolin-1 was detected. Altogether, these results suggest that TRPV4 activity is in part regulated by caveolin-1 and/or that this channel requires caveolar location to function properly.

Gap junctions are the sites of intimate cell-to-cell contacts, allowing electric propagation as well as passage of ions, second messengers, and other small molecules. Specifically, the myoendothelial gap junctions (composed of Cx37, Cx40, and Cx43) have been implicated in the EDHF signal spread from endothelial to smooth muscle cells.6 This was confirmed in our study as we observed that EDHF-dependent relaxation of WT vessels was dramatically inhibited by the gap-junctional uncoupling agent carbenoxolone. Hyperpolarization spread is also dependent on homocellular electric and chemical coupling in the intima and in the media, generating a continuum between coupled cells. Immunohistochemistry and Western blot have shown decreased expression of connexins in caveolin-1 KO arteries compared with WT. Myoendothelial gap junctions were observed on endothelial cell projections in the media of WT vessels, as previously documented, and specific staining for the 3 connexins confirmed their presence in these junctions.37 By contrast, in caveolin-1 KO mouse arteries, few existing junctions were evident. These results suggest that caveolin-1 may interact with the connexins and regulate their targeting at the plasma membrane. In WT vessels, the presence of Cx43, Cx40, and Cx37 was also demonstrated in intracellular caveolar structure (illustrated for Cx37 in Figure 6A). Using cell fractionation, we showed a colocalization of caveolin-1 with Cx43. Together with our calcein-based functional assay (Figure 6), these data suggest that caveolin-1 absence directly affects connexin location at the plasma membrane and, consequently, formation and function of gap junctions, thereby impairing the spread of EDHF-related hyperpolarization and relaxation.

NO-mediated relaxation is increased in superior mesenteric arteries from caveolin-1 KO mice. In these mice, the negative regulation by caveolin-1 on eNOS activity2 is abrogated, and, consequently, eNOS protein is constitutively activated, leading to enhanced NO production. This seems to occur even in small arteries, in which EDHF is the most prominent endothelial vasorelaxing factor. It was suggested that the excess of NO production could directly inhibit EDHF relaxation.26 However, in our study, EDHF-mediated hyperpolarization could not be restored by L-NA pretreatment, a NOS inhibitor. Moreover, when caveolin-1 WT arteries were exposed to an exogenous NO donor, EDHF-mediated relaxation was not affected, suggesting that the larger NO production observed in caveolin-1 KO arteries did not inhibit EDHF relaxation.

The role of caveolae in the signaling cascade leading to EDHF-mediated relaxation may have clinical significance in the development of pathological states like atherosclerosis. Hypercholesterolemia is associated with impaired endothelial NO production, and, as a consequence, alterations in eNOS abundance and activity were proposed to constitute early events in the development of atherosclerosis.38 Our group has provided biochemical and functional evidence that high levels of low-density lipoprotein cholesterol decrease NO production in endothelial cells by upregulating caveolin-1 abundance and promoting its inhibitory interaction with eNOS.39,40 Our results suggest that EDHF-mediated relaxation could be preserved in such pathological states and act as backup relaxation. Previous work in human arteries confirms this hypothesis, showing preserved EDHF-mediated relaxation despite the presence of risk factors for atherosclerosis.22,41

In conclusion, we observed that the genetic deletion of caveolin-1 results in total absence of EDHF-mediated relaxation in caveolin-1 KO arteries. This phenomenon emphasizes the role played by caveolin-1 at different steps of the EDHF-related signaling cascade. By altering Ca2+ entry, caveolin-1 deletion may interfere with the initiation of EDHF-dependent relaxation, which is mediated by a [Ca2+]i increase in endothelial cells. This is in part due to the disruption of TRPV4 function, as suggested by the caveolar location of this channel and its contribution to NO- and EDHF-mediated relaxation. Finally, caveolin-1 deletion alters the expression and caveolar location of Cx37, Cx40, and Cx43, myoendothelial and vascular homocellular gap-junction components, thereby interfering with the intercellular spread of EDHF hyperpolarization.


*    Acknowledgments
 
The authors express special thanks to Stefania Castrezzati and Hrag Esfahani for excellent technical assistance.

Sources of Funding

J. Saliez is the recipient of a Fonds pour la formation à la Recherche dans l’Industrie et dans l’Agriculture (FRIA) fellowship. Drs Dessy and Feron are the Fond National de la Recherche Scientifique (FNRS) research associate and senior research associate, respectively. Drs Bouzin and Desjardins are FNRS postdoctoral researcher and research fellow, respectively. Dr Vriens is a Flanders Science Foundation (FWO) postdoctoral fellow. This work was supported by grants Action de Recherche Concertée (ARC) 06/11339 (Dr Dessy), Fonds de la recherche scientifique médicale (FRSM) 3.4547.03 (Dr Dessy), the Politique Scientifique Fédérale PAI6/30, the Fondation Leducq (Dr Balligand), Human Frontiers Science Program (RGP 32/2004, Dr Nilius), Commissariat général aux relations internationals (CGRI) travel grant (Dr Bouzin), and Flemish Government Center of Excellence financing (Dr Nilius, EF/95/010).

Disclosures

None.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Feletou M, Vanhoutte PM. Endothelium-derived hyperpolarizing factor: where are we now? Arterioscler Thromb Vasc Biol. 2006; 26: 1215–1225.[Abstract/Free Full Text]

2. Sbaa E, Frerart F, Feron O. The double regulation of endothelial nitric oxide synthase by caveolae and caveolin: a paradox solved through the study of angiogenesis. Trends Cardiovasc Med. 2005; 15: 157–162.[CrossRef][Medline] [Order article via Infotrieve]

3. Feron O, Dessy C, Opel DJ, Arstall MA, Kelly RA, Michel T. Modulation of the endothelial nitric-oxide synthase-caveolin interaction in cardiac myocytes: implications for the autonomic regulation of heart rate. J Biol Chem. 1998; 273: 30249–30254.[Abstract/Free Full Text]

4. Sonveaux P, Martinive P, Dewever J, Batova Z, Daneau G, Pelat M, Ghisdal P, Gregoire V, Dessy C, Balligand JL, Feron O. Caveolin-1 expression is critical for vascular endothelial growth factor-induced ischemic hindlimb collateralization and nitric oxide-mediated angiogenesis. Circ Res. 2004; 95: 154–161.[Abstract/Free Full Text]

5. Chen G, Suzuki H, Weston AH. Acetylcholine releases endothelium-derived hyperpolarizing factor and EDRF from rat blood vessels. Br J Pharmacol. 1988; 95: 1165–1174.[Medline] [Order article via Infotrieve]

6. Griffith TM. Endothelium-dependent smooth muscle hyperpolarization: do gap junctions provide a unifying hypothesis? Br J Pharmacol. 2004; 141: 881–903.[CrossRef][Medline] [Order article via Infotrieve]

7. Marrelli SP. Mechanisms of endothelial P2Y(1)- and P2Y(2)-mediated vasodilatation involve differential [Ca2+]i responses. Am J Physiol. 2001; 281: H1759–H1766.

8. Busse R, Edwards G, Feletou M, Fleming I, Vanhoutte PM, Weston AH. EDHF: bringing the concepts together. Trends Pharmacol Sci. 2002; 23: 374–380.[CrossRef][Medline] [Order article via Infotrieve]

9. Isshiki M, Anderson RG. Function of caveolae in Ca2+ entry and Ca2+-dependent signal transduction. Traffic. 2003; 4: 717–723.[CrossRef][Medline] [Order article via Infotrieve]

10. Murata T, Lin MI, Stan RV, Bauer PM, Yu J, Sessa WC. Genetic evidence supporting caveolae microdomain regulation of calcium entry in endothelial cells. J Biol Chem. 2007; 282: 16631–16643.[Abstract/Free Full Text]

11. Fujimoto T, Nakade S, Miyawaki A, Mikoshiba K, Ogawa K. Localization of inositol 1,4,5-trisphosphate receptor-like protein in plasmalemmal caveolae. J Cell Biol. 1992; 119: 1507–1513.[Abstract/Free Full Text]

12. Fujimoto T. Calcium pump of the plasma membrane is localized in caveolae. J Cell Biol. 1993; 120: 1147–1157.[Abstract/Free Full Text]

13. Li S, Okamoto T, Chun M, Sargiacomo M, Casanova JE, Hansen SH, Nishimoto I, Lisanti MP. Evidence for a regulated interaction between heterotrimeric G proteins and caveolin. J Biol Chem. 1995; 270: 15693–15701.[Abstract/Free Full Text]

14. Lockwich T, Singh BB, Liu X, Ambudkar IS. Stabilization of cortical actin induces internalization of transient receptor potential 3 (Trp3)-associated caveolar Ca2+ signaling complex and loss of Ca2+ influx without disruption of Trp3-inositol trisphosphate receptor association. J Biol Chem. 2001; 276: 42401–42408.[Abstract/Free Full Text]

15. Lockwich TP, Liu X, Singh BB, Jadlowiec J, Weiland S, Ambudkar IS. Assembly of Trp1 in a signaling complex associated with caveolin-scaffolding lipid raft domains. J Biol Chem. 2000; 275: 11934–11942.[Abstract/Free Full Text]

16. Brazer SC, Singh BB, Liu X, Swaim W, Ambudkar IS. Caveolin-1 contributes to assembly of store-operated Ca2+ influx channels by regulating plasma membrane localization of TRPC1. J Biol Chem. 2003; 278: 27208–27215.[Abstract/Free Full Text]

17. Watanabe H, Vriens J, Prenen J, Droogmans G, Voets T, Nilius B. Anandamide and arachidonic acid use epoxyeicosatrienoic acids to activate TRPV4 channels. Nature. 2003; 424: 434–438.[CrossRef][Medline] [Order article via Infotrieve]

18. Vriens J, Owsianik G, Fisslthaler B, Suzuki M, Janssens A, Voets T, Morisseau C, Hammock BD, Fleming I, Busse R, Nilius B. Modulation of the Ca2 permeable cation channel TRPV4 by cytochrome P450 epoxygenases in vascular endothelium. Circ Res. 2005; 97: 908–915.[Abstract/Free Full Text]

19. Schubert AL, Schubert W, Spray DC, Lisanti MP. Connexin family members target to lipid raft domains and interact with caveolin-1. Biochemistry. 2002; 41: 5754–5764.[CrossRef][Medline] [Order article via Infotrieve]

20. Wang XL, Ye D, Peterson TE, Cao S, Shah VH, Katusic ZS, Sieck GC, Lee HC. Caveolae targeting and regulation of large conductance Ca(2+)-activated K+ channels in vascular endothelial cells. J Biol Chem. 2005; 280: 11656–11664.[Abstract/Free Full Text]

21. Ghisdal P, Godfraind T, Morel N. Effect of nitro-L-arginine on electrical and mechanical responses to acetylcholine in the superior mesenteric artery from stroke-prone hypertensive rat. Br J Pharmacol. 1999; 128: 1513–1523.[CrossRef][Medline] [Order article via Infotrieve]

22. Dessy C, Moniotte S, Ghisdal P, Havaux X, Noirhomme P, Balligand JL. Endothelial beta3-adrenoceptors mediate vasorelaxation of human coronary microarteries through nitric oxide and endothelium-dependent hyperpolarization. Circulation. 2004; 110: 948–954.[Abstract/Free Full Text]

23. Brouet A, Sonveaux P, Dessy C, Balligand JL, Feron O. Hsp90 ensures the transition from the early Ca2+-dependent to the late phosphorylation-dependent activation of the endothelial nitric-oxide synthase in vascular endothelial growth factor-exposed endothelial cells. J Biol Chem. 2001; 276: 32663–32669.[Abstract/Free Full Text]

24. Massion PB, Dessy C, Desjardins F, Pelat M, Havaux X, Belge C, Moulin P, Guiot Y, Feron O, Janssens S, Balligand JL. Cardiomyocyte-restricted overexpression of endothelial nitric oxide synthase (NOS3) attenuates beta-adrenergic stimulation and reinforces vagal inhibition of cardiac contraction. Circulation. 2004; 110: 2666–2672.[Abstract/Free Full Text]

25. Griffith TM, Chaytor AT, Taylor HJ, Giddings BD, Edwards DH. cAMP facilitates EDHF-type relaxations in conduit arteries by enhancing electrotonic conduction via gap-junctions. Proc Natl Acad Sci U S A. 2002; 99: 6392–6397.[Abstract/Free Full Text]

26. Bauersachs J, Popp R, Hecker M, Sauer E, Fleming I, Busse R. Nitric oxide attenuates the release of endothelium-derived hyperpolarizing factor. Circulation. 1996; 94: 3341–3347.[Abstract/Free Full Text]

27. Bergdahl A, Gomez MF, Dreja K, Xu SZ, Adner M, Beech DJ, Broman J, Hellstrand P, Sward K. Cholesterol depletion impairs vascular reactivity to endothelin-1 by reducing store-operated Ca2+ entry dependent on TRPC1. Circ Res. 2003; 93: 839–847.[Abstract/Free Full Text]

28. Brazer SC, Singh BB, Liu X, Swaim W, Ambudkar IS. Caveolin-1 contributes to assembly of store-operated Ca2+ influx channels by regulating plasma membrane localization of TRPC1. J Biol Chem. 2003; 278: 27208–27215.[Abstract/Free Full Text]

29. Parekh AB, Putney JW Jr. Store-operated calcium channels. Physiol Rev. 2005; 85: 757–810.[Abstract/Free Full Text]

30. Ambudkar IS, Brazer SC, Liu X, Lockwich T, Singh B. Plasma membrane localization of TRPC channels: role of caveolar lipid rafts. Novartis Found Symp. 2004; 258: 63–70.[Medline] [Order article via Infotrieve]

31. Kwiatek AM, Minshall RD, Cool DR, Skidgel RA, Malik AB, Tiruppathi C. Caveolin-1 regulates store-operated Ca2+ influx by binding of its scaffolding domain to transient receptor potential channel-1 in endothelial cells. Mol Pharmacol. 2006; 70: 1174–1183.[Abstract/Free Full Text]

32. Fleming I, Rueben A, Popp R, Fisslthaler B, Schrodt S, Sander A, Haendeler J, Falck JR, Morisseau C, Hammock BD, Busse R. Epoxyeicosatrienoic acids regulate Trp channel dependent Ca2+ signaling and hyperpolarization in endothelial cells. Arterioscler Thromb Vasc Biol. 2007; 27: 2612–2618.[Abstract/Free Full Text]

33. Fisslthaler B, Popp R, Kiss L, Potente M, Harder DR, Fleming I, Busse R. Cytochrome P450 2C is an EDHF synthase in coronary arteries. Nature. 1999; 401: 493–497.[CrossRef][Medline] [Order article via Infotrieve]

34. Earley S, Heppner TJ, Nelson MT, Brayden JE. TRPV4 forms a novel Ca2+ signaling complex with ryanodine receptors and BKCa channels. Circ Res. 2005; 97: 1270–1279.[Abstract/Free Full Text]

35. Marrelli SP, O’Neil RG, Brown RC, Bryan RM Jr. PLA2 and TRPV4 channels regulate endothelial calcium in cerebral arteries. Am J Physiol. 2007; 292: H1390–H1397.

36. Kohler R, Heyken WT, Heinau P, Schubert R, Si H, Kacik M, Busch C, Grgic I, Maier T, Hoyer J. Evidence for a functional role of endothelial transient receptor potential V4 in shear stress–induced vasodilatation. Arterioscler Thromb Vasc Biol. 2006; 26: 1495–1502.[Abstract/Free Full Text]

37. Sandow SL, Hill CE. Incidence of myoendothelial gap junctions in the proximal and distal mesenteric arteries of the rat is suggestive of a role in endothelium-derived hyperpolarizing factor–mediated responses. Circ Res. 2000; 86: 341–346.[Abstract/Free Full Text]

38. Napoli C, de Nigris F, Williams-Ignarro S, Pignalosa O, Sica V, Ignarro LJ. Nitric oxide and atherosclerosis: an update. Nitric Oxide. 2006; 15: 265–279.[CrossRef][Medline] [Order article via Infotrieve]

39. Feron O, Dessy C, Moniotte S, Desager JP, Balligand JL. Hypercholesterolemia decreases nitric oxide production by promoting the interaction of caveolin and endothelial nitric oxide synthase. J Clin Invest. 1999; 103: 897–905.[Medline] [Order article via Infotrieve]

40. Pelat M, Dessy C, Massion P, Desager JP, Feron O, Balligand JL. Rosuvastatin decreases caveolin-1 and improves nitric oxide–dependent heart rate and blood pressure variability in apolipoprotein E–/– mice in vivo. Circulation. 2003; 107: 2480–2486.[Abstract/Free Full Text]

41. Miura H, Liu Y, Gutterman DD. Human coronary arteriolar dilation to bradykinin depends on membrane hyperpolarization: contribution of nitric oxide and Ca2+-activated K+ channels. Circulation. 1999; 99: 3132–3138.[Abstract/Free Full Text]


 

CLINICAL PERSPECTIVE

The present study emphasizes the role played by caveolin-1 at major steps of the endothelium-derived hyperpolarizing factor–related signaling cascade. Our study expands our understanding of the functions of TRPV4 channels in endothelial biology and raises the possibility of targeting these specific channels to improve vascular relaxation in the context of coronary or peripheral ischemic diseases characterized by deficient endothelium-dependent relaxation. The spread of endothelial hyperpolarization through gap junctions is crucial to coordinate vascular relaxation along the vessel wall. Our results highlight the existence of a caveolin-dependent regulation of these gap junctions. In addition to facilitating the compartmentation of signaling mediators within microdomains, caveolin interactions may be keys for the backup role of endothelium-derived hyperpolarizing factor in pathological conditions. Indeed, we have previously demonstrated that high levels of low-density lipoprotein cholesterol decrease nitric oxide production in endothelial cells by upregulating caveolin-1 abundance and promoting its inhibitory interaction with endothelial nitric oxide synthase. Our present results suggest that crucial steps of endothelium-derived hyperpolarizing factor signaling, that is, calcium influx through TRPV4 and proper gap junction function, could be preserved or even facilitated in such pathological conditions.


*    Footnotes
 
*Drs Bouzin and Rath contributed equally to this work. Back

The online-only Data Supplement, consisting of expanded Methods and figures, is available with this article at http://circ.ahajournals.org/cgi/content/ full/CIRCULATIONAHA.107.731679/DC1.


Related Article:

Clinical Summaries
Circulation 2008 117: 987-989. [Extract] [Full Text]



This article has been cited by other articles:


Home page
Circ. Res.Home page
B. D.M. Meijering, L. J.M. Juffermans, A. van Wamel, R. H. Henning, I. S. Zuhorn, M. Emmer, A. M.G. Versteilen, W. J. Paulus, W. H. van Gilst, K. Kooiman, et al.
Ultrasound and Microbubble-Targeted Delivery of Macromolecules Is Regulated by Induction of Endocytosis and Pore Formation
Circ. Res., March 13, 2009; 104(5): 679 - 687.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
D. X. Zhang, S. A. Mendoza, A. H. Bubolz, A. Mizuno, Z.-D. Ge, R. Li, D. C. Warltier, M. Suzuki, and D. D. Gutterman
Transient Receptor Potential Vanilloid Type 4-Deficient Mice Exhibit Impaired Endothelium-Dependent Relaxation Induced by Acetylcholine In Vitro and In Vivo
Hypertension, March 1, 2009; 53(3): 532 - 538.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
F. R. Carreno, L. L. Ji, and J. T. Cunningham
Altered central TRPV4 expression and lipid raft association related to inappropriate vasopressin secretion in cirrhotic rats
Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2009; 296(2): R454 - R466.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
H. C. Hercule, W.-H. Schunck, V. Gross, J. Seringer, F. P. Leung, S. M. Weldon, A. Ch. da Costa Goncalves, Y. Huang, F. C. Luft, and M. Gollasch
Interaction Between P450 Eicosanoids and Nitric Oxide in the Control of Arterial Tone in Mice
Arterioscler. Thromb. Vasc. Biol., January 1, 2009; 29(1): 54 - 60.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
F. Desjardins, I. Lobysheva, M. Pelat, B. Gallez, O. Feron, C. Dessy, and J.-L. Balligand
Control of blood pressure variability in caveolin-1-deficient mice: role of nitric oxide identified in vivo through spectral analysis
Cardiovasc Res, April 9, 2008; (2008) cvn080v2.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
117/8/1065    most recent
CIRCULATIONAHA.107.731679v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Saliez, J.
Right arrow Articles by Dessy, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Saliez, J.
Right arrow Articles by Dessy, C.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*CALCIUM COMPOUNDS
*CALCIUM, ELEMENTAL
*NITRIC OXIDE
Related Collections
Right arrow Endothelium/vascular type/nitric oxide
Right arrow Other Vascular biology
Right arrowRelated Article