(Circulation. 1995;92:1808-1812.)
© 1995 American Heart Association, Inc.
Articles |
From the Division of Cardiology, Department of Medicine, Baylor College of Medicine, Houston, Tex (M.L., M.A.Q., R.H., Q.T.Y., R.R., A.J.M.) and Division of Cardiology and the Center for Cardiovascular Research, the Toronto Hospital, Ontario, Canada (A.O., H.R., D.W., C.C.L., M.S.).
| Abstract |
|---|
|
|
|---|
Methods and Results LVMI was derived by the area-length method using two-dimensional echocardiograms. Extent of LVH was determined by a point score method (1 to 10 points). DNA was extracted from blood, and ACE genotyping was performed by polymerase chain reaction (PCR) with an established protocol. Amplification of DNA in the region of polymorphism by PCR of alleles I and D showed 490- and 190-bp products, respectively. ACE genotypes DD, ID, and II were present in 60, 90, and 33 patients with HCM, respectively. In genetically independent patients (n=108), the mean LVMI (g/m2) was 148±35.3 in those with DD (n=35) and 134.2±33.3 in those with ID and II (n=73) genotypes (P=.046). LVH score was 6.69±1.71 in patients with DD and 5.55±2.19 in those with ID and II genotypes (P=.004). Regression analysis showed that ACE genotypes accounted for 3.7% and 6.5% of the variability of LVMI and LVH score (P=.046 and P=.008, respectively). In 26 patients from a single family, LVMI and LVH score were also greater in patients with DD than in those with ID and II genotypes. ACE genotypes accounted for 14.7% and 10.4% of the variability of the LVMI and extent of hypertrophy, respectively.
Conclusions ACE genotypes influence the phenotypic expression of hypertrophy in HCM.
Key Words: angiotensin enzymes cardiomyopathy hypertrophy genes
| Introduction |
|---|
|
|
|---|
-tropomyosin
gene on chromosome 15q2, and a fourth locus on chromosome 11q11, in
families with HCM have been
identified.3 4 5 6 7
Furthermore,
more than 35 mutations in the ß-MHC gene, 8 in the troponin T
gene, and 3 in the
-tropomyosin gene in affected
individuals of families with HCM have been
reported.7 8
Genotype-phenotype correlation has shown an
association between specific mutations and the phenotypic expression of
the HCM such as sudden cardiac
death.9 10 11 However, a
significant degree of variability in the magnitude of LVH exists in
patients with HCM, even among the affected individuals with the same
mutation within the same family.10 11 12
Thus, it is evident
that a number of factors, genetic as well as environmental, affect the
extent of LVH in patients with HCM. Autocrine, paracrine, and endocrine
factors with trophic and mitogenic effects on myocytes are
likely to influence the phenotypic expression of HCM. The renin-angiotensin system plays an important role in the cardiovascular system, regulating, in part, the expression of cardiac hypertrophy.13 14 A major component of the renin-angiotensin system is ACE, which is upregulated in pressure overloadinduced cardiac hypertrophy as well as heart failure.15 16 Inhibition of ACE induces regression of cardiac hypertrophy independent of load17 and prevents dilatation and remodeling of the ventricle after myocardial infarction.18 Recently an I/D polymorphism in the ACE gene, due to the presence or absence of a 287-bp Alu repeat in intron 16 of the ACE gene, has been described.19 The I/D polymorphism results in three genotypes, DD, ID, and II. The ACE genotype DD is associated with plasma levels of ACE twice that of ACE genotype II.20 We previously showed that the ACE genotype DD is more common in patients from HCM families with a high incidence of sudden cardiac death than in unaffected members of HCM families.21 The purpose of this investigation was, therefore, to determine whether ACE genotype influences phenotypic expression of hypertrophy, assessed by two-dimensional echocardiographic measurement of LVMI and LVH severity score, in patients with HCM.
| Methods |
|---|
|
|
|---|
HCM was diagnosed on the basis of echocardiographic
criteria defined as the presence of LVH with a wall thickness of
13
mm and in the absence of other causes for hypertrophy such
as hypertension or valvular disease.4 Patients in
whom echocardiograms were not available for calculation of left
ventricular mass and score or those with poor-quality
echocardiograms were excluded from the study.
Two-dimensional echocardiography was performed with conventional equipment, and images of the left ventricle were obtained in the parasternal long-axis and short-axis and apical two-chamber and four-chamber views. Echocardiographic analysis was performed by a single individual who was blinded to the results of ACE genotypes. The magnitude of LVH was determined by calculating echocardiographic LVM by the area-length method as recommended by the American Society of Echocardiography22 and was indexed to BSA (LVMI).
