(Circulation. 1995;92:457-464.)
© 1995 American Heart Association, Inc.
Articles |
From Harvard Medical School (M.E.R., L.R.W., M.J.K.); Harvard School of Public Health (A.F.W., M.E.R.); Cardiac Unit (J.B.N.), Massachusetts General Hospital; and the Cardiovascular Division (M.E.R.), Brigham and Women's Hospital, Boston, Mass.
Correspondence to Mary E. Russell, MD, Harvard School of Public Health, Cardiovascular Biology Laboratory, 677 Huntington Ave, Boston, MA 02115.
| Abstract |
|---|
|
|
|---|
Methods and Results We studied iNOS mRNA and protein expression patterns in a series of Lewis-F344 cardiac allografts with early and late chronic rejection and after modulation of the inflammatory response (in an effort to attenuate arteriosclerosis). Relative gene transcript levels were measured with a 32P-dCTP reverse-transcriptase polymerase chain reaction assay designed to amplify iNOS mRNA. The distribution of the iNOS gene product was examined by immunocytochemistry with a polyclonal antibody against iNOS. NOS transcript levels increased significantly in cardiac allografts (days 7, 14, 28, and 75) compared with paired host hearts (exposed to the same circulation) and syngrafts (P<.003). Immunostaining localized the iNOS antigen within subpopulations of mononuclear inflammatory cells in cardiac allograftspresumably, activated macrophages. The number of iNOS-positive mononuclear cells was 25-fold higher in cardiac allografts compared with paired host hearts and syngrafts (P<.009). In cardiac allografts of 75 days or older, there also was striking iNOS staining within some medial and intimal smooth muscle cells in various vessels. Modulation of the inflammatory response (with a diet deficient in essential fatty acids) produced significant decreases in the intimal thickening score and in the percentage of diseased vessels in 28-day cardiac allografts compared with allografts from rats fed a control diet. There was a correlate decrease in iNOS transcript levels and in the number of iNOS-positive mononuclear cells in the 28-day cardiac allografts from rats fed the essential fatty acid-deficient diet.
Conclusions The early and persistent upregulation of iNOS in chronic cardiac rejection and the coincident reduction in arteriosclerosis and downregulation of iNOS suggest that this inducible regulator may contribute to the inflammatory response mediating transplant arteriosclerosis.
Key Words: arteriosclerosis macrophages rejection transplantation
| Introduction |
|---|
|
|
|---|
An accelerated form of arteriosclerosis composed of
intimal smooth muscle cells, macrophages, and some lymphocytes
develops in the majority of cardiac transplant recipients and limits
long-term graft survival.17 Considerable insight into this
cellular evolution has been provided by the Lewis-F344 heterotopic rat
cardiac transplantation model of chronic rejection, which produces
arteriosclerotic lesions in
stages.18 19 20 Early vascular changes
involve thickening of
the neointima with macrophages and occasional
lymphocytes. Later (75 to 120 days), there is accumulation of smooth
muscle cells in the neointima with fewer inflammatory
cells.18 20 It has been our working hypothesis that a
cell-mediated inflammatory response involving activated
macrophages mediates intimal thickening. This mediation might
occur by local induction of a number of known and unknown effector
pathways that culminate in growth factor-initiated smooth muscle cell
proliferation and migration. However, the precise mechanisms have yet
to be clarified. Recent reports documenting increased expression of the
platelet-derived growth factor (PDGF) receptor in the vasculature
of Lewis-F344 cardiac allografts, as well as our findings that
expression of monocyte chemoattractant protein-1 and interferon-
(IFN-
) had increased, provide support for the
hypothesis.21 22 23
The cytokine-rich environment of the Lewis-F344 model of chronic cardiac allograft rejection provides an opportunity to study the iNOS activation pathway during various stages of chronic rejection and transplant arteriosclerosis. We describe the tissue expression and cellular distribution of iNOS in this model. We also studied time-dependent iNOS mRNA and protein expression patterns and how they are affected by modulation of the inflammatory response.
| Methods |
|---|
|
|
|---|
Measurement of Gene Transcript Levels
Relative gene
transcript levels were measured with RT-PCR assays
as described.22 23 24 These assays are
sensitive, require
only 2.5 µg of total RNA, and permit replicates to be performed from
a single cDNA strand. In brief, total cellular RNA was extracted from
ventricular samples with RNAzol B and checked for quality
on denaturing agarose gels. Samples were deemed to be of high quality
when the amount of RNA in the 28S ribosomal band was twice that in the
18S ribosomal band. Only samples that yielded high-quality total RNA
were used for cDNA synthesis (2.5 µg of total RNA per reaction).
Primers for iNOS were designed using the MAC VECTOR
sequence analysis program (International Biotechnologies) from
the 5' portion of the cDNA (bp, 30 to 477).
Glyceraldehyde-3-phosphate dehydrogenase (G3PDH)
primers were used as controls. Sequence analysis confirmed
amplification of the predicted iNOS and G3PDH fragments. Primer
sequences, annealing temperatures, and number of cycles were as
follows: for iNOS, 5' TGCCAGGGTCACAACTTTACAGG and 3'
GGTCGATGTCACATGCAGCTTGTC (References 2 and 25) (60°C, 30 cycles); and
for G3PDH, 5' TGA AGG TCG GTG TCA ACG GAT TTG GC and 3' CAT GTA
GGC CAT
GAG GTC CAC CAC (Reference 23) (58°C, 22 cycles).
The RT-PCR assay was performed with the Gene Amp 9600 system by using the hot-start technique. The logarithmic ranges of PCR amplification were established as a function of cycle number and cDNA dilution for each primer pair. 32P-dCTP was added to allow measurement of incorporated radioactivity in amplified PCR product bands from dried agarose gels on a PhosphorImager (Molecular Dynamics). Corrected levels were derived by determining the ratio of 32P incorporated in the amplified iNOS product band to the mean of that incorporated in the amplified G3PDH band (derived from quadruplicate measurements) for the corresponding cDNA as described.24 To identify relative differences. we derived corrected transcript levels from sets of cDNA (studied simultaneously) that included negative controls (for which RT had been omitted during cDNA synthesis or water used instead of cDNA). Each PCR analysis was completed in quadruplicate. In the temporal study, the experimental set of cDNAs was derived from 12 transplant pairs (allograft and host hearts) harvested at various time points (days 3 [n=1], 7 [n=3], 14 [n=2], 28 [n=3], and 75 [n=3]), as well as hearts from a Lewis syngeneic pair (n=1) and a day-0 heart (harvested but not transplanted) (n=1). The mean value for the corrected levels was obtained by pooling measurements from all animals in a subgroup.
Statistical Analysis
Results from experimental sets were
subjected to MANOVA without
replication. If they were significant, individual comparisons were
made, and the level of significance was corrected with the Bonferroni
method. With MANOVA, all data are pooled to estimate standard errors.
This approach was selected because it is considered statistically sound
in the setting of small samples.26
Immunocytochemical Studies
To identify the iNOS gene product
and study its
distribution, we performed immunohistochemical staining with 4-µm
sections. Paraffin blocks from cardiac allografts and host hearts
completed in the present study (days 7, 28, and 75) as well as
those from previous studies (day 120) were analyzed. Syngrafts
were analyzed at days 28 and 120.20 For the diet
study, allograft and host hearts harvested at days 7 and 28 from rats
fed each diet were analyzed, and 120-day samples from a
previous study were included.27 Duplicate sections were
stained from two animals in each of the subgroups studied. The
polyclonal rabbit anti-iNOS sera was prepared by Jeffrey R. Weidner and
Richard A. Mumford (Merck Sharp & Dhome Laboratories) and kindly
provided to us by Dr Carl Nathan. It was produced through immunization
with a synthetic peptide sequence corresponding to the C-terminus
(residues 1 through 20) of the long isoform of murine
macrophage iNOS.2 Previous characterization of the
sera has shown that staining can be blocked by synthetic peptides
corresponding to the peptide that was used as immunogen (C. Nathan,
personal communication).
We performed immunostaining as described with
antisera
against iNOS (in dilutions of 1:1000 or 1:2000) and a secondary,
biotinylated, goat anti-rabbit antibody.20 22
IFN-
-stimulated rat macrophages with documented elevations
in nitrate production (measured by the Greiss reaction) were
used as positive control cells. Negative controls included (1) omission
of the primary antibody, (2) use of an alternative primary antibody,
and (3) staining of phosphate-buffered saline-stimulated rat
macrophages. To localize the cell types expressing iNOS, we
also performed double-immunostaining experiments with
antibodies directed against von Willebrand factor, to identify
endothelial cells; smooth muscle cell actin, to
identify smooth muscle cells; and ED-1, to identify
monocytes/macrophages, as described.20 22
Avidin-biotin was used to identify the first antibody (anti-iNOS),
followed by alkaline phosphatase to identify the second antibody.
Dietary Modulation of the Inflammatory Response
We studied
iNOS expression patterns in early cardiac allografts
(days 7 and 28) from rats fed an essential fatty acid-deficient (EFAD)
diet, which modulates the inflammatory response in the Lewis-F344
chronic rejection model. We had shown previously that the EFAD diet
protected against the development of
arteriosclerosis in 120-day cardiac allografts, but
we had not studied earlier time points.27 In brief, F344
weanlings were maintained on an EFAD or a control diet for 8 weeks
before transplantation. (Although the rats appeared healthy, there was
some retardation of growth in those fed the EFAD diet.) Four
transplantations were performed at each time point in each of the diet
subgroups. We harvested the allografted and host hearts at 7 days (when
infiltration just begins and the vascular abnormality is confined to
adhesion of mononuclear cells to the vessel lumen) and at 28 days (when
intimal thickening and interstitial infiltration typically
are first evident). Functional evaluation of the hearts was completed
by palpation as previously described.18 Vessel morphometry
was assessed by scoring Verhoeff's elastin-stained sections as
described.18 The degree of arterial intimal
thickening was graded on a scale of 0 (normal) to 5 (circumferential
thickening affecting more than 80% of the lumen), and the percentage
of diseased arteries was tabulated. For studies involving transcript
measurements, the experimental set included cDNA only from the subgroup
of transplants (at each time point) that yielded high-quality total
RNA. Thus, although four transplantations were performed and graded at
each time point, only two transplant-paired samples (allograft and host
heart) from each subgroup were analyzed with RT-PCR, with the
exception of the 28-day EFAD diet subgroup, which included three
transplant-paired samples.
| Results |
|---|
|
|
|---|
|
To normalize for variations in RNA loading among cDNAs, we
derived
corrected transcript levels by taking the ratio of iNOS to G3PDH of the
32P incorporated into the bands for each cDNA. The bar
graph in Fig 1
(bottom) shows the corrected iNOS transcript
levels for
the entire series of transplants studied. In cardiac allografts,
corrected iNOS transcript levels increased significantly by day 7 (but
not at day 3) and were sustained through day 75 in comparison with
paired host hearts, day-0 hearts, and day-14 Lewis-Lewis syngrafts
(P<.003). The early and sustained increase in iNOS
transcripts in this subgroup of 11 transplants is consistent
with chronic alloimmune stimulation.
iNOS Gene Product in Cardiac Allografts
Having identified an
increase in gene transcript levels for iNOS,
we then immunostained samples from early and late cardiac
allografts, paired host hearts, and syngrafts to identify the gene
product and localize the cell expressing it. At all time points
studied (7, 28, 75, and 120 days), iNOS staining localized
predominantly to mononuclear inflammatory cells within the
interstitial and perivascular spaces of cardiac allografts.
There were few positive cells in host hearts and syngrafts. In scoring
the number of iNOS-positive mononuclear cells per section, we found
significant increases in 28-day allografts (mean, 681±59) compared
with paired host hearts (26±9) or 14-day syngrafts (9±2)
(P<.009). At the later time points, similar trends were
identified with a large increase in iNOS-positive mononuclear cells in
120-day cardiac allografts (340±25) compared with 120-day syngrafts
(10±5) (P=.006). The decrease in iNOS-positive cells
between day 28 and day 120 followed the decline in mononuclear cell
infiltration typical of older grafts.20
Double-staining
studies confirmed that some of the mononuclear cells
expressing iNOS were macrophages (Fig 2A
), in
that they also stained positive for the rat monocyte/macrophage
marker ED-1. However, there were many large ED-1-negative but
iNOS-positive mononuclear cells (Fig 2B
), raising the
possibility that
they represent another inflammatory cell type (lymphocyte
subset) or a distinct macrophage population in which ED-1
expression is downregulated or lost in concert with induction of iNOS
expression. We have also found in propagated bone marrow
macrophages immunostained after stimulation with
IFN-
(for 24 hours) that a subset of cells were ED-1-negative but
iNOS-positive (data not shown). At the same time, most of the control
(unstimulated) bone marrow macrophages were ED-1-positive and
iNOS-negative. Apparently, ED-1 expression can be downregulated by
factors that induce iNOS expression.
|
In 75- and 120-day cardiac
allografts, there was prominent staining in
a spectrum of vessels in addition to the mononuclear staining.
Interestingly, only a subset of the vessels stained positive and did so
in only a portion of media or in a subset of the neointimal
cells. The vascular cell type expressing iNOS antigen was shown to be
smooth muscle by a series of double-staining studies. Double staining
for von Willebrand factor identified
endothelial cells and showed that most of the
iNOS-positive cells were located deep in the vessel within the medial
and, occasionally, neointimal layers (Fig 2C
). Double
staining for smooth muscle cell actin and iNOS (Fig 2D
) showed
that
most of the iNOS-positive cells in the vessels were also smooth muscle
cell actin-positive. These cells were located primarily in the media
and occasionally in the expanding neointima. In very small
vessels, such as the arterioles, it was harder to distinguish whether
the iNOS-positive cells were of smooth muscle or
endothelial origin. Staining of occasional arterioles
was present in all hearts (allografts, host, and syngrafts).
Effects of EFAD Diet on Cardiac Allografts
To determine
whether the protective effects of the EFAD diet might
be mediated through the iNOS pathway, we compared iNOS expression
patterns, heart function (palpable beat), and
arteriosclerotic characteristics (intimal
thickening and number of diseased vessels) in cardiac allografts
harvested early from rats fed the EFAD diet with those in allografts
from rats fed a control diet. As seen in Fig 3
, at day 7
there was no significant difference between the EFAD and control diet
groups with respect to heart beat, intimal thickening grade, and
percentage of diseased vessels. In contrast, at day 28 there was
preservation of allograft function (Fig 3A
), as evidenced by a
heartbeat score of 4 in allografts from rats fed the EFAD diet versus a
score of 2 in those from rats fed the control diet (P<.001,
four per subgroup). A significant difference was also seen in the mean
intimal thickening score (Fig 3B
) in allografts from rats fed
the EFAD
diet (0.30±0) versus those from rats fed the control diet
(0.79±0.1,
P=.001, four per diet subgroup). The grades for intimal
thickening ranged from 0 (normal) to 5 (compromise of more than 80%).
A score of 1 was assigned when intimal thickening was visible in as
much as 50% of the vessel perimeter and there was less than 20%
luminal compromise.18 At the day-28 time point, there also
was a significant difference in the percentage of diseased vessels in
allografts from rats fed the EFAD diet (28% versus 53% for control
diet, P=.008) (Fig 3C
). These findings
demonstrate that the
EFAD diet had a significant
antiarteriosclerotic effect even in the early
stage (day 28) of chronic rejection, when the degree of
arteriosclerotic development is small.
|
Fig 4
shows an
analysis of iNOS transcript
levels in a subset of allograft cDNAs from rats fed one of the two
diets. In Fig 4A
, iNOS transcript levels were similar for the
two
groups at day 7 (two per diet subgroup). However, at day 28 there was a
significant difference in iNOS cardiac allograft transcript levels
between rats fed the EFAD diet (n=2) and those fed the control diet
(n=3; P<.0001). iNOS transcript levels were higher in
cardiac allografts compared with host hearts at both time points and on
both diets (P<.0001).
|
Fig 4B
shows the
number of iNOS-positive mononuclear cells in heart
sections from the 7- and 28-day time points. Again, no significant
differences were detected at day 7 between the two diet groups (EFAD,
82±60; control, 88±10; two per diet subgroup). The lack of a
significant difference in cell count between the two diet groups at
this point may reflect the low level of cell infiltration and absence
of intimal thickening typical of this stage. In contrast, at day 28
there was a significant difference in iNOS-positive mononuclear cell
counts in sections from allografts from rats fed the EFAD diet
(339±10) versus rats fed the control diet (689±92;
P=.0001, two per diet subgroup).
Immunostaining in these older allografts (from the EFAD
and control diet groups) was also prominent within the media of some
vessels (data not shown), although there was no significant difference
in staining between the two diets. Thus, it appears that although the
EFAD diet decreased the number of iNOS-positive macrophages
infiltrating the heart, it did not have a significant effect on
vascular iNOS expression.
| Discussion |
|---|
|
|
|---|
Yang et al28 demonstrated that iNOS mRNA and protein increase at day 5 in acutely rejecting cardiac allografts. In their immunohistochemical analysis, iNOS staining was identified in the inflammatory infiltrate, in some microvascular endothelial cells, and at the periphery of myocytes. Our findings in chronically rejecting cardiac allografts disagree with those of the group of Yang et al in that we observed limited staining in microvascular endothelial cells and myocytes but striking staining in vascular smooth muscle cells. Possible explanations for the discordant observations include differences inherent in the acute and chronic rejection models, which would affect the cell types activated or the time course of activation. Alternatively, the antisera used in the two studies (which were generated from different peptide sequences) may selectively identify different isoforms. Between the two studies, there was concordance in the localization of iNOS staining to inflammatory cell types. The presence of iNOS-positive inflammatory cells in both acutely and chronically rejecting rat hearts implies that a subset of the infiltrating mononuclear cells has acquired an activation phenotype that parallels the phenotype in other inflammatory conditions.6 7 29 30 31 This correlation is important because data are limited regarding the characterization or phenotypes of macrophages involved in chronic rejection, a process in which an inflammatory response has been proposed to contribute to or even mediate the intimal changes.22 23 32 Clarification of the effector pathways present in chronically rejecting tissues could provide insight into the pathogenesis of transplant arteriosclerosis and how it might be ameliorated.
Given that the high-output nitric oxide pathway regulated by iNOS bestows many acquired functions to macrophages (killing of bacteria, viruses, parasites, and tumor cells), we have used iNOS expression as a measure of activation.4 5 With rats fed an EFAD diet, we have shown decreases in iNOS mRNA levels and iNOS-positive mononuclear cells in 28-day cardiac allografts coincident with preservation of heartbeat and reduction in arteriosclerotic changes. The basic mechanism underlying the anti-inflammatory effect of the EFAD diet involves defects in arachidonate metabolism that in turn alter leukotriene production, particularly that of the chemoattractant leukotriene B4, and affect various macrophage functions (trafficking, spreading, and adherence).33 34 35 The decrease in iNOS expression in cardiac allografts from rats fed the EFAD diet could be explained by a reduction in trafficking of inflammatory cells to the graft, or the diet may interfere with the actual activation of macrophages by cytokines. Regardless of the mechanism, the corresponding reduction in activated macrophages and intimal thickening in cardiac allografts from rats fed the EFAD diet provides support for the hypothesis that arteriosclerotic changes following transplantation are mediated by an inflammatory response involving cellular activation. The precise role of iNOS as an inflammatory mediator in noninfectious inflammation conditions, including chronic rejection, has yet to be elucidated. From recent in vitro studies, one can conceive of direct effects through nitric oxide produced by the inflamed tissue or indirect effects in which nitric oxide acts as an intermediary (in association with nitrosylation, ADP ribosylation, or free radical formation) in the production of other mediators that regulate cytotoxicity, chemotaxis, and proliferation.1
In the later stages of chronic cardiac rejection (75 and 120 days), we found a striking increase in iNOS staining within a spectrum of allograft vessels (ranging from the epicardial to the arteriole) not seen at earlier time points. Although endothelial staining for NOS has been reported in some vessels, there are few reports documenting vascular smooth muscle cell iNOS immunopositivity.8 36 37 The present study provides direct evidence that smooth muscle cell NOS can be induced in vivo under conditions of inflammatory stimulation. Unexplained is the focal nature of the smooth muscle cell staining, which does not appear to correlate with specific locations within the heart, regional inflammation, degree of intimal thickening, or type of diet. One potential explanation is that the smooth muscle cell population may react in a heterogeneous or focal manner similar to that seen in transplanted hearts with inflammatory infiltrates, which are patchy.20 The inductive stimuli may be transient or cyclic and may reflect local variations in the vessel wall related to hemodynamic or inflammatory influences that vary cytokine production.
The upregulation of smooth muscle cell iNOS in a subset of arteries in our model of transplant arteriosclerosis is intriguing and raises the question of whether it suppresses or promotes intimal thickening. In the context of the vessel, nitric oxide is considered an antiatherogenic molecule on the basis of rat and rabbit studies with L-arginine (used to enhance nitric oxide production) that show reduced arteriosclerotic or neointimal thickening in injured vessels.38 39 This view is corroborated by recent studies with NOS antagonists (used to decrease nitric oxide production) that have shown increases in neointimal formation.14 15 However, in these reports, the regulatory role of specific NOS isoforms was not studied. It may be that the endothelial, macrophage, and smooth muscle cell isoforms are regulated independently and have distinct end effects. One can speculate also that in the transplanted heart (where the allogeneic stimulus is chronic), the antiarteriosclerotic effects of nitric oxide in the vessel may be outweighed by proarteriosclerotic forces in the allografted organ, such as PDGF-ß-driven smooth muscle cell migration. The late appearance of iNOS in allograft vessels may be a compensatory measure to inhibit further vascular remodeling when the vessel reaches a quiescent state. Of course, regulation of nitric oxide and the various NOS isoforms may be quite different in these animal models of arteriosclerosis given the specific vessel types, modes of injury or underlying stimuli (allogeneic versus hypercholesterolemic), and strains under investigation.
The identification of subpopulations of mononuclear and smooth muscle cells expressing an inducible factor implies that they have acquired an "activated" phenotype in response to allogeneic stimulation after transplantation. Further studies in which the iNOS pathway is disrupted at specific points will be required to determine the roles of the various iNOS isoforms in mediating the inflammatory response of the vessel wall and the neointimal thickening associated with chronic cardiac rejection.
| Note Added in Proof |
|---|
|
|
|---|
| Acknowledgments |
|---|
Received December 19, 1994; accepted January 17, 1995.
| References |
|---|
|
|
|---|
2.
Xie QW, Cho HJ, Calaycay J, Mumford RA, Swiderek KM,
Lee TD, Ding A, Troso T, Nathan C. Cloning and characterization
of inducible nitric oxide synthase from mouse
macrophages. Science. 1992;256:225-228.
3.
Moncada S, Higgs A. The L-arginine-nitric oxide
pathway. N Engl J Med. 1993;329:2002-2012.
4. Nussler AK, Billiar TR. Inflammation, immunoregulation, and inducible nitric oxide synthase. J Leukoc Biol. 1993;54:171-178. [Abstract]
5.
Lorsbach RB, Murphy WJ, Lowenstein CJ, Snyder SH,
Russell SW. Expression of the nitric oxide synthase gene in
mouse macrophages activated for tumor cell killing:
molecular basis for the synergy between interferon-gamma and
lipopolysaccharide. J Biol
Chem. 1993;268:1908-1913.
6.
McCartney FN, Allen JB, Mizel DE, Albina JE, Xie QW,
Nathan CF, Wahl SM. Suppression of arthritis by an
inhibitor of nitric oxide synthase. J
Exp Med. 1993;178:749-754.
7.
Weinberg JB, Granger DL, Pisetsky DS, Seldin MF,
Misukonis MA, Mason SN, Pippen AM, Ruiz P, Wood ER, Gilkeson GS.
The role of nitric oxide in the pathogenesis of spontaneous
murine autoimmune disease: increased nitric oxide production
and nitric oxide synthase expression in MRL-lpr/lpr mice, and reduction
of spontaneous glomerulonephritis and arthritis by orally administered
NG-monomethyl-L-arginine. J Exp
Med. 1994;179:651-660.
8. Forstermann U, Closs EI, Pollock JS, Nakane M, Schwarz P, Gath I, Kleinert H. Nitric oxide synthase isozymes: characterization, purification, molecular cloning, and functions. Hypertension. 1994;1121-1131.
9. Lamas S, Michel T, Collins T, Brenner BM, Marsden PA. Effects of interferon-gamma on nitric oxide synthase activity and endothelin-1 production by vascular endothelial cells. J Clin Invest. 1992;90:879-887.
10. Sirsjo A, Soderkvist P, Sundqvist T, Carlsson M, Ost M, Gidlof A. Different induction mechanisms of mRNA for inducible nitric oxide synthase in rat smooth muscle cells in culture and in aortic strips. FEBS Lett. 1994;338:191-196. [Medline] [Order article via Infotrieve]
11.
Lefer AM, Ma X-L. Decreased basal nitric oxide
release in hypercholesterolemia increases
neutrophil adherence to rabbit coronary artery
endothelium. Arterioscler
Thromb. 1993;13:771-776.
12. Wang B-Y, Singer AH, Tsao PS, Drexler H, Kosek J, Cooke JP. Dietary arginine prevents atherogenesis in the coronary artery of the hypercholesterolemic rabbit. J Am Coll Cardiol. 1994;23:452-458. [Abstract]
13.
Tsao PS, McEvoy LM, Drexler H, Butcher EC, Cooke JP.
Enhanced endothelial adhesiveness in
hypercholesterolemia is attenuated by
L-arginine. Circulation. 1994;89:2176-2182.
14.
Naruse K, Shimizu K, Muramatsu M, Toki Y, Miyazaki Y,
Okumura K, Hashimoto H, Ito T. Long-term inhibition of nitric
oxide synthesis promotes atherosclerosis in the
hypercholesterolemic rabbit thoracic aorta.
Arterioscler Thromb. 1994;14:746-752.
15.
Cayette AJ, Palacino JJ, Horton K, Cohen RA.
Chronic inhibition of nitric oxide production
accelerates neointima formation and impairs
endothelial function in
hypercholesterolemic rabbits.
Arterioscler Thromb. 1994;14:753-759.
16.
Drexler H, Fischell TA, Pinto FJ, Chenzbraun A, Botas
J, Cooke JP, Alderman EL. Effect of L-arginine on
coronary endothelial function in cardiac
transplant recipients: relation to vessel wall morphology.
Circulation. 1994;89:1615-1623.
17. Schoen FJ, Libby P. Cardiac transplant graft arteriosclerosis. Trends Cardiovasc Med. 1991;1:216-223.
18. Adams DH, Tilney NL, Collins JJ, Karnovsky MJ. Experimental graft arteriosclerosis, I: the Lewis-to-F-344 allograft model. Transplantation. 1992;53:1115-1119. [Medline] [Order article via Infotrieve]
19. Cramer DV, Wu GD, Chapman FA, Cajulis E, Wang HK, Makowka L. Lymphocytic subsets and histopathologic changes associated with the development of heart transplant arteriosclerosis. J Heart Lung Transplant. 1992;458-466.
20. Adams DH, Wyner LR, Karnovsky MJ. Experimental graft arteriosclerosis, II: immunocytochemical analysis of lesion development. Transplantation. 1993;56:794-799. [Medline] [Order article via Infotrieve]
21. Higgy NA, Davidoff AW, Grothman GT, Hollenberg MD, Benediktsson H, Paul LC. Expression of platelet-derived growth factor receptor in rat heart allografts. J Heart Lung Transplant. 1991;10:1012-1022. [Medline] [Order article via Infotrieve]
22.
Russell ME, Adams DH, Wyner LR, Yamashita Y, Halnon NJ,
Karnovsky MJ. Early and persistent induction of monocyte
chemoattractant protein 1 in rat cardiac allografts. Proc
Natl Acad Sci U S A. 1993;90:6086-6090.
23. Russell ME, Wallace AF, Hancock WW, Sayegh MH, Adams DH, Sibinga NES, Wyner LR, Karnovsky MJ. Upregulation of cytokines associated with macrophage activation in the Lewis to F344 rat chronic cardiac rejection model. Transplantation. 1995;59:572-578. [Medline] [Order article via Infotrieve]
24. Russell ME, Utans U, Wallace AF, Liang P, Arceci RJ, Karnovsky MJ, Wyner LR, Yamashita Y, Tarn C. Identification and upregulation of galactose/N-acetylgalactosamine macrophage lectin in rat cardiac allografts with arteriosclerosis. J Clin Invest. 1994;94:722-730.
25. Nunokawa Y, Ishida N, Tanaka S. Cloning of inducible nitric oxide synthase in rat vascular smooth muscle cells. Biochem Biophys Res Commun. 1993;191:89-94. [Medline] [Order article via Infotrieve]
26. Snedecor GW, Cochran WG. Statistical Methods, 6th ed. Ames, Iowa: Iowa State University Press; 1967:339-380.
27. Adams DH, Wyner LR, Steinbeck MJ, Karnovsky MJ. Inhibition of graft arteriosclerosis by modulation of the inflammatory response. Transplant Proc. 1993;25:2092-2094. [Medline] [Order article via Infotrieve]
28. Yang X, Chowdhury N, Cai B, Brett J, Marboe C, Sciacca RR, Michler RE, Cannon PJ. Induction of myocardial nitric oxide synthase by cardiac allograft rejection. J Clin Invest. 1994;94:714-721.
29. Langrehr JM, Murase N, Markus PM, Cai X, Neuhaus P, Schraut W, Simmons RL, Hoffman RA. Nitric oxide production in host-versus-graft and graft-versus-host reactions in the rat. J Clin Invest. 1992;90:679-683.
30.
Lancaster JJ, Langrehr JM, Bergonia HA, Murase N,
Simmons RL, Hoffman RA. EPR detection of heme and nonheme
iron-containing protein nitrosylation by nitric oxide during rejection
of rat heart allograft. J Biol Chem. 1992;267:10994-10998.
31.
Koprowski H, Zheng YM, Heber KE, Fraser N, Rorke L, Fu
ZF, Hanlon C, Dietzschold B. In vivo expression of inducible
nitric oxide synthase in experimentally induced neurologic
diseases. Proc Natl Acad Sci U S A. 1993;90:3024-3027.
32. Paul LC, Grothman GT, Benediktsson H, Davidoff A, Rozing J. Macrophage subpopulations in normal and transplanted heart and kidney tissues in the rat. Transplantation. 1992;53:157-162. [Medline] [Order article via Infotrieve]
33.
Lefkowith JB, Jakschik BA, Stahl P, Needleman P.
Metabolic and functional alterations in
macrophages induced by essential fatty acid deficiency.
J Biol Chem. 1987;262:6668-6675.
34. Rovin BH, Lefkowith JB, Schreiner GF. Mechanisms underlying the anti-inflammatory effects of essential fatty acid deficiency in experimental glomerulonephritis: inhibited release of a monocyte chemoattractant by glomeruli. J Immunol. 1990;145:1238-1245. [Abstract]
35.
Lefkowith JB, Rogers M, Lennartz MR, Brown EJ.
Essential fatty acid deficiency impairs macrophage
spreading and adherence: role of arachidonate in cell
adhesion. J Biol Chem. 1991;266:1071-1076.
36. Kobzik L, Bredt DS, Lowenstein CJ, Drazen J, Gaston B, Sugarbaker D, Stamler JS. Nitric oxide synthase in human and rat lung: immunocytochemical and histochemical localization. Am J Respir Cell Mol Biol. 1993;9:371-377.
37.
Ursell PC, Mayes M. The majority of nitric oxide
synthase in pig heart is vascular and not neural.
Cardiovasc Res. 1993;27:1920-1924.
38. Cooke JP, Singer AH, Tsao P, Zera P, Rowan RA, Billingham ME. Antiatherogenic effects of L-arginine in the hypercholesterolemic rabbit. J Clin Invest. 1992;90:1168-1172.
39. McNamara DB, Bedi B, Aurora H, Tena L, Ignarro LJ, Kadowitz PJ, Akers DL. L-Arginine inhibits balloon catheter-induced intimal hyperplasia. Biochem Biophys Res Commun. 1993;193:291-296.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
T. Hasegawa, K. Iwanaga, D. E. Hultquist, H. Liao, S. H. Visovatti, and D. J. Pinsky Suppression of nitrosative and oxidative stress to reduce cardiac allograft vasculopathy Am J Physiol Heart Circ Physiol, April 1, 2009; 296(4): H1007 - H1016. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Minamoto and D. J. Pinsky Recipient iNOS but Not eNOS Deficiency Reduces Luminal Narrowing in Tracheal Allografts J. Exp. Med., November 18, 2002; 196(10): 1321 - 1333. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Szabolcs, J. Sun, N. Ma, A. Albala, R. R. Sciacca, G. B. Philips, J. Parkinson, N. Edwards, and P. J. Cannon Effects of Selective Inhibitors of Nitric Oxide Synthase-2 Dimerization on Acute Cardiac Allograft Rejection Circulation, October 29, 2002; 106(18): 2392 - 2396. [Abstract] [Full Text] [PDF] |
||||
![]() |
S Chowdhary, D Harrington, R S Bonser, J H Coote, and J N Townend Chronotropic effects of nitric oxide in the denervated human heart J. Physiol., June 1, 2002; 541(2): 645 - 651. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Takano, R. Yanagisawa, T. Ichinose, K. Sadakane, S. Yoshino, T. Yoshikawa, and M. Morita Diesel Exhaust Particles Enhance Lung Injury Related to Bacterial Endotoxin through Expression of Proinflammatory Cytokines, Chemokines, and Intercellular Adhesion Molecule-1 Am. J. Respir. Crit. Care Med., May 1, 2002; 165(9): 1329 - 1335. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Qian, R. Gelzer-Bell, S.-x. Yang, W. Cao, T. Ohnishi, B. A. Wasowska, R. H. Hruban, E. R. Rodriguez, W. M. Baldwin III, and C. J. Lowenstein Inducible Nitric Oxide Synthase Inhibition of Weibel-Palade Body Release in Cardiac Transplant Rejection Circulation, November 6, 2001; 104(19): 2369 - 2375. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Wildhirt, M. Weis, C. Schulze, N. Conrad, S. Pehlivanli, G. Rieder, G. Enders, W. von Scheidt, and B. Reichart Expression of Endomyocardial Nitric Oxide Synthase and Coronary Endothelial Function in Human Cardiac Allografts Circulation, September 18, 2001; 104 (2009): I-336 - I-343. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Wildhirt, M. Weis, C. Schulze, N. Conrad, S. Pehlivanli, G. Rieder, G. Enders, W. von Scheidt, and B. Reichart Coronary flow reserve and nitric oxide synthases after cardiac transplantation in humans Eur. J. Cardiothorac. Surg., June 1, 2001; 19(6): 840 - 847. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Szabolcs, N. Ma, E. Athan, J. Zhong, M. Ming, R. R. Sciacca, J. Husemann, A. Albala, and P. J. Cannon Acute Cardiac Allograft Rejection in Nitric Oxide Synthase-2-/- and Nitric Oxide Synthase-2+/+ Mice : Effects of Cellular Chimeras on Myocardial Inflammation and Cardiomyocyte Damage and Apoptosis Circulation, May 22, 2001; 103(20): 2514 - 2520. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Fukada, S. Schena, I. Tack, P. Ruiz, Y. Kurimoto, M. Pang, A. Aitouche, T. Abe, L. J. Striker, and S. M. Pham FK409, a Spontaneous Nitric Oxide Releaser, Attenuates Allograft Vasculopathy in a Rat Aortic Transplant Model Circ. Res., July 7, 2000; 87(1): 66 - 72. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. L. Skarsgard, X. Wang, P. McDonald, A. H. Lui, E. K. Lam, B. M. McManus, C. van Breemen, and I. Laher Profound Inhibition of Myogenic Tone in Rat Cardiac Allografts Is Due to eNOS- and iNOS-Based Nitric Oxide and an Intrinsic Defect in Vascular Smooth Muscle Contraction Circulation, March 21, 2000; 101(11): 1303 - 1310. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Yang, N. Ma, M. J. Szabolcs, J. Zhong, E. Athan, R. R. Sciacca, R. E. Michler, G. D. Anderson, J. F. Wiese, K. M. Leahy, et al. Upregulation of COX-2 During Cardiac Allograft Rejection Circulation, February 1, 2000; 101(4): 430 - 438. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M Shah Inducible nitric oxide synthase and cardiovascular disease Cardiovasc Res, January 1, 2000; 45(1): 148 - 155. [Full Text] [PDF] |
||||
![]() |
K.-Y. Chyu, P. Dimayuga, J. Zhu, J. Nilsson, S. Kaul, P. K. Shah, and B. Cercek Decreased Neointimal Thickening After Arterial Wall Injury in Inducible Nitric Oxide Synthase Knockout Mice Circ. Res., December 3, 1999; 85(12): 1192 - 1198. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kibbe, T. Billiar, and E. Tzeng Inducible nitric oxide synthase and vascular injury Cardiovasc Res, August 15, 1999; 43(3): 650 - 657. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Vural, M. C. Oz, H. Liao, H. F. Batirel, and D. J. Pinsky Membrane stabilization in harvested vein graft storage: effects on adhesion molecule expression and nitric oxide synthesis Eur. J. Cardiothorac. Surg., August 1, 1999; 16(2): 150 - 155. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. E. MASON, P. CHANG, C. FALLERY, and M. RABINOVITCH Nitric oxide mediates LC-3-dependent regulation of fibronectin in ductus arteriosus intimal cushion formation FASEB J, August 1, 1999; 13(11): 1423 - 1434. [Abstract] [Full Text] |
||||
![]() |
J. Koglin, D. J. Granville, T. Glysing-Jensen, J. S. Mudgett, C. M. Carthy, B. M. McManus, and M. E. Russell Attenuated Acute Cardiac Rejection in NOS2 -/- Recipients Correlates With Reduced Apoptosis Circulation, February 16, 1999; 99(6): 836 - 842. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Stamm, A. Raisanen-Sokolowski, M. Okano, M. E. Russell, J. R. David, and A. R. Satoskar Mice with STAT6-Targeted Gene Disruption Develop a Th1 Response and Control Cutaneous Leishmaniasis J. Immunol., December 1, 1998; 161(11): 6180 - 6188. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Hale and R. A. Kloner Myocardial temperature reduction attenuates necrosis after prolonged ischemia in rabbits Cardiovasc Res, December 1, 1998; 40(3): 502 - 507. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Koglin, T. Glysing-Jensen, J. S. Mudgett, and M. E. Russell NOS2 Mediates Opposing Effects in Models of Acute and Chronic Cardiac Rejection : Insights from NOS2-Knockout Mice Am. J. Pathol., November 1, 1998; 153(5): 1371 - 1376. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Raisanen-Sokolowski, T. Glysing-Jensen, and M. E. Russell Leukocyte-Suppressing Influences of Interleukin (IL)-10 in Cardiac Allografts : Insights from IL-10 Knockout Mice Am. J. Pathol., November 1, 1998; 153(5): 1491 - 1500. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-B. Peng, M. Spiecker, and J. K. Liao Inducible Nitric Oxide: An Autoregulatory Feedback Inhibitor of Vascular Inflammation J. Immunol., August 15, 1998; 161(4): 1970 - 1976. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ravalli, A. Albala, M. Ming, M. Szabolcs, A. Barbone, R. E. Michler, and P. J. Cannon Inducible Nitric Oxide Synthase Expression in Smooth Muscle Cells and Macrophages of Human Transplant Coronary Artery Disease Circulation, June 16, 1998; 97(23): 2338 - 2345. [Abstract] [Full Text] [PDF] |
||||
![]() |
J o. Koglin, T. Glysing-Jensen, J. S. Mudgett, and M. E. Russell Exacerbated Transplant Arteriosclerosis in Inducible Nitric Oxide–Deficient Mice Circulation, May 26, 1998; 97(20): 2059 - 2065. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Cannon, X. Yang, M. J. Szabolcs, S. Ravalli, R. R. Sciacca, and R. E. Michler The role of inducible nitric oxide synthase in cardiac allograft rejection Cardiovasc Res, April 1, 1998; 38(1): 6 - 15. [Full Text] [PDF] |
||||
![]() |
W. J. Paulus, S. Kastner, P. Pujadas, A. M. Shah, H. Drexler, and M. Vanderheyden Left Ventricular Contractile Effects of Inducible Nitric Oxide Synthase in the Human Allograft Circulation, November 18, 1997; 96(10): 3436 - 3442. [Abstract] [Full Text] |
||||
![]() |
A. Raisanen-Sokolowski, T. Glysing-Jensen, P. L. Mottram, and M. E Russell Sustained Anti-CD4/CD8 Treatment Blocks Inflammatory Activation and Intimal Thickening in Mouse Heart Allografts Arterioscler. Thromb. Vasc. Biol., October 1, 1997; 17(10): 2115 - 2122. [Abstract] [Full Text] |
||||
![]() |
M. Weis and W. von Scheidt Cardiac Allograft Vasculopathy : A Review Circulation, September 16, 1997; 96(6): 2069 - 2077. [Abstract] [Full Text] |
||||
![]() |
S. M. Wildhirt, H. Suzuki, D. Horstman, S. Weismuller, R. R. Dudek, K. Akiyama, and B. Reichart Selective Modulation of Inducible Nitric Oxide Synthase Isozyme in Myocardial Infarction Circulation, September 2, 1997; 96(5): 1616 - 1623. [Abstract] [Full Text] |
||||
![]() |
R. A. Kelly, J.-L. Balligand, and T. W. Smith Nitric Oxide and Cardiac Function Circ. Res., September 1, 1996; 79(3): 363 - 380. [Full Text] |
||||
![]() |
N. K. Worrall, K. Chang, G. M. Suau, W. S. Allison, T. P. Misko, P. M. Sullivan, R. G. Tilton, J. R. Williamson, and T. B. Ferguson Jr Inhibition of Inducible Nitric Oxide Synthase Prevents Myocardial and Systemic Vascular Barrier Dysfunction During Early Cardiac Allograft Rejection Circ. Res., May 1, 1996; 78(5): 769 - 779. [Abstract] [Full Text] |
||||
![]() |
C. A. E. O'Blenes, C. Kinnear, and M. Rabinovitch Tumor Necrosis Factor-{alpha} Induces Fibronectin Synthesis in Coronary Artery Smooth Muscle Cells by a Nitric Oxide-Dependent Posttranscriptional Mechanism Circ. Res., July 6, 2001; 89(1): 26 - 32. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1995 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |