Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 1995;91:962-967

This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Booth, D. R.
Right arrow Articles by Frustaci, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Booth, D. R.
Right arrow Articles by Frustaci, A.

(Circulation. 1995;91:962-967.)
© 1995 American Heart Association, Inc.


Articles

A Novel Variant of Transthyretin, 59Thr->Lys, Associated With Autosomal Dominant Cardiac Amyloidosis in an Italian Family

D. R. Booth, PhD; S. Y. Tan, MRCP; P. N. Hawkins, PhD, FRCP; M. B. Pepys, MD, PhD, FRCP; A. Frustaci, MD, FCCP

From the Immunological Medicine Unit (D.R.B., S.Y.T., P.N.H., M.B.P), Department of Medicine, Royal Postgraduate Medical School, Hammersmith Hospital, London, UK; and the Istituto di Cardiologia (A.F.), Universita Cattolica del S Cuore, Rome, Italy.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background Amyloidosis is a disorder of protein metabolism characterized by extracellular accumulation of abnormal protein fibrils. Different proteins form the fibrils in different forms of the disease, and the condition can be acquired or hereditary. Involvement of the heart is quite common, producing a serious and usually fatal cardiomyopathy. Cardiac amyloidosis is often diagnosed late, and cardiac biopsy together with proper histological examination is essential. Contrary to previous perceptions, there is much recent evidence of effective treatment for several different types of systemic and cardiac amyloidosis, including the most common hereditary form caused by mutations in the transthyretin gene. Chemical and genetic typing of amyloid is therefore of considerable clinical importance.

Methods and Results Seven members in two generations of an Italian family presented with cardiac disease inherited as an autosomal dominant and were found to have systemic amyloidosis. Angina pectoris–like pain, an unusual feature in cardiac amyloidosis, was a prominent symptom, possibly related to partial obliteration of the distal coronary arteries by amyloid infiltration. There were also cases of sudden cardiac death. Peripheral and autonomic neuropathy, which are the usual features of hereditary amyloidosis, were present in only two cases, and a diagnosis of acquired, immunoglobulin light chain (AL type) amyloidosis was suspected in the index case before the family history emerged. In fact, the amyloid fibrils were composed of transthyretin, and the two affected individuals from whom DNA was available were both heterozygotes for a single base change in exon 3 of the transthyretin gene, encoding substitution of Lys for the wild-type Thr residue at position 59 in the mature protein. This mutation has not previously been reported.

Conclusions We have identified a novel mutation in the transthyretin gene encoding 59Thr->Lys associated with autosomal dominant hereditary systemic amyloidosis in an Italian kindred in whom cardiac involvement was the major feature. This family illustrates the difficulty in diagnosis of cardiac amyloid, the variable clinical phenotype in hereditary amyloidosis even within a family, and the importance of precise fibril typing for correct management in this condition.


Key Words: amyloid • cardiomyopathy • genes • proteins


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Cardiac amyloidosis is a distinct form of cardiomyopathy that usually carries a grave prognosis.1 Amyloid deposits are largely composed of protein fibrils, the precursors of which differ in different forms of the disease, and clinical amyloidosis syndromes are classified according to the identity of these proteins and whether the disorder is acquired or hereditary.2 3 It is essential to characterize the underlying process in all cases because this may have major implications for prognosis and treatment. Hereditary forms of amyloidosis are rare but are extremely serious for the affected families and also are valuable models for understanding the pathogenesis of amyloid deposition in general. This is important because clinically significant amyloidosis is not rare2 : localized amyloid deposits in the brain are a hallmark pathological feature in Alzheimer's disease, and amyloid is present in the islets of Langerhans of the pancreas in most patients with type II diabetes mellitus. Systemic forms of amyloidosis are less frequently encountered, but their management is a major challenge.

Clinically significant acquired cardiac amyloidosis is usually of AL (formerly known as primary) type, in which the amyloid fibril protein is derived from monoclonal immunoglobulin light chains.1 2 Although so-called senile cardiac amyloid, in which normal wild-type transthyretin (TTR) is the fibril protein, is very common in the elderly, it is rarely symptomatic.1 4 Hereditary cardiac amyloidosis presents from the third decade on and usually occurs in the context of familial amyloid polyneuropathy (FAP),1 5 associated with peripheral and autonomic neuropathy, which dominate the clinical picture, although there are families in which cardiac involvement has been the major or only clinical feature. The amyloid fibril protein in most kindreds with FAP is derived from variant TTR. In each family, the variant contains a single amino acid substitution encoded by a point mutation in the TTR gene, and more than 40 such mutations, inherited in an autosomal dominant pattern, have been identified.2 6

We report on an Italian family with a new variant of TTR associated with hereditary amyloidosis and a predominantly cardiac presentation. Interestingly, the clinical features in several of the affected individuals strongly suggested ischemic heart disease. This family illustrates the diverse phenotypic expression of amyloidogenic mutations and underscores the importance of early diagnosis in cardiac amyloidosis.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Clinical Evaluation of Patients
Clinical details and the results of routine investigations were available for seven members of an Italian family, who all presented with cardiac disease. Cardiac investigation included 12-lead ECG, 24-hour Holter rhythm monitoring, and detailed echocardiography with Doppler analysis. Cardiac catheterization, endomyocardial biopsies, and electrophysiological studies were performed in some cases. Limited autopsies were obtained in three cases.

Histology
Tissue was available from each case, obtained during life in four and at autopsy in the remainder. Myocardial tissue was studied in six cases, rectum tissue in two, and small intestine and sural nerve tissue in one case each. Amyloid was identified by Congo red staining with pathognomonic green birefringence when viewed under crossed polarized light.7

Immunohistochemical Staining
For detection of TTR, sections were first incubated with 1% w/v sodium-m-periodate for 10 minutes, 0.1% w/v sodium borohydride for 10 minutes, and then overnight with 6 mol/L guanidine hydrochloride in 0.9% w/v NaCl, to enhance immunoreactivity. After washing with saline non–specific binding was blocked by incubation with 10% (v/v) normal non–immune goat serum in 10 mmol/L Tris-buffered saline (TBS) for 60 minutes at room temperature. Sections were then incubated overnight at 4°C with specific polyclonal rabbit anti-human TTR antibodies (Dako Ltd) diluted 1:400 in TBS containing 1% (v/v) normal goat serum. Specificity of staining was established by reacting adjacent serial sections with the same dilution of antiserum previously absorbed with pure human TTR to remove all anti-TTR activity. After these primary reagents, the slides were washed on a rotating platform, twice with TBS containing Triton X-100 (BDH Laboratory Supplies) 0.005% (v/v) and once with TBS alone before incubation for 60 minutes at room temperature with polyclonal goat anti-rabbit antiserum (ICN Biochemicals Ltd) 1:50 in 5% (v/v) normal human serum. The washing as detailed above was repeated, and sections were then incubated at room temperature for 60 minutes with rabbit peroxidase–anti-peroxidase complexes (PAP) (Serotec Ltd) 1:50 with 1% (v/v) normal goat serum in TBS. After another wash cycle to remove unbound rabbit PAP, bound enzyme was detected using 3,3'-diaminobenzidine tetrahydrochloride (Sigma Chemical Co Ltd) 0.05% (w/v) in TBS containing 10 mmol/L imidazole (BDH Laboratory Supplies), and 0.002% (v/v) H2O2 (Taab Laboratory Equipment Ltd) as substrate. Separate sections were stained using antisera against other known amyloid fibril proteins: {kappa} and {lambda} immunoglobulin light chains, amyloid A protein, apolipoprotein A-I, and lysozyme.

Radiolabeled SAP Scintigraphy and Turnover Studies
Whole-body scintigraphic imaging and a 24-hour plasma turnover study were performed in one patient (III.4) using 123I-labeled serum amyloid P component (SAP), as previously described.8 9 Briefly, anterior and posterior whole-body scans and regional images were obtained with an IGE Starcam gamma camera 24 hours after intravenous injection of 123I-labeled SAP (200 MBq of activity associated with 100 µg of pure protein). The decline of radioactivity was measured in the plasma over 24 hours, and activity was also estimated in the complete collection of urine obtained for 24 hours after isotope administration.

Isolation of DNA and Amplification and Sequencing of TTR Gene
DNA was extracted from whole blood,10 and TTR exons were amplified by the polymerase chain reaction (PCR) using taq polymerase (Amplitaq, Perkin Elmer Cetus) with the following cycling conditions: 1 cycle of 94°C, 5 minutes; 35 cycles of 94°C for 1 minute, 60°C for 1 minute, and 72°C for 1 minute; and a final step of 72°C for 10 minutes. The reaction mixture was 10 mmol/L Tris, 50 mmol/L KCl, 1.5 mmol/L MgCl2, 0.1% v/v Triton X100 (pH 8.8) containing 160 mmol/L dNTP, 200 ng of each primer, 2.5 units polymerase, and 10 µL of DNA template in a final volume of 100 µL. For exon 1, the primers were the intron sequences (5' to 3'); CAGCAGGTTTGCAGTCAGAT and GGTACCCTTGCCCTAGTAAT; for exon 2, CAATTTTGTTAACTTCTCACG and CAGATGATGTGAGCCTCTCTC; for exon 3, CCTCCATGCGTAACTTAATCC and TAGGACATTTCTGTGGTACAC; and for exon 4, TGGTGGAAATGGATCTGTCTG and TGGAAGGGACAATAAGGGAAT.

PCR products (100 µL) were purified by size fractionation on a Nusieve agarose gel (FMC, Rockland, ME). The band was extracted using Magiprep columns (Promega) recovered by ethanol precipitation and dissolved in 12 µL of distilled water. Six microliters were then used in the sequencing reaction for each primer.

The sequencing reaction was modified from the method of Casanova et al.11 A reaction mix containing 2 µL of sequencing buffer, 2 µL of primer (100 ng/µL), and 6 µL of template was boiled for 2 minutes before being frozen in a dry ice–methanol bath for 15 seconds, and then 5 µL of Mastermix was added. Just after the mixture thawed, 3 µL was added to 2.5 µL of each of the four dideoxynucleotides, and the termination reaction was then incubated at 37°C for 2 minutes before the addition of 4 µL of stop solution. The same primers were used for PCR and sequencing, except that for exon 4, the primer (5'-3') CTCGTCCTTCAGGTCCACTG was used because, for unknown reasons, poor sequence was obtained with the exon 4 PCR downstream primer.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Clinical Features
The seven patients presented with chest pain typical of angina pectoris (n=4), with exertional dyspnea (n=1), or with sudden cardiac death (n=2) (Fig 1Down, TableDown). Two patients died suddenly shortly after presenting with chest pain. ECG, obtained in six patients, demonstrated reduction in standard lead voltages and a pseudoinfarct pattern (characterized by deep Q waves in the inferior and septal leads) in each patient (Fig 2Down). First-degree atrioventricular block was present in one patient. Echocardiography, performed in three patients, demonstrated massive concentric thickening of the left ventricular wall (mean approximately, 18 mm) with small internal left ventricular dimensions and good systolic function; Doppler studies showed a restrictive filling defect in each case. There was no evidence of atheromatous coronary artery disease at angiography or at autopsy (three patients each). Ventriculography showed normal contractility in each of three cases and mild mitral regurgitation in two patients. Left ventricular end-diastolic pressure was elevated to about 25 mm Hg in each case, and pressure tracings showed a restrictive (deep-plateau) pattern. Pulmonary artery pressure was elevated to approximately 45/25 in the three patients studied, and the cardiac index was within normal limits. Twenty-four-hour ambulatory ECG monitoring was performed in two patients and in each demonstrated frequent ventricular extrasystoles; ventricular tachycardia was induced during electrophysiological studies in one patient and abolished after oral amiodarone therapy of 800 mg/d for 1 week.



View larger version (11K):
[in this window]
[in a new window]
 
Figure 1. Family tree of the Italian kindred with hereditary cardiac amyloidosis. Affected individuals are indicated with solid symbols. Individual I.2 (hatched symbol) is suspected of having had amyloidosis. The only clinically affected living member of the family, individual III.4, is aged 62.


View this table:
[in this window]
[in a new window]
 
Table 1. Clinical Details of Affected Family Members



View larger version (82K):
[in this window]
[in a new window]
 
Figure 2. ECG of individual III.3, showing the low voltage in the standard leads and the inferoseptal pseudoinfarct pattern that characterized the ECGs of all patients for whom they were available.

Evidence of clinically significant amyloid deposition outside the heart was apparent at presentation in only one patient (TableUp, patient III.5), in whom there were neuropathic features typical of FAP. Autonomic and peripheral neuropathy developed 2 years after presentation in only one other patient (III.3). No patient had clinical evidence of nephropathy.

Histology and Immunohistochemistry
Congo red stains confirmed the presence of abundant amyloid deposits in all biopsy specimens from each of the seven patients. Cardiac histology was similar in each patient and showed regularly arranged muscle fibers exhibiting hypertrophy or atrophy. There was some interstitial fibrosis and very extensive amyloid deposition. The intramyocardial arteries were also heavily infiltrated with amyloid, causing significant luminal narrowing in some areas. The abundant congophilic amyloid deposits in myocardial and rectal biopsy tissue from patient III.5 reacted strongly with an antiserum to TTR (Fig 3Down) but not with antisera to other known amyloid fibril proteins. The TTR immunoreactivity was completely abolished by prior absorption of the antiserum with pure TTR (Fig 3Down).





View larger version (443K):
[in this window]
[in a new window]
 
Figure 3. Photomicrographs of transthyretin amyloid in tissues of patient III.5. A, Myocardium stained with Congo red and viewed in crossed polarized light, showing massive infiltration with brightly birefringent amyloid deposits. B, Myocardium stained with monospecific antiserum to transthyretin, showing extensive dark peroxidase reaction product. C, Myocardium stained with antiserum to transthyretin that had been absorbed with isolated pure transthyretin, showing complete absence of reactivity. D, Rectal submucosa stained with monospecific antiserum to transthyretin, showing extensive dark peroxidase reaction product. E, Rectal submucosa stained with antiserum to transthyretin that had been absorbed with isolated pure transthyretin, showing complete absence of reactivity. All illustrations are at the same magnification; the magnification bars correspond to 100 µm.

Radiolabeled SAP Studies
123I-SAP scintigraphy in patient III.4 demonstrated the presence of unsuspected amyloid deposits in the spleen and both kidneys. Plasma and whole-body turnover of the tracer fell within our reference range for normal subjects,12 indicating that less than 10% of the activity had localized to amyloid, consistent with a relatively modest whole-body amyloid load.

Characterization of the TTR Gene
Amplification and direct sequencing of all four exons of the TTR gene13 in patients III.3 and III.4 showed that they were heterozygotes with a single base change in one allele, altering the codon for residue 59 of the native protein from ACA (Thr) to AAA (Lys) (Fig 4Down). The remainder of the sequence was normal in both alleles.



View larger version (63K):
[in this window]
[in a new window]
 
Figure 4. Nucleotide sequence of part of exon 3 of the transthyretin gene from patient III.3 (right) compared with a healthy subject (left). The patient was a heterozygote for a single- base change in one allele altering the codon for residue 59 from the wild-type ACA encoding Thr to AAA encoding Lys. An identical result was obtained in patient III.4, the only other family member from whom DNA was available.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
Members of two, and probably three or more, generations in this family have been affected by amyloid heart disease apparently transmitted as an autosomal dominant trait. The presence of the TTR 59Lys gene mutation, TTR in the amyloid deposits, and the absence of any other TTR variant provide compelling evidence that this mutation, which has not been reported previously, is causative. Normal wild-type TTR is inherently amyloidogenic, being deposited in acquired senile amyloidosis,4 and more than 40 different point mutations in the TTR gene have been associated with hereditary amyloidosis.6 The structure of TTR has been defined to atomic resolution, and each protomer consists of an {alpha}-helix, eight ß-strands forming two face-to-face sheets, and their connecting loops.14 Mutations in ß-strand C, the CD loop, and ß-strand D region are particularly likely to be amyloidogenic.15 59Thr is situated in this part of the molecule and is highly conserved in mammalian and avian TTR sequences,16 suggesting that it is important for the molecular structure and/or function of TTR. Displacement within the CD loop and D strand, which may be induced even by quite distant substitutions, has been proposed as the final common pathway for TTR fibrillogenesis via aggregation of edge ß-strands.15

Hereditary TTR amyloidosis usually presents as FAP with peripheral and autonomic neuropathy dominating the clinical picture, although the amyloid is always systemic and symptomatic involvement of the heart and kidneys is common. However, six TTR variants (45Thr, 60Ala, 68Leu, 89Gln, 111Met, and 122Ile) have been reported in association with predominantly cardiac amyloid and minimal signs elsewhere.17 The clinical features of affected members of the present family were very diverse (TableUp), with amyloid involvement of different organ systems and at ages between the fifth and the seventh decade. One subject, III.5, presented with severe neuropathic features identical to those typically seen in FAP, and similar features developed in her brother, subject III.3, 2 years after he had presented with cardiac disease. The factors, other than the TTR mutation itself, which govern the penetrance, age of onset, and tissue distribution of amyloidosis associated with variant TTR are unknown.

A prominent feature among patients in this family was chest pain, with the characteristic quality of angina pectoris. This is an unusual symptom of cardiac amyloidosis, although it has been described before, and its basis is probably multifactorial. Increased ventricular wall tension during diastole, infiltration of the interstitial space between myocardial cells, and reduced blood flow through small distal coronary arterioles, the lumens of which were partially obliterated by amyloid in this family, may all contribute. Three family members had sudden cardiac deaths, suggesting a dysrhythmic etiology. Potentially life-threatening ventricular arrhythmias were detected in electrophysiological studies of two surviving individuals who, notably, responded to conventional therapy with amiodarone. The rhythm disturbances may have been precipitated directly by amyloid deposits and/or by ischemia.

This family study highlights some of the common difficulties faced by the clinician when a diagnosis of cardiac amyloid is suspected. The clinical features masqueraded as those of ischemic heart disease, and echocardiography suggested severe left ventricular hypertrophy raising the possibility of hypertrophic cardiomyopathy. Endomyocardial biopsy is essential to confirm the presence of cardiac amyloid, but unless immunohistochemical studies are performed in addition to Congo red histology, the type of amyloid cannot be defined. The clinical features of amyloid neuropathy and heart disease in patient III.5 were originally presumed to be those of AL amyloidosis, which frequently presents in this manner. A family history should routinely be sought, and if more than one first-degree relative has cardiac amyloidosis or if the amyloid is found to be of TTR type in a nonelderly patient, analysis of the TTR gene should be undertaken.

Restriction fragment length polymorphism and single-strand conformational polymorphism analyses have been widely used to seek TTR gene mutations, and even more sophisticated indirect approaches, such as PCRprimer–introduced restriction analysis, have been reported.18 Restriction fragment length polymorphism analysis is not applicable for the present mutation because it neither creates nor abolishes a restriction enzyme site. However, the most precise and unambiguous method for detecting mutations, with the least potential for erroneous results, is direct sequencing, as reported here.19 This can be undertaken in any routine molecular genetic laboratory.

Characterization of the molecular defect causing hereditary cardiac amyloidosis in the present family has implications for treatment. The circulating TTR is produced almost exclusively in the liver, and we have previously shown that orthotopic liver transplantation in FAP due to TTR mutations eliminates variant TTR from the circulation and is followed by clinical improvement.20 21 More than 70 cases of TTR-associated FAP have been treated by liver replacement, and the majority have benefited clinically (Proceedings of the First International Workshop on Liver Transplantation in FAP, Stockholm, September 1993, unpublished observations). SAP scintigraphy, a quantitative method for surveying the whole-body distribution and extent of amyloid, has shown that the systemic amyloid deposits regress significantly within 1 to 2 years after surgery.21 These findings are consistent with those we have obtained in systemic AA and AL amyloidosis, in which major regression of amyloid frequently also occurs when the supply of the amyloid fibril precursor protein is substantially reduced.22 23

Another life-saving option in our family is cardiac transplantation, although without simultaneous liver replacement cardiac amyloid deposition is likely to recur. Even if the time course of amyloid deposition in the donor heart was slow, and indeed it may take decades, it is probable that clinically important amyloids would develop in other organ systems. In July 1992, we performed simultaneous heart and liver transplantation in a 62-year-old man with FAP associated with the 77Tyr variant of TTR. He is alive and well with increased general well-being, having gained weight, and with subjective and objective electrophysiological evidence of improved autonomic and peripheral nerve function. This radical but potentially curative approach is currently under consideration for the present family.


*    Acknowledgments
 
This work was supported in part by MRC Programme Grant G7900510 to Prof Pepys. We thank Prof Attilio Maseri and Dr Anne Soutar for helpful discussions and Beth Sontrop for expert preparation of the manuscript.


*    Footnotes
 
Reprint requests to Dr D.R. Booth, Immunological Medicine Unit, Royal Postgraduate Medical School, Hammersmith Hospital, Du Cane Rd, London W12 0NN, UK.

Received May 18, 1994; revision received September 1, 1994; accepted September 23, 1994.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 

  1. Kyle RA, Gertz MA. Cardiac amyloidosis. Int J Cardiol. 1990;28:139-141. [Medline] [Order article via Infotrieve]
  2. Pepys MB. Amyloidosis. In: Frank MM, Austen KF, Claman HN, Unanue ER, eds. Samter's Immunological Diseases. 5th ed. Boston, Mass: Little, Brown & Co; 1994:637-655.
  3. Husby G. Nomenclature and classification of amyloid and amyloidoses. J Intern Med. 1992;232:511-512. [Medline] [Order article via Infotrieve]
  4. Pitkanen P, Westermark P, Cornwell GG. Senile systemic amyloidosis. Am J Pathol. 1984;117:391-399. [Abstract]
  5. Saraiva MJM. Recent advances in the molecular pathology of familial amyloid polyneuropathy. Neuromuscul Disord. 1991;1:3-6. [Medline] [Order article via Infotrieve]
  6. Saraiva MJM, Costa PP, Goodman DS. Transthyretin and familial amyloidotic polyneuropathy. In: Rosenberg RN, Prusiner SB, DiMauro S, Barchi RL, Kunkel LM, eds. The Molecular and Genetic Basis of Neurological Disease. Boston, Mass: Butterworths; 1993:889-894.
  7. Puchtler H, Sweat F, Levine M. On the binding of Congo red by amyloid. J Histochem Cytochem. 1962;10:355-364. [Abstract]
  8. Hawkins PN, Myers MJ, Lavender JP, Pepys MB. Diagnostic radionuclide imaging of amyloid: biological targeting by circulating human serum amyloid P component. Lancet. 1988;1:1413-1418. [Medline] [Order article via Infotrieve]
  9. Hawkins PN, Lavender JP, Pepys MB. Evaluation of systemic amyloidosis by scintigraphy with 123I-labeled serum amyloid P component. N Engl J Med. 1990;323:508-513. [Abstract]
  10. Talmud P, Tybjaerg-Hansen A, Bhatnagar D, Mbewu A, Miller JP, Durrington P, Humphries S. Rapid screening for specific mutations in patients with a clinical diagnosis of familial hypercholesterolaemia. Atherosclerosis. 1991;89:137-141. [Medline] [Order article via Infotrieve]
  11. Casanova J-L, Pannetier C, Jaulin C, Kourilsky P. Optimal conditions for directly sequencing double-stranded PCR products with Sequenase. Nucleic Acids Res. 1990;18:4028. [Free Full Text]
  12. Hawkins PN, Wootton R, Pepys MB. Metabolic studies of radioiodinated serum amyloid P component in normal subjects and patients with systemic amyloidosis. J Clin Invest. 1990;86:1862-1869.
  13. Tsuzuki T, Mita S, Maeda S, Araki S, Shimada K. Structure of the human prealbumin gene. J Biol Chem. 1985;260:12224-12227. [Abstract/Free Full Text]
  14. Terry CJ, Damas AM, Oliveira P, Saraiva MJM, Alves IL, Costa PP, Matias PM, Sakaki Y, Blake CCF. Structure of Met30 variant of transthyretin and its amyloidogenic implications. EMBO J. 1993;12:735-741. [Medline] [Order article via Infotrieve]
  15. Serpell LC, Blake CCF. Frequency analysis and structural correlation of FAP mutations in transthyretin. In: Kisilevsky R, Benson MD, Frangione B, Gauldie J, Muckle TJ, Young ID, eds. Amyloid and Amyloidosis 1993. Pearl River, NY: Parthenon Publishing; 1994:447-449.
  16. Duan W, Achen MG, Richardson SJ, Lawrence MC, Wettenhall REH, Jaworowski A, Schreiber G. Isolation, characterization, cDNA cloning and gene expression of an avian transthyretin: implications for the evolution of structure and function of transthyretin in vertebrates. Eur J Biochem. 1991;200:679-687. [Medline] [Order article via Infotrieve]
  17. Hesse A, Altland K, Linke RP, Almeida MR, Saraiva MJM, Steinmertz A, Maisch B. Cardiac amyloidosis: a review and report of a new transthyretin (prealbumin) variant. Br Heart J. 1993;70:111-115. [Abstract/Free Full Text]
  18. Jacobson DR. A specific test for transthyretin 122 (Val->Ile), based on PCR-primer-introduced restriction analysis (PCR-PIRA): confirmation of the gene frequency in blacks. Am J Hum Genet. 1992;50:195-198. [Medline] [Order article via Infotrieve]
  19. Booth DR, Soutar AK, Hawkins PN, Reilly M, Harding A, Pepys MB. Three new amyloidogenic transthyretin gene mutations: advantages of direct sequencing. In: Kisilevsky R, Benson MD, Frangione B, Gauldie J, Muckle TJ, Young ID, eds. Amyloid and Amyloidosis 1993. Pearl River, NY: Parthenon Publishing; 1994:456-458.
  20. Holmgren G, Steen L, Ekstedt J, Groth C-G, Ericzon B-G, Eriksson S, et al. Biochemical effect of liver transplantation in two Swedish patients with familial amyloidotic polyneuropathy (FAP-met30). Clin Genet. 1991;40:242-246. [Medline] [Order article via Infotrieve]
  21. Holmgren G, Ericzon B-G, Groth C-G, Steen L, Suhr O, Andersen O, et al. Clinical benefit and regression of amyloidosis following liver transplantation in patients with familial amyloid polyneuropathy due to transthyretin variant Met-30. Lancet. 1993;341:1113-1116. [Medline] [Order article via Infotrieve]
  22. Hawkins PN, Richardson S, MacSweeney JE, King AD, Vigushin DM, Lavender JP, Pepys MB. Scintigraphic quantification and serial monitoring of human visceral amyloid deposits provide evidence for turnover and regression. Q J Med. 1993;86:365-374. [Abstract/Free Full Text]
  23. Hawkins PN, Richardson S, Vigushin DM, David J, Kelsey CR, Gray RES, et al. Serum amyloid P component scintigraphy and turnover studies for diagnosis and quantitative monitoring of AA amyloidosis in juvenile rheumatoid arthritis. Arthritis Rheum. 1993;36:842-851.[Medline] [Order article via Infotrieve]



This article has been cited by other articles:


Home page
Br. J. Ophthalmol.Home page
Answers
Br. J. Ophthalmol., January 1, 2008; 92(1): 142 - 142.
[Full Text] [PDF]


Home page
Mol. Pathol.Home page
S Bonin, F Petrera, B Niccolini, and G Stanta
PCR analysis in archival postmortem tissues
Mol. Pathol., June 1, 2003; 56(3): 184 - 186.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
H. J. Lachmann, D. R. Booth, S. E. Booth, A. Bybee, J. A. Gilbertson, J. D. Gillmore, M. B. Pepys, and P. N. Hawkins
Misdiagnosis of Hereditary Amyloidosis as AL (Primary) Amyloidosis
N. Engl. J. Med., June 6, 2002; 346(23): 1786 - 1791.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
E. Hund, R. P. Linke, F. Willig, and A. Grau
Transthyretin-associated neuropathic amyloidosis: Pathogenesis and treatment
Neurology, February 27, 2001; 56(4): 431 - 435.
[Abstract] [Full Text] [PDF]


Home page
QJMHome page
J.D. Gillmore, D.R. Booth, M. Rela, N.D. Heaton, V. Rahman, A.J. Stangou, M.B. Pepys, and P.N. Hawkins
Curative hepatorenal transplantation in systemic amyloidosis caused by the Glu526Val fibrinogen {alpha}-chain variant in an English family
QJM, May 1, 2000; 93(5): 269 - 275.
[Abstract] [Full Text] [PDF]


Home page
BrainHome page
M. Brett, M. R. Persey, M. M. Reilly, T. Revesz, D. R. Booth, S. E. Booth, P. N. Hawkins, M. B. Pepys, and J. A. Morgan-Hughes
Transthyretin Leu12Pro is associated with systemic, neuropathic and leptomeningeal amyloidosis
Brain, February 1, 1999; 122(2): 183 - 190.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
T. Akasaka, K. Yoshida, A. Yamamuro, T. Hozumi, T. Takagi, S. Morioka, and J. Yoshikawa
Phasic Coronary Flow Characteristics in Patients With Constrictive Pericarditis : Comparison With Restrictive Cardiomyopathy
Circulation, September 16, 1997; 96(6): 1874 - 1881.
[Abstract] [Full Text]


Home page
NEJMHome page
S. S. Kushwaha, J. T. Fallon, and V. Fuster
Restrictive Cardiomyopathy
N. Engl. J. Med., January 23, 1997; 336(4): 267 - 276.
[Full Text] [PDF]


Home page
CirculationHome page
R. A. Kyle
Amyloidosis
Circulation, February 15, 1995; 91(4): 1269 - 1271.
[Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Booth, D. R.
Right arrow Articles by Frustaci, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Booth, D. R.
Right arrow Articles by Frustaci, A.