The echocardiographic method of determining LVMI combines a short-axis image of the left ventricle at the base with a measurement of left ventricular long axis from the apical views. Since HCM frequently manifests as asymmetric hypertrophy, the echocardiographic measurement of LVMI may not truly reflect the extent of hypertrophy and involvement (or lack thereof) of the distal (apical) half of the septum or lateral wall. Thus, the extent of hypertrophy was also assessed by a semiquantitative point score method developed by Wigle et al.23 This method has been validated against measurements of LVM by magnetic resonance imaging.24 A maximum of 10 points are given: 1 to 4 points for septal hypertrophy based on magnitude of thickness, 2 points for extension of hypertrophy into the papillary muscles (basal two thirds of septum), 2 points for extension of hypertrophy into the apex (total septal involvement), and 2 points for extension of hypertrophy into the anterolateral wall.
The techniques used for extraction of DNA are conventional and have been published previously.4
ACE genotyping was performed by laboratory personnel who had no knowledge of the echocardiographic data. ACE genotypes were determined in 183 HCM patients by use of PCR according to previously published protocols,19 21 except for addition of DMSO to enhance amplification of the I allele.25 In brief, a set of primers was designed to encompass the polymorphic region in intron 16 of the ACE gene (sense primer 5' CTGGAGACCACTCCCATCCTTTCT 3' and antisense primer 5' GATGTGGCCATCACATTCGTCAGAT 3'). The PCR reaction contained 100 ng DNA template, 0.125 µmol/L of each primer, 200 µmol/L 4dNTPs, 1 unit of Taq DNA polymerase, and 1.5 mmol/L MgCl2 and 5% DMSO. DNA was amplified for 30 cycles, each cycle composed of denaturation at 94°C for 1 minute, annealing at 58°C for 1 minute, and extension at 72°C for 1 minute, with a final extension time of 3 minutes. The PCR products were separated by electrophoresis on 2% agarose gel and identified by ethidium bromide staining.
Statistical Analysis
Differences in the LVMI and the LVH
score among groups were
compared by Student's t test. The Fisher exact test was
used to compare the distribution frequency of ACE genotypes
among different groups. Regression analysis was performed to
determine the percentage of explained variance in LVMI and LVH score
that is accounted for by ACE genotypes. Statistical
analysis was done with MINITAB for Windows,
version 9.2 (State College, Pa). A value of P<.05 was
considered significant.
| Results |
|---|
|
|
|---|
|
|
A total of 183 patients with the diagnosis of HCM were studied.
Patients with an increased septal thickness of
13 mm and a normal
LVMI, even in the absence of a molecular genetic diagnosis, were also
studied. LVMI was calculated in 87 isolated cases of HCM and 96
patients from families with HCM. The characteristics of the study
population and the frequency of ACE genotypes are shown in
Table 1
.
The influence of ACE genotypes on the magnitude and extent of
LVH was determined in 108 genetically independent patients by combining
the sporadic cases and one randomly selected individual per family.
This approach was necessary to avoid the potential bias introduced by
the presence of genetically dependent samples (relatives) in the
cohort. The results are shown in Table 2
.
|
Patients with ACE genotype DD were more likely to have extension of hypertrophy beyond the interventricular septum, ie, involvement of the apical and/or lateral walls. While 63% of patients with ACE genotype DD had extension of hypertrophy beyond the interventricular septum, only 28% (21/73) of those with ACE genotype ID or II had involvement of the apical and lateral walls (P=.004; odds ratio, 4.2; 95% CI, 1.8 to 9.8). The frequency of ACE genotype DD also increased from 22% in the lower quartile of LVMI (114.2 g/m2) to 46% in the upper quartile (165.7 g/m2) of LVMI (P=.08).
Regression analysis showed that ACE genotypes accounted for 3.7% of the variability of LVMI (F=4.06, P=.046) and 6.5% of the variability of LVH score (F=7.32, P=.008) in genetically independent patients with HCM. Regression analysis included multiple independent variables such as age, sex, weight, height, BSA, BMI, and ACE genotypes. No correlation between any of the above variables, except for ACE genotypes, and LVMI or LVH score was observed in the study population.
To determine the independent influence of ACE genotypes on the
phenotypic expression of hypertrophy in patients with HCM,
a large family (family 14 in Table 1
) composed of 26 affected
individuals with HCM was studied. The disease in this family has been
linked to chromosome 11q1-p1; however, the responsible gene and the
mutation have not yet been identified. ACE genotypes DD, ID,
and II were present in 5, 12, and 7 patients, respectively. The
influence of ACE genotypes on the magnitude of LVMI and extent
of hypertrophy in this family is shown in Table 3
. ACE
genotypes accounted for 14.7%
(F=5.31, P=.030) and 10.4%
(F=3.90,
P=.060) of the variability of the LVMI and extent of
hypertrophy in patients with HCM in family 14,
respectively.
|
Of the 183 patients enrolled in this study, only 30 (16%) had a known
ß-MHC mutation (Table 1
). The small number of affected
individuals
with the same mutation precluded an analysis of the role of ACE
genotypes on the phenotype of LVH in individuals with
the same mutation.
| Discussion |
|---|
|
|
|---|
Genotype-phenotype correlation in HCM families with
known mutations in the ß-MHC gene has shown the role of mutations in
penetrance as well as phenotypic expression of the disease, in
particular their prognostic
significance.9 10 11 However, the
affected individuals within the same family, despite having the same
HCM mutation, show a significant variability in the magnitude of
LVH.12 This is illustrated in Table 1
, which shows
that
the LVMI and the LVH score in the affected individuals within the same
family vary extensively, despite their having the same HCM-causing
mutation. Thus, genetic background, such as ACE genotypes, is
likely to affect the phenotypic expression of HCM mutations. Although
we have shown that ACE genotypes influence development and
extent of LVH in HCM patients, it is clear that ACE genotypes
account for only a small fraction of the variability in phenotypic
expression in HCM patients. Additional genetic as well as environmental
factors are likely to be identified that, along with ACE
genotypes, could account for the remarkable variability in HCM
phenotypes. This is likely to be true for all genetic
diseases, whether they be monogenic or polygenic diseases.
Two-dimensional echocardiography using the area-length method is an accurate technique for determination of LVMI in patients with pressure-overload hypertrophy.22 However, in patients with HCM, in which hypertrophy may be asymmetric and localized, the accuracy of this technique as a measure of severity of phenotypic expression of HCM is likely to be diminished. Thus, in addition to determining LVMI, a semiquantitative point score system developed by Wigle et al,23 which is reflective of the extent of hypertrophy in HCM patients, was also determined in this study. Similarly, a significant association between homozygosity for allele D of the ACE gene and the extent of hypertrophy was found. Thus, the results of LVMI as well as LVH score were concordant in this study.
The distribution of ACE genotypes and the frequency of ACE alleles in this study were similar to those observed in the general population of the United States.21 26 The apparent discrepancy in the frequency of allele D in HCM patients between this study and our previous report21 is reflective of the differences in the study populations. The increased frequency of ACE allele D in HCM patients, as reported previously, was observed only in those HCM patients from families with a high incidence of SCD, not in those from families with a low incidence of SCD.21 Therefore, the results of our previous study indicated that ACE genotypes influence the expression of SCD in patients with HCM. Since the ACE gene is not a known causal gene for HCM, a monogenic disease, the increased frequency of allele D in a cohort of HCM patients, with a garden variety of phenotypes pooled together, is not expected. Thus, the results of the present study, showing more extensive hypertrophy in patients with ACE genotype DD, is further supportive of our previous notion that ACE genotypes indeed influence the phenotypic expression of HCM.
The influence of genetic background on determining the cardiac volume and mass has been shown previously in epidemiological studies as well as studies of monozygotic and dizygotic twins.27 28 29 Recently, Schunkert et al27 showed that homozygosity for allele D of the ACE gene serves as a genetic marker for development of LVH in a normotensive population. Furthermore, in a study of 142 patients randomly selected from an outpatient clinic, Iwai et al30 showed that ACE genotypes were predictors of LVM. However, in a study of 86 human subjects free of clinical heart disease, Kupari et al31 showed that in the absence of heart disease, ACE genotypes had no influence on echocardiographic indexes of left ventricular size, mass, or function. Thus, from the results of our study, which indicate a modifying role for the ACE genotypes in phenotypic expression of hypertrophy in HCM patients, and those studies discussed earlier, one may postulate that ACE genotypes play a role, albeit small, in modulating the hypertrophic response of the myocardium to altered stress. This finding is clinically important, since several studies have shown that echocardiographically determined LVMI carries prognostic significance and a higher LVMI is associated with increased total cardiovascular32 and cerebrovascular mortality.33 It has also been suggested that an increased LVMI is also a risk factor for mortality and sudden cardiac death in HCM patients.11 34
The molecular mechanism by which ACE genotypes determine the magnitude of LVH remains unknown and is not addressed in this study. A plausible hypothesis is that ACE genotypes influence the development of hypertrophy through their association with plasma and possibly tissue ACE levels. ACE genotypes account for approximately half of the variability of the plasma levels of ACE, with genotype DD being associated with plasma levels twice as high as that of genotype II.20 ACE, through conversion of angiotensin I to angiotensin II, the latter a trophic as well as mitogenic hormone, acts as a growth factor for cardiac myocytes and induces cardiac hypertrophy independent of hemodynamic or neurohumoral effects.13 Furthermore, ACE inhibitors result in regression of pressure overloadinduced cardiac hypertrophy independent of load.17 The association of ACE genotype DD with an increased LVMI in HCM patients is independent of pressure overload, since in this study, the prerequisite for the diagnosis of HCM was exclusion of patients with hypertension and valvular heart disease. Another plausible hypothesis is that ACE genotype DD serves as a genetic marker that cosegregates with another gene that has direct effects on development and magnitude of LVH.
In conclusion, the results of this study indicate that the ACE gene modifies the phenotypic expression of hypertrophy in HCM patients and accounts for a fraction of the interfamilial and intrafamilial variability of the magnitude and extent of hypertrophy in HCM patients. Thus, the phenotypic expression of HCM, a monogenic disease, is also influenced by additional modifying genes.
| Selected Abbreviations and Acronyms |
|---|
|
| Acknowledgments |
|---|
| Footnotes |
|---|
Guest editor for this article was Christine E. Seidman, MD, Harvard Medical School, Boston, Mass.
Received January 16, 1995; revision received March 30, 1995; accepted April 25, 1995.
| References |
|---|
|
|
|---|
2. Maron BJ, Spirito P, Wesley Y, Arce J. Development and progression of left ventricular hypertrophy in children with hypertrophic cardiomyopathy. N Engl J Med. 1986;315:610-614. [Abstract]
3. Jarcho JA, McKenna W, Pare JAP, Solomon SD, Holcombe RF, Dickie S, Levi T, Donis-Keller H, Seidman JG, Seidman CE. Mapping a gene for familial hypertrophic cardiomyopathy to chromosome 14q1. N Engl J Med. 1989;321:1372-1378. [Abstract]
4.
Hejtmancik JF, Brink PA, Towbin J, Hill R, Brink L,
Tapscott T, Traktenbroit A, Roberts R. Localization of gene for
familial hypertrophic cardiomyopathy to chromosome
14q1 in a diverse U.S. population.
Circulation. 1991;83:1592-1597.
5. Watkins H, MacRae C, Thierfelder L, Chou Y, Frenneaux MP, McKenna W, Seidman JG, Seidman CE. A disease locus for familial hypertrophic cardiomyopathy maps to chromosome 1q3. Nat Genet. 1993;3:333-337. [Medline] [Order article via Infotrieve]
6.
Thierfelder LC, MacRae C, Watkins H, Tomfohrde J,
McKenna W, Bom K, Noeske G, Schlepper M, Just J, Bowcock A, Vosberg I,
Seidman CE, Seidman JG. A familial hypertrophic
cardiomyopathy locus maps to chromosome
15q2. Proc Natl Acad Sci U S A. 1993;90:6270-6274.
7.
Thierfelder L, Watkins H, MacRae C, Lamas R, McKenna
W, Vosberg H-P, Seidman JG, Seidman CE.
-Tropomyosin and
cardiac troponin T mutations cause familial hypertrophic
cardiomyopathy: a disease of the sarcomere.
Cell. 1994;77:701-712. [Medline]
[Order article via Infotrieve]
8. Roberts R, Marian AJ, Buchinski L. Application of molecular biology to medical genetics. In: Clark EB, Markwald RR, Takao A, eds. Developmental Mechanisms of Heart Disease. Mount Kisco, NY: Futura Press; 1995:87-111.
9. Anan R, Greve G, Thierfelder L, Watkins HC, McKenna WJ, Solomon S, Vecchio C, Shono H, Nakao S, Tanaka H, Mares A Jr, Towbin JA, Spirito P, Roberts R, Seidman JG, Seidman CE. Prognostic implications of novel ß cardiac myosin heavy chain gene mutations that cause familial hypertrophic cardiomyopathy. J Clin Invest. 1994;93:280-285.
10.
Marian AJ, Mares A Jr, Kelly DP, Yu Q-T, Abchee AB,
Hill R, Roberts R. Sudden cardiac death in hypertrophic
cardiomyopathy: variability in phenotypic
expression of beta-myosin heavy chain mutations. Eur
Heart J. 1995;16:368-376.
11.
Epstein ND, Cohn GM, Cyran F, Fananapazir L.
Differences in clinical expression of hypertrophic
cardiomyopathy associated with two distinct
mutations in the ß-myosin heavy chain gene: a
908Leu
Val mutation and a 403Arg
Gln
mutation. Circulation. 1992;86:345-352.
12. Solomon SD, Wolff SA, Watkins H, Ridker PM, Come P, McKenna WJ, Seidman CE, Lee RT. Left ventricular hypertrophy and morphology in familial hypertrophic cardiomyopathy associated with mutations of the beta-myosin heavy chain gene. J Am Coll Cardiol. 1993;22:498-505. [Abstract]
13.
Sadoshima J-I, Izumo S. Molecular
characterization of angiotensin II induced
hypertrophy of cardiac myocytes and hyperplasia of cardiac
fibroblasts: critical role of the AT1 receptor subtype.
Circ Res. 1993;73:413-423.
14.
Griendling KK, Murphy TJ, Alexander RW.
Molecular biology of the renin-angiotensin
system. Circulation. 1993;87:1816-1828.
15.
Schunkert H, Jackson B, Tang SS, Schoen FJ, Smits FM,
Apstein CS, Lorell BH. Distribution and functional significance
of cardiac angiotensin converting enzyme in hypertrophied
rat hearts. Circulation. 1993;87:1328-1339.
16. Studer R, Reinecke H, Muller B, Holtz J, Just H, Drexler H. Increased angiotensin-I converting enzyme gene expression in the failing human heart: quantification by competitive RNA polymerase chain reaction. J Clin Invest. 1994;94:301-310.
17. Linz W, Schaper J, Wiemer G, Albus U, Scholkens BA. Ramipril prevents left ventricular hypertrophy with myocardial fibrosis without blood pressure reduction: a one year study in rats. Br J Pharmacol. 1992;107:970-975. [Medline] [Order article via Infotrieve]
18. Pfeffer MA, Braunwald E, on behalf of SAVE investigators. Effect of captopril on mortality and morbidity in patients with left ventricular dysfunction after myocardial infarction. N Engl J Med. 1992;327:669-677. [Abstract]
19.
Rigat B, Hubert C, Corvol P, Soubrier F. PCR
detection of the insertion/deletion polymorphism of the human
angiotensin converting enzyme gene (DCP1) (dipeptidyl
carboxypeptidase 1). Nucleic Acids Res. 1992;20:1433.
20. Rigat B, Hubert C, Alhenc-Gelas F, Cambien F, Corval P, Soubrier F. An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half of the variance of serum enzyme levels. J Clin Invest. 1990;86:1343-1346.
21. Marian AJ, Yu Q-T, Workman R, Greve G, Roberts R. Angiotensin converting enzyme polymorphism is associated with hypertrophic cardiomyopathy as well as sudden cardiac death. Lancet. 1993;342:1073-1074. [Medline] [Order article via Infotrieve]
22. American Society of Echocardiography Committee on Standards, Subcommittee on Quantitation of Two-Dimensional Echocardiograms: Schiller NB, Shah PM, Crawford M, DeMaria A, Devereux R, Feigenbaum H, Gutgessell H, Reichek N, Sahn D, Schnittger I, Silverman NH, Tajik AJ. Recommendations for quantitation of the left ventricle by two-dimensional echocardiography. J Am Soc Echocardiogr. 1989;2:358-367.[Medline] [Order article via Infotrieve]
23. Wigle ED, Sasson Z, Henderson MA, Ruddy TD, Fulop J, Rakowski H, Williams WG. Hypertrophic cardiomyopathy: the importance of the site and extent of hypertrophy: a review. Prog Cardiovasc Dis. 1985;28:1-83. [Medline] [Order article via Infotrieve]
24. Rakowski H, Sasson Z, Wigle ED. Echocardiographic and Doppler assessment of hypertrophic cardiomyopathy. J Am Soc Echocardiogr. 1988;1:31-47. [Medline] [Order article via Infotrieve]
25. Fogarty DG, Maxwell AP, Doherty CC, Hughes AE, Nevin NC. ACE gene typing. Lancet. 1994;343:851. Letter. [Medline] [Order article via Infotrieve]
26. Beohar N, Damaraju S, Prather A, Yu Q-T, Raizner AE, Kleiman NS, Robert R, Marian AJ. Angiotensin converting enzyme genotype DD is a risk factor for coronary artery disease. J Invest Med. 1995;43:275-280. [Medline] [Order article via Infotrieve]
27.
Schunkert H, Hense H-W, Holmer SR, Stender M, Perz S,
Keil U, Lorell BH, Riegger GAJ. Association between a deletion
polymorphism of the angiotensin converting-enzyme
gene and left ventricular hypertrophy.
N Engl J Med. 1994;330:1634-1638.
28.
Adams TD, Yanowitz FG, Fisher AG, Ridges JD, Nelson AG,
Hagan AD, Williams RR, Hunt SC. Heritability of cardiac size: an
echocardiographic and electrocardiographic study of
monozygotic and dizygotic twins.
Circulation. 1985;71:39-44.
29. Verhaaren HA, Schieken RM, Mosteller M, Hewitt JK, Eaves LJ, Nance WE. Bivariate genetic analysis of left ventricular mass and weight in pubertal twins (the Medical College of Virginia Twin Study). Am J Cardiol. 1991;68:661-668. [Medline] [Order article via Infotrieve]
30.
Iwai N, Ohimichi N, Nakamura Y, Kinoshita M. DD
genotype of the angiotensin-converting enzyme
gene is a risk factor for left ventricular
hypertrophy. Circulation. 1994;90:2622-2628.
31. Kupari M, Perola M, Koskinen P, Virolainen J, Karhunen PJ. Left ventricular size and mass, and function in relation to angiotensin-converting enzyme gene polymorphism in human. Am J Physiol. 1994;267(3 pt 2):H1107-H1111.
32. Levy D, Garrison RJ, Savage DD, Kannel WB, Castelli WP. Prognostic implications of echocardiographically determined left ventricular mass in the Framingham Heart Study. N Engl J Med. 1990;322:1561-1566. [Abstract]
33.
Bikkina M, Levy D, Evans JC, Larson MG, Benjamin EJ,
Wolf PA, Castelli WP. Left ventricular mass and risk
of stroke in an elderly cohort: the Framingham Heart Study.
JAMA. 1994;272:33-36.
34. Spirito P, Maron BJ. Relation between extent of left ventricular hypertrophy and occurrence of sudden cardiac death in hypertrophic cardiomyopathy. J Am Coll Cardiol. 1990;15:1521-1526.[Abstract]
This article has been cited by other articles:
![]() |
J. M. Bos, J. A. Towbin, and M. J. Ackerman Diagnostic, prognostic, and therapeutic implications of genetic testing for hypertrophic cardiomyopathy. J. Am. Coll. Cardiol., July 14, 2009; 54(3): 201 - 211. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Kaludercic, C. Reggiani, and N. Paolocci Genes, Geography and Geometry: The "Critical Mass" in Hypertrophic Cardiomyopathy J. Mol. Diagn., January 1, 2009; 11(1): 12 - 16. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Penicka, P. Gregor, R. Kerekes, D. Marek, K. Curila, J. Krupicka, and for the Candesartan use in Hypertrophic And Non-ob The Effects of Candesartan on Left Ventricular Hypertrophy and Function in Nonobstructive Hypertrophic Cardiomyopathy: A Pilot, Randomized Study J. Mol. Diagn., January 1, 2009; 11(1): 35 - 41. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. H. Frey, W. Lieb, J. Erdmann, D. Savidou, G. Heusch, K. Leineweber, H. Jakob, H.-W. Hense, H. Lowel, N. H. Brockmeyer, et al. Characterization of the GNAQ promoter and association of increased Gq expression with cardiac hypertrophy in humans Eur. Heart J., April 1, 2008; 29(7): 888 - 897. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. W. Daw, S. N. Chen, G. Czernuszewicz, R. Lombardi, Y. Lu, J. Ma, R. Roberts, S. Shete, and A. J. Marian Genome-wide mapping of modifier chromosomal loci for human hypertrophic cardiomyopathy Hum. Mol. Genet., October 15, 2007; 16(20): 2463 - 2471. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Muthumala, H. Montgomery, J. Palmen, J. A. Cooper, and S. E. Humphries Angiotensin-Converting Enzyme Genotype Interacts With Systolic Blood Pressure to Determine Coronary Heart Disease Risk in Healthy Middle-Aged Men Hypertension, August 1, 2007; 50(2): 348 - 353. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Hueb, S. G. Zanati, K. Okoshi, C. N. Raffin, L. V. de Arruda Silveira, and B. B. Matsubara Association Between Atherosclerotic Aortic Plaques and Left Ventricular Hypertrophy in Patients With Cerebrovascular Events Stroke, April 1, 2006; 37(4): 958 - 962. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Perkins, S. L. Van Driest, E. G. Ellsworth, M. L. Will, B. J. Gersh, S. R. Ommen, and M. J. Ackerman Gene-specific modifying effects of pro-LVH polymorphisms involving the renin-angiotensin-aldosterone system among 389 unrelated patients with hypertrophic cardiomyopathy Eur. Heart J., November 2, 2005; 26(22): 2457 - 2462. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Sipola, K. Lauerma, P. Jaaskelainen, M. Laakso, K. Peuhkurinen, H. Manninen, H. J. Aronen, and J. Kuusisto Cine MR Imaging of Myocardial Contractile Impairment in Patients with Hypertrophic Cardiomyopathy Attributable to Asp175Asn Mutation in the {alpha}-Tropomyosin Gene Radiology, September 1, 2005; 236(3): 815 - 824. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Maron, W. J. McKenna, G. K. Danielson, L. J. Kappenberger, H. J. Kuhn, C. E. Seidman, P. M. Shah, W. H. Spencer III, P. Spirito, F. J. Ten Cate, et al. American College of Cardiology/European Society of Cardiology Clinical Expert Consensus Document on Hypertrophic Cardiomyopathy: a report of the American College of Cardiology Foundation Task Force on Clinical Expert Consensus Documents and the European Society of Cardiology Committee for Practice Guidelines J. Am. Coll. Cardiol., November 5, 2003; 42(9): 1687 - 1713. [Full Text] [PDF] |
||||
![]() |
Writing Committee Members, B. J. Maron, W. J. McKenna, G. K. Danielson, L. J. Kappenberger, H. J. Kuhn, C. E. Seidman, P. M. Shah, W. H. Spencer III, P. Spirito, et al. American College of Cardiology/European Society of Cardiology Clinical Expert Consensus Document on Hypertrophic Cardiomyopathy: A report of the American College of Cardiology Foundation Task Force on Clinical Expert Consensus Documents and the European Society of Cardiology Committee for Practice Guidelines Eur. Heart J., November 1, 2003; 24(21): 1965 - 1991. [Full Text] [PDF] |
||||
![]() |
A Woo, H Rakowski, J C Liew, M-S Zhao, C-C Liew, T G Parker, M Zeller, E D Wigle, and M J Sole Mutations of the {beta} myosin heavy chain gene in hypertrophic cardiomyopathy: critical functional sites determine prognosis Heart, October 1, 2003; 89(10): 1179 - 1185. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. G. Nabel Cardiovascular Disease N. Engl. J. Med., July 3, 2003; 349(1): 60 - 72. [Full Text] [PDF] |
||||
![]() |
P. Sipola, E. Vanninen, H. J. Aronen, K. Lauerma, S. Simula, P. Jaaskelainen, M. Laakso, K. Peuhkurinen, J. Kuusisto, and J. T. Kuikka Cardiac Adrenergic Activity Is Associated with Left Ventricular Hypertrophy in Genetically Homogeneous Subjects with Hypertrophic Cardiomyopathy J. Nucl. Med., April 1, 2003; 44(4): 487 - 493. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Arad, J.G. Seidman, and C. E. Seidman Phenotypic diversity in hypertrophic cardiomyopathy Hum. Mol. Genet., October 1, 2002; 11(20): 2499 - 2506. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Maron Hypertrophic Cardiomyopathy: A Systematic Review JAMA, March 13, 2002; 287(10): 1308 - 1320. [Abstract] [Full Text] [PDF] |
||||
![]() |
J R Ortlepp, H P Vosberg, S Reith, F Ohme, N G Mahon, D Schroder, H G Klues, P Hanrath, and W J McKenna Genetic polymorphisms in the renin-angiotensin-aldosterone system associated with expression of left ventricular hypertrophy in hypertrophic cardiomyopathy: a study of five polymorphic genes in a family with a disease causing mutation in the myosin binding protein C gene Heart, March 1, 2002; 87(3): 270 - 275. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Deinum, J. M.G. van Gool, M. J.M. Kofflard, F. J. ten Cate, and A.H. J. Danser Angiotensin II Type 2 Receptors and Cardiac Hypertrophy in Women With Hypertrophic Cardiomyopathy Hypertension, December 1, 2001; 38(6): 1278 - 1281. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Marian On genetic and phenotypic variability of hypertrophic cardiomyopathy: nature versus nurture J. Am. Coll. Cardiol., August 1, 2001; 38(2): 331 - 334. [Full Text] [PDF] |
||||
![]() |
J. C. Rodriguez-Perez, F. Rodriguez-Esparragon, O. Hernandez-Perera, A. Anabitarte, A. Losada, A. Medina, E. Hernandez, D. Fiuza, O. Avalos, C. Yunis, et al. Association of angiotensinogen m235t and a(-6)g gene polymorphisms with coronary heart disease with independence of essential hypertension: the procagene study J. Am. Coll. Cardiol., May 1, 2001; 37(6): 1536 - 1542. [Abstract] [Full Text] [PDF] |
||||
![]() |
N G Mahon, A S Coonar, S Jeffery, F Coccolo, J Akiyu, B Zal, R Houlston, G E Levin, C Baboonian, W J McKenna, et al. Haemochromatosis gene mutations in idiopathic dilated cardiomyopathy Heart, November 1, 2000; 84(5): 541 - 547. [Abstract] [Full Text] |
||||
![]() |
P. Sorajja, P.M. Elliott, and W.J. Mckenna The molecular genetics of hypertrophic cardiomyopathy: prognostic implications Europace, January 1, 2000; 2(1): 4 - 14. [PDF] |
||||
![]() |
M. Komajda, P. Charron, and F. Tesson Genetic aspects of heart failure Eur J Heart Fail, June 1, 1999; 1(2): 121 - 126. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. R. M. Osterop, M. J. M. Kofflard, L. A. Sandkuijl, F. J. t. Cate, R. Krams, M. A. D. H. Schalekamp, and A. H. J. Danser AT1 Receptor A/C1166 Polymorphism Contributes to Cardiac Hypertrophy in Subjects With Hypertrophic Cardiomyopathy Hypertension, November 1, 1998; 32(5): 825 - 830. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Maron, J. H. Moller, C. E. Seidman, G. M. Vincent, H. C. Dietz, A. J. Moss, J. A. Towbin, H. M. Sondheimer, R. E. Pyeritz, G. McGee, et al. Impact of Laboratory Molecular Diagnosis on Contemporary Diagnostic Criteria for Genetically Transmitted Cardiovascular Diseases: Hypertrophic Cardiomyopathy, Long-QT Syndrome, and Marfan Syndrome : A Statement for Healthcare Professionals From the Councils on Clinical Cardiology, Cardiovascular Disease in the Young, and Basic Science, American Heart Association Circulation, October 6, 1998; 98(14): 1460 - 1471. [Full Text] [PDF] |
||||
![]() |
M. Kyriakidis, F. Triposkiadis, J. Dernellis, A. E. Androulakis, P. Mellas, G. A. Kelepeshis, and J. E. Gialafos Effects of Cardiac Versus Circulatory Angiotensin-Converting Enzyme Inhibition on Left Ventricular Diastolic Function and Coronary Blood Flow in Hypertrophic Obstructive Cardiomyopathy Circulation, April 14, 1998; 97(14): 1342 - 1347. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Agerholm-Larsen, B. G. Nordestgaard, R. Steffensen, T. I.A. Sorensen, G. Jensen, and A. Tybjærg-Hansen ACE Gene Polymorphism: Ischemic Heart Disease and Longevity in 10 150 Individuals: A Case-Referent and Retrospective Cohort Study Based on the Copenhagen City Heart Study Circulation, May 20, 1997; 95(10): 2358 - 2367. [Abstract] [Full Text] |
||||
![]() |
A. Busjahn, H. Knoblauch, M. Knoblauch, J. Bohlender, M. Menz, H.-D. Faulhaber, A. Becker, H. Schuster, and F. C. Luft Angiotensin-Converting Enzyme and Angiotensinogen Gene Polymorphisms, Plasma Levels, Cardiac Dimensions A Twin Study: A Twin Study Hypertension, January 1, 1997; 29(1): 165 - 170. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1995 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |