This Article Abstract Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Lechin, M. Articles by Marian, A. J. Search for Related Content PubMed PubMed Citation Articles by Lechin, M. Articles by Marian, A. J.

(Circulation. 1995;92:1808-1812.)
© 1995 American Heart Association, Inc.

Articles

Angiotensin-I Converting Enzyme Genotypes and Left Ventricular Hypertrophy in Patients With Hypertrophic Cardiomyopathy

Marcel Lechin, MD; Miguel A. Quiñones, MD; Ahmad Omran, MD; Rita Hill, RN; Qun-Tao Yu, MD; Harry Rakowski, MD; Douglas Wigle, MD; C.C. Liew, PhD; Michael Sole, MD; Robert Roberts, MD; Ali J. Marian, MD

From the Division of Cardiology, Department of Medicine, Baylor College of Medicine, Houston, Tex (M.L., M.A.Q., R.H., Q.T.Y., R.R., A.J.M.) and Division of Cardiology and the Center for Cardiovascular Research, the Toronto Hospital, Ontario, Canada (A.O., H.R., D.W., C.C.L., M.S.).

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Background The variability of the phenotypic expression of left ventricular hypertrophy (LVH) in patients with hypertrophic cardiomyopathy (HCM) indicates a potential role for additional modifying genes. Variants of angiotensin-I converting enzyme (ACE) gene have been implicated in cardiac hypertrophy. To assess whether ACE genotypes influence the phenotypic expression of hypertrophy, we determined the left ventricular mass index (LVMI) and extent of hypertrophy in 183 patients with HCM.

Methods and Results LVMI was derived by the area-length method using two-dimensional echocardiograms. Extent of LVH was determined by a point score method (1 to 10 points). DNA was extracted from blood, and ACE genotyping was performed by polymerase chain reaction (PCR) with an established protocol. Amplification of DNA in the region of polymorphism by PCR of alleles I and D showed 490- and 190-bp products, respectively. ACE genotypes DD, ID, and II were present in 60, 90, and 33 patients with HCM, respectively. In genetically independent patients (n=108), the mean LVMI (g/m²) was 148±35.3 in those with DD (n=35) and 134.2±33.3 in those with ID and II (n=73) genotypes (P=.046). LVH score was 6.69±1.71 in patients with DD and 5.55±2.19 in those with ID and II genotypes (P=.004). Regression analysis showed that ACE genotypes accounted for 3.7% and 6.5% of the variability of LVMI and LVH score (P=.046 and P=.008, respectively). In 26 patients from a single family, LVMI and LVH score were also greater in patients with DD than in those with ID and II genotypes. ACE genotypes accounted for 14.7% and 10.4% of the variability of the LVMI and extent of hypertrophy, respectively.

Conclusions ACE genotypes influence the phenotypic expression of hypertrophy in HCM.

Key Words: angiotensin • enzymes • cardiomyopathy • hypertrophy • genes

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
The phenotypic hallmark of HCM is LVH.¹ The development as well as the severity of LVH in patients with HCM is variable, as is the phenotypic expression of many other autosomal-dominant diseases.² Recently, three genes, namely the ß-MHC gene on chromosome 14q1, the cardiac troponin T gene on chromosome 1q3, and the -tropomyosin gene on chromosome 15q2, and a fourth locus on chromosome 11q11, in families with HCM have been identified.^{3 4 5 6 7} Furthermore, more than 35 mutations in the ß-MHC gene, 8 in the troponin T gene, and 3 in the -tropomyosin gene in affected individuals of families with HCM have been reported.^{7 8} Genotype-phenotype correlation has shown an association between specific mutations and the phenotypic expression of the HCM such as sudden cardiac death.^{9 10 11} However, a significant degree of variability in the magnitude of LVH exists in patients with HCM, even among the affected individuals with the same mutation within the same family.^{10 11 12} Thus, it is evident that a number of factors, genetic as well as environmental, affect the extent of LVH in patients with HCM. Autocrine, paracrine, and endocrine factors with trophic and mitogenic effects on myocytes are likely to influence the phenotypic expression of HCM.

The renin-angiotensin system plays an important role in the cardiovascular system, regulating, in part, the expression of cardiac hypertrophy.^{13 14} A major component of the renin-angiotensin system is ACE, which is upregulated in pressure overload–induced cardiac hypertrophy as well as heart failure.^{15 16} Inhibition of ACE induces regression of cardiac hypertrophy independent of load¹⁷ and prevents dilatation and remodeling of the ventricle after myocardial infarction.¹⁸ Recently an I/D polymorphism in the ACE gene, due to the presence or absence of a 287-bp Alu repeat in intron 16 of the ACE gene, has been described.¹⁹ The I/D polymorphism results in three genotypes, DD, ID, and II. The ACE genotype DD is associated with plasma levels of ACE twice that of ACE genotype II.²⁰ We previously showed that the ACE genotype DD is more common in patients from HCM families with a high incidence of sudden cardiac death than in unaffected members of HCM families.²¹ The purpose of this investigation was, therefore, to determine whether ACE genotype influences phenotypic expression of hypertrophy, assessed by two-dimensional echocardiographic measurement of LVMI and LVH severity score, in patients with HCM.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
One hundred eighty-three white adult patients with the diagnosis of HCM were enrolled in the study. Patients <18 years old were included in the study only if the underlying genetic defect was known. Eighty-seven patients had a sporadic form of HCM, while for the remaining 96 patients, at least 1 other family member was affected, as shown by echocardiogram.

HCM was diagnosed on the basis of echocardiographic criteria defined as the presence of LVH with a wall thickness of 13 mm and in the absence of other causes for hypertrophy such as hypertension or valvular disease.⁴ Patients in whom echocardiograms were not available for calculation of left ventricular mass and score or those with poor-quality echocardiograms were excluded from the study.

Two-dimensional echocardiography was performed with conventional equipment, and images of the left ventricle were obtained in the parasternal long-axis and short-axis and apical two-chamber and four-chamber views. Echocardiographic analysis was performed by a single individual who was blinded to the results of ACE genotypes. The magnitude of LVH was determined by calculating echocardiographic LVM by the area-length method as recommended by the American Society of Echocardiography²² and was indexed to BSA (LVMI).

The echocardiographic method of determining LVMI combines a short-axis image of the left ventricle at the base with a measurement of left ventricular long axis from the apical views. Since HCM frequently manifests as asymmetric hypertrophy, the echocardiographic measurement of LVMI may not truly reflect the extent of hypertrophy and involvement (or lack thereof) of the distal (apical) half of the septum or lateral wall. Thus, the extent of hypertrophy was also assessed by a semiquantitative point score method developed by Wigle et al.²³ This method has been validated against measurements of LVM by magnetic resonance imaging.²⁴ A maximum of 10 points are given: 1 to 4 points for septal hypertrophy based on magnitude of thickness, 2 points for extension of hypertrophy into the papillary muscles (basal two thirds of septum), 2 points for extension of hypertrophy into the apex (total septal involvement), and 2 points for extension of hypertrophy into the anterolateral wall.

The techniques used for extraction of DNA are conventional and have been published previously.⁴

ACE genotyping was performed by laboratory personnel who had no knowledge of the echocardiographic data. ACE genotypes were determined in 183 HCM patients by use of PCR according to previously published protocols,^{19 21} except for addition of DMSO to enhance amplification of the I allele.²⁵ In brief, a set of primers was designed to encompass the polymorphic region in intron 16 of the ACE gene (sense primer 5' CTGGAGACCACTCCCATCCTTTCT 3' and antisense primer 5' GATGTGGCCATCACATTCGTCAGAT 3'). The PCR reaction contained 100 ng DNA template, 0.125 µmol/L of each primer, 200 µmol/L 4dNTPs, 1 unit of Taq DNA polymerase, and 1.5 mmol/L MgCl₂ and 5% DMSO. DNA was amplified for 30 cycles, each cycle composed of denaturation at 94°C for 1 minute, annealing at 58°C for 1 minute, and extension at 72°C for 1 minute, with a final extension time of 3 minutes. The PCR products were separated by electrophoresis on 2% agarose gel and identified by ethidium bromide staining.

Statistical Analysis
Differences in the LVMI and the LVH score among groups were compared by Student's t test. The Fisher exact test was used to compare the distribution frequency of ACE genotypes among different groups. Regression analysis was performed to determine the percentage of explained variance in LVMI and LVH score that is accounted for by ACE genotypes. Statistical analysis was done with MINITAB for Windows, version 9.2 (State College, Pa). A value of P<.05 was considered significant.

	Results

Top Abstract Introduction Methods Results Discussion References

 
Gel electrophoresis of amplified PCR products showed 490- and 190-bp products, corresponding to the PCR amplification of I and D alleles, respectively (Figure). The distribution of ACE genotypes in the study population was 60 patients (33%) with DD, 90 patients (49%) with ID, and 33 patients (18%) with II genotypes (Table 1). The frequency of allele D was 0.57, which is comparable to the frequency of this allele in the white population of the United States as reported previously.^{21 26} Ninety-nine of the 183 patients were men, and the remaining 84 patients were women. ACE genotypes DD, ID, and II were present in 30% (30/99), 51% (50/99), and 19% (19/99) of male patients and 36% (30/84), 48% (40/84), and 17% (14/84) of female patients, respectively (P=.72).

View larger version (82K): [in this window] [in a new window]   Figure 1. Agarose gel electrophoresis of PCR products in the region of ACE I/D polymorphism. The first lane shows the presence of a single 190-bp band, indicating homozygosity for allele D (DD genotype). The middle lane shows the presence of a 490- and a 190-bp product, products of alleles I and D, and indicating heterozygosity for ACE alleles (ID genotype). Last lane shows a single 490-bp product, a product of allele D, indicating homozygosity for allele I (II genotype).

View this table: [in this window] [in a new window]   Table 1. Characteristics of Isolated and Familial Cases of HCM

A total of 183 patients with the diagnosis of HCM were studied. Patients with an increased septal thickness of 13 mm and a normal LVMI, even in the absence of a molecular genetic diagnosis, were also studied. LVMI was calculated in 87 isolated cases of HCM and 96 patients from families with HCM. The characteristics of the study population and the frequency of ACE genotypes are shown in Table 1.

The influence of ACE genotypes on the magnitude and extent of LVH was determined in 108 genetically independent patients by combining the sporadic cases and one randomly selected individual per family. This approach was necessary to avoid the potential bias introduced by the presence of genetically dependent samples (relatives) in the cohort. The results are shown in Table 2.

View this table: [in this window] [in a new window]   Table 2. Influence of ACE Genotypes on LVH in Genetically Independent Patients With HCM

Patients with ACE genotype DD were more likely to have extension of hypertrophy beyond the interventricular septum, ie, involvement of the apical and/or lateral walls. While 63% of patients with ACE genotype DD had extension of hypertrophy beyond the interventricular septum, only 28% (21/73) of those with ACE genotype ID or II had involvement of the apical and lateral walls (P=.004; odds ratio, 4.2; 95% CI, 1.8 to 9.8). The frequency of ACE genotype DD also increased from 22% in the lower quartile of LVMI (114.2 g/m²) to 46% in the upper quartile (165.7 g/m²) of LVMI (P=.08).

Regression analysis showed that ACE genotypes accounted for 3.7% of the variability of LVMI (F=4.06, P=.046) and 6.5% of the variability of LVH score (F=7.32, P=.008) in genetically independent patients with HCM. Regression analysis included multiple independent variables such as age, sex, weight, height, BSA, BMI, and ACE genotypes. No correlation between any of the above variables, except for ACE genotypes, and LVMI or LVH score was observed in the study population.

To determine the independent influence of ACE genotypes on the phenotypic expression of hypertrophy in patients with HCM, a large family (family 14 in Table 1) composed of 26 affected individuals with HCM was studied. The disease in this family has been linked to chromosome 11q1-p1; however, the responsible gene and the mutation have not yet been identified. ACE genotypes DD, ID, and II were present in 5, 12, and 7 patients, respectively. The influence of ACE genotypes on the magnitude of LVMI and extent of hypertrophy in this family is shown in Table 3. ACE genotypes accounted for 14.7% (F=5.31, P=.030) and 10.4% (F=3.90, P=.060) of the variability of the LVMI and extent of hypertrophy in patients with HCM in family 14, respectively.

View this table: [in this window] [in a new window]   Table 3. Influence of ACE Genotypes on LVH in Patients With HCM in a Single Family

Of the 183 patients enrolled in this study, only 30 (16%) had a known ß-MHC mutation (Table 1). The small number of affected individuals with the same mutation precluded an analysis of the role of ACE genotypes on the phenotype of LVH in individuals with the same mutation.

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
We have determined the ACE genotypes in a total of 183 patients, including 108 genetically independent patients with HCM, and have shown a positive association between ACE genotype DD and the magnitude of LVH as assessed by LVMI and by a semiquantitative score. Our results are the first to suggest that the phenotypic expression of hypertrophy in patients with HCM—a monogenic disease—is influenced by another gene, the ACE gene. We previously showed an increased frequency of ACE genotype DD in patients from HCM families with a high incidence of sudden cardiac death compared with their unaffected siblings and offspring.²¹ The results of the present study indicate that homozygosity for ACE allele D increases the risk of developing extensive hypertrophy in patients with HCM. Thus, although HCM is a monogenic disease, it is clear that additional genetic factors such as ACE genotypes partially account for the interfamilial and intrafamilial variability in the phenotypic expression of the disease.

Genotype-phenotype correlation in HCM families with known mutations in the ß-MHC gene has shown the role of mutations in penetrance as well as phenotypic expression of the disease, in particular their prognostic significance.^{9 10 11} However, the affected individuals within the same family, despite having the same HCM mutation, show a significant variability in the magnitude of LVH.¹² This is illustrated in Table 1, which shows that the LVMI and the LVH score in the affected individuals within the same family vary extensively, despite their having the same HCM-causing mutation. Thus, genetic background, such as ACE genotypes, is likely to affect the phenotypic expression of HCM mutations. Although we have shown that ACE genotypes influence development and extent of LVH in HCM patients, it is clear that ACE genotypes account for only a small fraction of the variability in phenotypic expression in HCM patients. Additional genetic as well as environmental factors are likely to be identified that, along with ACE genotypes, could account for the remarkable variability in HCM phenotypes. This is likely to be true for all genetic diseases, whether they be monogenic or polygenic diseases.

Two-dimensional echocardiography using the area-length method is an accurate technique for determination of LVMI in patients with pressure-overload hypertrophy.²² However, in patients with HCM, in which hypertrophy may be asymmetric and localized, the accuracy of this technique as a measure of severity of phenotypic expression of HCM is likely to be diminished. Thus, in addition to determining LVMI, a semiquantitative point score system developed by Wigle et al,²³ which is reflective of the extent of hypertrophy in HCM patients, was also determined in this study. Similarly, a significant association between homozygosity for allele D of the ACE gene and the extent of hypertrophy was found. Thus, the results of LVMI as well as LVH score were concordant in this study.

The distribution of ACE genotypes and the frequency of ACE alleles in this study were similar to those observed in the general population of the United States.^{21 26} The apparent discrepancy in the frequency of allele D in HCM patients between this study and our previous report²¹ is reflective of the differences in the study populations. The increased frequency of ACE allele D in HCM patients, as reported previously, was observed only in those HCM patients from families with a high incidence of SCD, not in those from families with a low incidence of SCD.²¹ Therefore, the results of our previous study indicated that ACE genotypes influence the expression of SCD in patients with HCM. Since the ACE gene is not a known causal gene for HCM, a monogenic disease, the increased frequency of allele D in a cohort of HCM patients, with a garden variety of phenotypes pooled together, is not expected. Thus, the results of the present study, showing more extensive hypertrophy in patients with ACE genotype DD, is further supportive of our previous notion that ACE genotypes indeed influence the phenotypic expression of HCM.

The influence of genetic background on determining the cardiac volume and mass has been shown previously in epidemiological studies as well as studies of monozygotic and dizygotic twins.^{27 28 29} Recently, Schunkert et al²⁷ showed that homozygosity for allele D of the ACE gene serves as a genetic marker for development of LVH in a normotensive population. Furthermore, in a study of 142 patients randomly selected from an outpatient clinic, Iwai et al³⁰ showed that ACE genotypes were predictors of LVM. However, in a study of 86 human subjects free of clinical heart disease, Kupari et al³¹ showed that in the absence of heart disease, ACE genotypes had no influence on echocardiographic indexes of left ventricular size, mass, or function. Thus, from the results of our study, which indicate a modifying role for the ACE genotypes in phenotypic expression of hypertrophy in HCM patients, and those studies discussed earlier, one may postulate that ACE genotypes play a role, albeit small, in modulating the hypertrophic response of the myocardium to altered stress. This finding is clinically important, since several studies have shown that echocardiographically determined LVMI carries prognostic significance and a higher LVMI is associated with increased total cardiovascular³² and cerebrovascular mortality.³³ It has also been suggested that an increased LVMI is also a risk factor for mortality and sudden cardiac death in HCM patients.^{11 34}

The molecular mechanism by which ACE genotypes determine the magnitude of LVH remains unknown and is not addressed in this study. A plausible hypothesis is that ACE genotypes influence the development of hypertrophy through their association with plasma and possibly tissue ACE levels. ACE genotypes account for approximately half of the variability of the plasma levels of ACE, with genotype DD being associated with plasma levels twice as high as that of genotype II.²⁰ ACE, through conversion of angiotensin I to angiotensin II, the latter a trophic as well as mitogenic hormone, acts as a growth factor for cardiac myocytes and induces cardiac hypertrophy independent of hemodynamic or neurohumoral effects.¹³ Furthermore, ACE inhibitors result in regression of pressure overload–induced cardiac hypertrophy independent of load.¹⁷ The association of ACE genotype DD with an increased LVMI in HCM patients is independent of pressure overload, since in this study, the prerequisite for the diagnosis of HCM was exclusion of patients with hypertension and valvular heart disease. Another plausible hypothesis is that ACE genotype DD serves as a genetic marker that cosegregates with another gene that has direct effects on development and magnitude of LVH.

In conclusion, the results of this study indicate that the ACE gene modifies the phenotypic expression of hypertrophy in HCM patients and accounts for a fraction of the interfamilial and intrafamilial variability of the magnitude and extent of hypertrophy in HCM patients. Thus, the phenotypic expression of HCM, a monogenic disease, is also influenced by additional modifying genes.

	Selected Abbreviations and Acronyms

 

ACE = angiotensin I–converting enzyme BMI = body mass index BSA = body surface area D = deletion HCM = hypertrophic cardiomyopathy I = insertion LVH = left ventricular hypertrophy LVM = left ventricular mass LVMI = LVM index MHC = myosin heavy chain PCR = polymerase chain reaction SCD = sudden cardiac death ST = septal thickness

	Acknowledgments

 
This work was supported in part by grants from the National Heart, Lung, and Blood Institute Specialized Centers of Research (P50-HL42267-01); the American Heart Association/Bugher Foundation Center for Molecular Biology (86-2216); the American Heart Association, Texas Affiliate (93G-1191); a grant from the Methodist Hospital Foundation, Houston, Tex; and a grant from the Heart and Stroke Foundation of Canada. The authors would like to acknowledge the expert assistance of Robert Fromm, MD, MPH, for statistical analysis of the data.

	Footnotes

 
Reprint requests to A.J. Marian, MD, Assistant Professor of Medicine, Division of Cardiology, One Baylor Plaza, 543E, Houston, TX 77030.

Guest editor for this article was Christine E. Seidman, MD, Harvard Medical School, Boston, Mass.

Received January 16, 1995; revision received March 30, 1995; accepted April 25, 1995.

	References

Top Abstract Introduction Methods Results Discussion References

 

1. Wynne J, Braunwald E. The cardiomyopathies and myocarditides: toxic, chemical, and physical damage to the heart. In: Braunwald E, ed. Heart Disease: A Textbook of Cardiovascular Medicine. Philadelphia, Pa: WB Saunders Co; 1992:1394-1450.
   
2. Maron BJ, Spirito P, Wesley Y, Arce J. Development and progression of left ventricular hypertrophy in children with hypertrophic cardiomyopathy. N Engl J Med. 1986;315:610-614. [Abstract]
   
3. Jarcho JA, McKenna W, Pare JAP, Solomon SD, Holcombe RF, Dickie S, Levi T, Donis-Keller H, Seidman JG, Seidman CE. Mapping a gene for familial hypertrophic cardiomyopathy to chromosome 14q1. N Engl J Med. 1989;321:1372-1378. [Abstract]
   
4. Hejtmancik JF, Brink PA, Towbin J, Hill R, Brink L, Tapscott T, Traktenbroit A, Roberts R. Localization of gene for familial hypertrophic cardiomyopathy to chromosome 14q1 in a diverse U.S. population. Circulation. 1991;83:1592-1597. [Abstract/Free Full Text]
   
5. Watkins H, MacRae C, Thierfelder L, Chou Y, Frenneaux MP, McKenna W, Seidman JG, Seidman CE. A disease locus for familial hypertrophic cardiomyopathy maps to chromosome 1q3. Nat Genet. 1993;3:333-337. [Medline] [Order article via Infotrieve]
   
6. Thierfelder LC, MacRae C, Watkins H, Tomfohrde J, McKenna W, Bom K, Noeske G, Schlepper M, Just J, Bowcock A, Vosberg I, Seidman CE, Seidman JG. A familial hypertrophic cardiomyopathy locus maps to chromosome 15q2. Proc Natl Acad Sci U S A. 1993;90:6270-6274. [Abstract/Free Full Text]
   
7. Thierfelder L, Watkins H, MacRae C, Lamas R, McKenna W, Vosberg H-P, Seidman JG, Seidman CE. -Tropomyosin and cardiac troponin T mutations cause familial hypertrophic cardiomyopathy: a disease of the sarcomere. Cell. 1994;77:701-712. [Medline] [Order article via Infotrieve]
   
8. Roberts R, Marian AJ, Buchinski L. Application of molecular biology to medical genetics. In: Clark EB, Markwald RR, Takao A, eds. Developmental Mechanisms of Heart Disease. Mount Kisco, NY: Futura Press; 1995:87-111.
   
9. Anan R, Greve G, Thierfelder L, Watkins HC, McKenna WJ, Solomon S, Vecchio C, Shono H, Nakao S, Tanaka H, Mares A Jr, Towbin JA, Spirito P, Roberts R, Seidman JG, Seidman CE. Prognostic implications of novel ß cardiac myosin heavy chain gene mutations that cause familial hypertrophic cardiomyopathy. J Clin Invest. 1994;93:280-285.
   
10. Marian AJ, Mares A Jr, Kelly DP, Yu Q-T, Abchee AB, Hill R, Roberts R. Sudden cardiac death in hypertrophic cardiomyopathy: variability in phenotypic expression of beta-myosin heavy chain mutations. Eur Heart J. 1995;16:368-376. [Abstract/Free Full Text]
    
11. Epstein ND, Cohn GM, Cyran F, Fananapazir L. Differences in clinical expression of hypertrophic cardiomyopathy associated with two distinct mutations in the ß-myosin heavy chain gene: a 908^LeuVal mutation and a 403^ArgGln mutation. Circulation. 1992;86:345-352. [Abstract/Free Full Text]
    
12. Solomon SD, Wolff SA, Watkins H, Ridker PM, Come P, McKenna WJ, Seidman CE, Lee RT. Left ventricular hypertrophy and morphology in familial hypertrophic cardiomyopathy associated with mutations of the beta-myosin heavy chain gene. J Am Coll Cardiol. 1993;22:498-505. [Abstract]
    
13. Sadoshima J-I, Izumo S. Molecular characterization of angiotensin II induced hypertrophy of cardiac myocytes and hyperplasia of cardiac fibroblasts: critical role of the AT1 receptor subtype. Circ Res. 1993;73:413-423. [Abstract/Free Full Text]
    
14. Griendling KK, Murphy TJ, Alexander RW. Molecular biology of the renin-angiotensin system. Circulation. 1993;87:1816-1828. [Free Full Text]
    
15. Schunkert H, Jackson B, Tang SS, Schoen FJ, Smits FM, Apstein CS, Lorell BH. Distribution and functional significance of cardiac angiotensin converting enzyme in hypertrophied rat hearts. Circulation. 1993;87:1328-1339. [Abstract/Free Full Text]
    
16. Studer R, Reinecke H, Muller B, Holtz J, Just H, Drexler H. Increased angiotensin-I converting enzyme gene expression in the failing human heart: quantification by competitive RNA polymerase chain reaction. J Clin Invest. 1994;94:301-310.
    
17. Linz W, Schaper J, Wiemer G, Albus U, Scholkens BA. Ramipril prevents left ventricular hypertrophy with myocardial fibrosis without blood pressure reduction: a one year study in rats. Br J Pharmacol. 1992;107:970-975. [Medline] [Order article via Infotrieve]
    
18. Pfeffer MA, Braunwald E, on behalf of SAVE investigators. Effect of captopril on mortality and morbidity in patients with left ventricular dysfunction after myocardial infarction. N Engl J Med. 1992;327:669-677. [Abstract]
    
19. Rigat B, Hubert C, Corvol P, Soubrier F. PCR detection of the insertion/deletion polymorphism of the human angiotensin converting enzyme gene (DCP1) (dipeptidyl carboxypeptidase 1). Nucleic Acids Res. 1992;20:1433. [Free Full Text]
    
20. Rigat B, Hubert C, Alhenc-Gelas F, Cambien F, Corval P, Soubrier F. An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half of the variance of serum enzyme levels. J Clin Invest. 1990;86:1343-1346.
    
21. Marian AJ, Yu Q-T, Workman R, Greve G, Roberts R. Angiotensin converting enzyme polymorphism is associated with hypertrophic cardiomyopathy as well as sudden cardiac death. Lancet. 1993;342:1073-1074. [Medline] [Order article via Infotrieve]
    
22. American Society of Echocardiography Committee on Standards, Subcommittee on Quantitation of Two-Dimensional Echocardiograms: Schiller NB, Shah PM, Crawford M, DeMaria A, Devereux R, Feigenbaum H, Gutgessell H, Reichek N, Sahn D, Schnittger I, Silverman NH, Tajik AJ. Recommendations for quantitation of the left ventricle by two-dimensional echocardiography. J Am Soc Echocardiogr. 1989;2:358-367.[Medline] [Order article via Infotrieve]
    
23. Wigle ED, Sasson Z, Henderson MA, Ruddy TD, Fulop J, Rakowski H, Williams WG. Hypertrophic cardiomyopathy: the importance of the site and extent of hypertrophy: a review. Prog Cardiovasc Dis. 1985;28:1-83. [Medline] [Order article via Infotrieve]
    
24. Rakowski H, Sasson Z, Wigle ED. Echocardiographic and Doppler assessment of hypertrophic cardiomyopathy. J Am Soc Echocardiogr. 1988;1:31-47. [Medline] [Order article via Infotrieve]
    
25. Fogarty DG, Maxwell AP, Doherty CC, Hughes AE, Nevin NC. ACE gene typing. Lancet. 1994;343:851. Letter. [Medline] [Order article via Infotrieve]
    
26. Beohar N, Damaraju S, Prather A, Yu Q-T, Raizner AE, Kleiman NS, Robert R, Marian AJ. Angiotensin converting enzyme genotype DD is a risk factor for coronary artery disease. J Invest Med. 1995;43:275-280. [Medline] [Order article via Infotrieve]
    
27. Schunkert H, Hense H-W, Holmer SR, Stender M, Perz S, Keil U, Lorell BH, Riegger GAJ. Association between a deletion polymorphism of the angiotensin converting-enzyme gene and left ventricular hypertrophy. N Engl J Med. 1994;330:1634-1638. [Abstract/Free Full Text]
    
28. Adams TD, Yanowitz FG, Fisher AG, Ridges JD, Nelson AG, Hagan AD, Williams RR, Hunt SC. Heritability of cardiac size: an echocardiographic and electrocardiographic study of monozygotic and dizygotic twins. Circulation. 1985;71:39-44. [Abstract/Free Full Text]
    
29. Verhaaren HA, Schieken RM, Mosteller M, Hewitt JK, Eaves LJ, Nance WE. Bivariate genetic analysis of left ventricular mass and weight in pubertal twins (the Medical College of Virginia Twin Study). Am J Cardiol. 1991;68:661-668. [Medline] [Order article via Infotrieve]
    
30. Iwai N, Ohimichi N, Nakamura Y, Kinoshita M. DD genotype of the angiotensin-converting enzyme gene is a risk factor for left ventricular hypertrophy. Circulation. 1994;90:2622-2628. [Abstract/Free Full Text]
    
31. Kupari M, Perola M, Koskinen P, Virolainen J, Karhunen PJ. Left ventricular size and mass, and function in relation to angiotensin-converting enzyme gene polymorphism in human. Am J Physiol. 1994;267(3 pt 2):H1107-H1111.
    
32. Levy D, Garrison RJ, Savage DD, Kannel WB, Castelli WP. Prognostic implications of echocardiographically determined left ventricular mass in the Framingham Heart Study. N Engl J Med. 1990;322:1561-1566. [Abstract]
    
33. Bikkina M, Levy D, Evans JC, Larson MG, Benjamin EJ, Wolf PA, Castelli WP. Left ventricular mass and risk of stroke in an elderly cohort: the Framingham Heart Study. JAMA. 1994;272:33-36. [Abstract]
    
34. Spirito P, Maron BJ. Relation between extent of left ventricular hypertrophy and occurrence of sudden cardiac death in hypertrophic cardiomyopathy. J Am Coll Cardiol. 1990;15:1521-1526.[Abstract]
    

This article has been cited by other articles:

				U. H. Frey, W. Lieb, J. Erdmann, D. Savidou, G. Heusch, K. Leineweber, H. Jakob, H.-W. Hense, H. Lowel, N. H. Brockmeyer, et al. Characterization of the GNAQ promoter and association of increased Gq expression with cardiac hypertrophy in humans Eur. Heart J., April 1, 2008; 29(7): 888 - 897. [Abstract] [Full Text] [PDF]

				E. W. Daw, S. N. Chen, G. Czernuszewicz, R. Lombardi, Y. Lu, J. Ma, R. Roberts, S. Shete, and A. J. Marian Genome-wide mapping of modifier chromosomal loci for human hypertrophic cardiomyopathy Hum. Mol. Genet., October 15, 2007; 16(20): 2463 - 2471. [Abstract] [Full Text] [PDF]

				A. Muthumala, H. Montgomery, J. Palmen, J. A. Cooper, and S. E. Humphries Angiotensin-Converting Enzyme Genotype Interacts With Systolic Blood Pressure to Determine Coronary Heart Disease Risk in Healthy Middle-Aged Men Hypertension, August 1, 2007; 50(2): 348 - 353. [Abstract] [Full Text] [PDF]

				J. C. Hueb, S. G. Zanati, K. Okoshi, C. N. Raffin, L. V. de Arruda Silveira, and B. B. Matsubara Association Between Atherosclerotic Aortic Plaques and Left Ventricular Hypertrophy in Patients With Cerebrovascular Events Stroke, April 1, 2006; 37(4): 958 - 962. [Abstract] [Full Text] [PDF]

				M. J. Perkins, S. L. Van Driest, E. G. Ellsworth, M. L. Will, B. J. Gersh, S. R. Ommen, and M. J. Ackerman Gene-specific modifying effects of pro-LVH polymorphisms involving the renin-angiotensin-aldosterone system among 389 unrelated patients with hypertrophic cardiomyopathy Eur. Heart J., November 2, 2005; 26(22): 2457 - 2462. [Abstract] [Full Text] [PDF]

				P. Sipola, K. Lauerma, P. Jaaskelainen, M. Laakso, K. Peuhkurinen, H. Manninen, H. J. Aronen, and J. Kuusisto Cine MR Imaging of Myocardial Contractile Impairment in Patients with Hypertrophic Cardiomyopathy Attributable to Asp175Asn Mutation in the {alpha}-Tropomyosin Gene Radiology, September 1, 2005; 236(3): 815 - 824. [Abstract] [Full Text] [PDF]

				B. J. Maron, W. J. McKenna, G. K. Danielson, L. J. Kappenberger, H. J. Kuhn, C. E. Seidman, P. M. Shah, W. H. Spencer III, P. Spirito, F. J. Ten Cate, et al. American College of Cardiology/European Society of Cardiology Clinical Expert Consensus Document on Hypertrophic Cardiomyopathy: a report of the American College of Cardiology Foundation Task Force on Clinical Expert Consensus Documents and the European Society of Cardiology Committee for Practice Guidelines J. Am. Coll. Cardiol., November 5, 2003; 42(9): 1687 - 1713. [Full Text] [PDF]

				Writing Committee Members, B. J. Maron, W. J. McKenna, G. K. Danielson, L. J. Kappenberger, H. J. Kuhn, C. E. Seidman, P. M. Shah, W. H. Spencer III, P. Spirito, et al. American College of Cardiology/European Society of Cardiology Clinical Expert Consensus Document on Hypertrophic Cardiomyopathy: A report of the American College of Cardiology Foundation Task Force on Clinical Expert Consensus Documents and the European Society of Cardiology Committee for Practice Guidelines Eur. Heart J., November 1, 2003; 24(21): 1965 - 1991. [Full Text] [PDF]

				A Woo, H Rakowski, J C Liew, M-S Zhao, C-C Liew, T G Parker, M Zeller, E D Wigle, and M J Sole Mutations of the {beta} myosin heavy chain gene in hypertrophic cardiomyopathy: critical functional sites determine prognosis Heart, October 1, 2003; 89(10): 1179 - 1185. [Abstract] [Full Text] [PDF]

				E. G. Nabel Cardiovascular Disease N. Engl. J. Med., July 3, 2003; 349(1): 60 - 72. [Full Text] [PDF]

				P. Sipola, E. Vanninen, H. J. Aronen, K. Lauerma, S. Simula, P. Jaaskelainen, M. Laakso, K. Peuhkurinen, J. Kuusisto, and J. T. Kuikka Cardiac Adrenergic Activity Is Associated with Left Ventricular Hypertrophy in Genetically Homogeneous Subjects with Hypertrophic Cardiomyopathy J. Nucl. Med., April 1, 2003; 44(4): 487 - 493. [Abstract] [Full Text] [PDF]

				M. Arad, J.G. Seidman, and C. E. Seidman Phenotypic diversity in hypertrophic cardiomyopathy Hum. Mol. Genet., October 1, 2002; 11(20): 2499 - 2506. [Abstract] [Full Text] [PDF]

				B. J. Maron Hypertrophic Cardiomyopathy: A Systematic Review JAMA, March 13, 2002; 287(10): 1308 - 1320. [Abstract] [Full Text] [PDF]

				J R Ortlepp, H P Vosberg, S Reith, F Ohme, N G Mahon, D Schroder, H G Klues, P Hanrath, and W J McKenna Genetic polymorphisms in the renin-angiotensin-aldosterone system associated with expression of left ventricular hypertrophy in hypertrophic cardiomyopathy: a study of five polymorphic genes in a family with a disease causing mutation in the myosin binding protein C gene Heart, March 1, 2002; 87(3): 270 - 275. [Abstract] [Full Text] [PDF]

				J. Deinum, J. M.G. van Gool, M. J.M. Kofflard, F. J. ten Cate, and A.H. J. Danser Angiotensin II Type 2 Receptors and Cardiac Hypertrophy in Women With Hypertrophic Cardiomyopathy Hypertension, December 1, 2001; 38(6): 1278 - 1281. [Abstract] [Full Text] [PDF]

				A. J. Marian On genetic and phenotypic variability of hypertrophic cardiomyopathy: nature versus nurture J. Am. Coll. Cardiol., August 1, 2001; 38(2): 331 - 334. [Full Text] [PDF]

				J. C. Rodriguez-Perez, F. Rodriguez-Esparragon, O. Hernandez-Perera, A. Anabitarte, A. Losada, A. Medina, E. Hernandez, D. Fiuza, O. Avalos, C. Yunis, et al. Association of angiotensinogen m235t and a(-6)g gene polymorphisms with coronary heart disease with independence of essential hypertension: the procagene study J. Am. Coll. Cardiol., May 1, 2001; 37(6): 1536 - 1542. [Abstract] [Full Text] [PDF]

				N G Mahon, A S Coonar, S Jeffery, F Coccolo, J Akiyu, B Zal, R Houlston, G E Levin, C Baboonian, W J McKenna, et al. Haemochromatosis gene mutations in idiopathic dilated cardiomyopathy Heart, November 1, 2000; 84(5): 541 - 547. [Abstract] [Full Text]

				P. Sorajja, P.M. Elliott, and W.J. Mckenna The molecular genetics of hypertrophic cardiomyopathy: prognostic implications Europace, January 1, 2000; 2(1): 4 - 14. [PDF]

				A. P. R. M. Osterop, M. J. M. Kofflard, L. A. Sandkuijl, F. J. t. Cate, R. Krams, M. A. D. H. Schalekamp, and A. H. J. Danser AT1 Receptor A/C1166 Polymorphism Contributes to Cardiac Hypertrophy in Subjects With Hypertrophic Cardiomyopathy Hypertension, November 1, 1998; 32(5): 825 - 830. [Abstract] [Full Text] [PDF]

				B. J. Maron, J. H. Moller, C. E. Seidman, G. M. Vincent, H. C. Dietz, A. J. Moss, J. A. Towbin, H. M. Sondheimer, R. E. Pyeritz, G. McGee, et al. Impact of Laboratory Molecular Diagnosis on Contemporary Diagnostic Criteria for Genetically Transmitted Cardiovascular Diseases: Hypertrophic Cardiomyopathy, Long-QT Syndrome, and Marfan Syndrome : A Statement for Healthcare Professionals From the Councils on Clinical Cardiology, Cardiovascular Disease in the Young, and Basic Science, American Heart Association Circulation, October 6, 1998; 98(14): 1460 - 1471. [Full Text] [PDF]

				M. Kyriakidis, F. Triposkiadis, J. Dernellis, A. E. Androulakis, P. Mellas, G. A. Kelepeshis, and J. E. Gialafos Effects of Cardiac Versus Circulatory Angiotensin-Converting Enzyme Inhibition on Left Ventricular Diastolic Function and Coronary Blood Flow in Hypertrophic Obstructive Cardiomyopathy Circulation, April 14, 1998; 97(14): 1342 - 1347. [Abstract] [Full Text] [PDF]

				B. Agerholm-Larsen, B. G. Nordestgaard, R. Steffensen, T. I.A. Sorensen, G. Jensen, and A. Tybjærg-Hansen ACE Gene Polymorphism: Ischemic Heart Disease and Longevity in 10 150 Individuals: A Case-Referent and Retrospective Cohort Study Based on the Copenhagen City Heart Study Circulation, May 20, 1997; 95(10): 2358 - 2367. [Abstract] [Full Text]

				A. Busjahn, H. Knoblauch, M. Knoblauch, J. Bohlender, M. Menz, H.-D. Faulhaber, A. Becker, H. Schuster, and F. C. Luft Angiotensin-Converting Enzyme and Angiotensinogen Gene Polymorphisms, Plasma Levels, Cardiac Dimensions A Twin Study: A Twin Study Hypertension, January 1, 1997; 29(1): 165 - 170. [Abstract] [Full Text] [PDF]

This Article Abstract Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed