Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 1996;93:2092-2096

This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Badenhop, R. F.
Right arrow Articles by Wilcken, D. E.L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Badenhop, R. F.
Right arrow Articles by Wilcken, D. E.L.

(Circulation. 1996;93:2092-2096.)
© 1996 American Heart Association, Inc.


Articles

Association Between an Angiotensinogen Microsatellite Marker in Children and Coronary Events in Their Grandparents

Renee F. Badenhop, BSc (Hons); Xing Li Wang, MBBS, PhD; David E.L. Wilcken, MD, FRCP, FRACP

From the Department of Cardiovascular Medicine, University of New South Wales/Prince Henry Hospital, Sydney, Australia.

Correspondence to Prof David Wilcken, Department of Cardiovascular Medicine, Clinical Sciences Bldg, Prince Henry Hospital, Little Bay, NSW 2036, Australia.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background Recently we found that the deletion (D) allele of the insertion/deletion (I/D) polymorphism of the ACE gene in 404 children was associated with a history of coronary artery disease (CAD) in their grandparents. This led us to explore polymorphisms in other genes of the renin-angiotensin system in this same population.

Methods and Results We determined the genotypes for three microsatellite markers located near or in the angiotensinogen, angiotensin II (type-1) receptor, and renin genes in the children and related the allele frequencies to grandparental CAD. We found a significant association between the angiotensinogen marker in children and grandparental CAD ({chi}2=42.2, P=.00001) with these children having an excess of the 125-bp and 129-bp alleles (odds ratio, 2.5; 95% confidence interval, 1.7 to 3.7). Greatest grandparental risk was when their grandchildren had the 125-bp/125-bp, 129-bp/129-bp, or 125-bp/129-bp genotypes (odds ratio, 7.75; 95% confidence interval, 2.2 to 27). There was no association between the microsatellites at either the angiotensin II (type-1) receptor (P=.8) or renin (P=.2) genes in children and grandparental CAD and none between the angiotensinogen and ACE polymorphisms in relation to CAD family history.

Conclusions This study identifies a significant association between an angiotensinogen marker in children and grandparental CAD. There was no association between the microsatellites at either the angiotensin II (type-1) receptor or renin genes and CAD in this population. We conclude that the angiotensinogen polymorphism as well as the ACE polymorphism may explain a part of the risk related to a family history of CAD.


Key Words: angiotensinogen • angiotensin • receptors • renin • coronary disease • genes • genetics


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
A history of premature heart disease in a first-degree relative approximately doubles the risk of an individual developing overt CAD.1 Single gene disorders, eg, familial hypercholesterolemia, are uncommon and only partly explain the incidence, severity, and clustering of CAD in families, and the genetic basis for the association with a positive family history is frequently unclear. However, there is increasing evidence that genes encoding the components of the RAS are candidates that may contribute.

In a recent study we found that the D allele of the I/D polymorphism of the ACE gene in children was associated with CAD in their grandparents.2 Case-control studies also have suggested that the I/D polymorphism of the ACE gene is an important independent risk factor for CAD,3 4 a finding not confirmed in some other studies.5 6 However, the D allele also has been found to be associated with hypertrophic,7 ischemic, and idiopathic dilated cardiomyopathies,8 left ventricular hypertrophy,9 and carotid wall thickening.10 The increasing evidence that the ACE genotype is an independent risk factor for cardiovascular disease led us to explore the other components of the RAS in this same population of school children selected during a study aimed at identifying young high-risk families.

In the RAS, angiotensinogen is cleaved by renin to produce the inactive peptide angiotensin I. The ACE then converts angiotensin I to angiotensin II. Angiotensin II is a potent systemic and local vasoconstrictor that stimulates vascular smooth muscle cell growth and migration, activates monocytes, stimulates the synthesis of plasminogen-activator inhibitor, and may be involved in platelet activation and aggregation.11 The D/D genotype of the ACE gene is associated with increased circulating12 and cellular13 concentrations of ACE, which may result in increased levels of angiotensin II. ACE inhibitors have been shown to reduce recurrent myocardial infarction and mortality and morbidity in patients with ischemic heart disease and congestive cardiac failure.14 15

The plasma concentration of angiotensinogen, the substrate for renin, is another clear determinant of angiotensin II levels. Recently, the M235T polymorphism of the angiotensinogen gene was found to be associated with CAD in New Zealand16 and Japanese17 case-control studies. Increased levels of angiotensinogen have been associated with hypertension, and polymorphisms in the angiotensinogen gene have shown linkage to18 and association with hypertension19 and preeclampsia.20

Cleavage of angiotensinogen by renin is the rate-limiting step in the RAS and is therefore likely to influence the levels of angiotensin II. Increased circulating renin was shown to be associated with increased risk of myocardial infarction in hypertensive patients in one study,21 but this was not confirmed in another.22 However, there are data to show that polymorphisms in the renin gene may be associated with both hypertension23 and family history of hypertension.24 The cellular effects of angiotensin II are mediated by the AT1 receptor,25 which is present in vascular smooth muscle cells and the myocardium.26 Gene variants in the AT1 receptor gene have been found to interact with the ACE genotype to increase the risk of myocardial infarction27 and have been associated with hypertension.28

Because of these findings and the importance of the RAS in cardiovascular regulation, in this present study we investigated the distribution of three informative microsatellite markers in the genes coding for angiotensinogen, the AT1 receptor, and renin in a population of schoolchildren and related the findings to the occurrence of coronary events in their grandparents. In addition, we explored interactions between these microsatellite markers and the ACE genotype (determined previously in this same population) in relation to coronary events in grandparents.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Study Population
We studied 404 unrelated Caucasian school children aged 6 to 13 years (mean age, 9.9 years) from our family-based program for early prevention of CAD.29 The microsatellites at the angiotensinogen, AT1 receptor, and renin genes were determined for 347, 373, and 345 children, respectively, according to sample availability. The number of families with affected grandparents in the children without microsatellite typing was not different proportionally from those included in the study, and there were no siblings in the study. There were approximately equal numbers of boys (53%) and girls (47%). We had complete family histories for the presence or absence of CAD in the children's older family members.

Family History
All information regarding coronary events in parents and grandparents was obtained via a structured questionnaire from the children's parents as described previously.29 The specific questions asked were whether or not there was a history of heart attack, death from CAD, coronary bypass surgery, angioplasty, hypertension, stroke, or diabetes and the age at which any event occurred. We classified parents and grandparents as having had a coronary event if there was a clear history of myocardial infarction, death from CAD, or a history of coronary bypass surgery or angioplasty. We restricted the coronary event questionnaire to these major events to minimize error of classification. We confined the study to the occurrence of events in grandparents only because parents were generally young (mean age of fathers, 41 years; range, 27 to 67 years; of mothers, 39 years; range, 24 to 57 years) and had had too few coronary events for a meaningful statistical analysis. Family history was recorded as the number of grandparents who had had a coronary event. In the total population of 404 children, there were 189 children with no grandparent who had had a coronary event and 215 children with one or more grandparents who had had coronary events (155 with 1 affected grandparent, 44 children with 2 affected grandparents, 14 with 3 affected grandparents, and 2 with all 4 grandparents affected).

Genotyping
We used finger-prick blood samples spotted onto filter paper as the source of DNA. The DNA was extracted as previously described2 and used as a template for PCR amplification of microsatellite markers located in or close to the angiotensinogen, AT1 receptor, and renin genes. The primers and PCR conditions used for the amplification of a microsatellite located 3' of the last exon of the angiotensinogen gene were from the protocol of Kotelevtsev et al.30 The primers and PCR conditions used for the amplification of a microsatellite located in the 3' end of the AT1 receptor gene were from the protocol of Davies et al.31 The primers used for the amplification of a microsatellite located in the renin gene, obtained from the Genethon database,32 were 5'AACCCGAGGTGTCTGTGG 3'and 5'AGGGAACAAAATGTGACCTGTAT 3'. PCR was performed in 25-µL volumes containing 100 ng DNA, 10 pmol/L of each primer, 1.5 mmol/L MgCl2, 200 mmol/L dNTP, 50 mmol/L KCl, 5 mmol/L Tris-HCl, pH 8.3, 0.1% gelatin and 0.5 U Taq polymerase (Advanced Biotechnologies). Samples were subjected to denaturing at 94°C for 3 minutes, 30 cycles of denaturing at 94°C for 1 minute, annealing at 62°C for 1 minute, and extension at 72°C for 2 minutes and a final extension at 72°C for 5 minutes.

Products were visualized on 6% nondenaturing polyacrylamide gels, run for 4.5 hours, with silver staining. Sizes of the PCR products were determined using the CREAM (Kem-En-Tec Software Systems, version 4.1) gel analysis system. There are 11 alleles for the angiotensinogen microsatellite ranging in size from 115 bp to 135 bp, 12 alleles for the AT1 receptor gene microsatellite ranging in size from 133 bp to 155 bp, and 11 alleles for the renin microsatellite ranging in size from 175 bp to 195 bp.

Statistics
We used {chi}2 tests to determine differences in allele frequency of the three microsatellites in different family history, age, and sex groups. We used logistic regression analysis to assess relationships between the three polymorphisms and CAD, and odds ratios were calculated as an estimate of relative risk of family history of CAD associated with each allele. Adjusted odds ratios were calculated to assess possible relationships between family history of CAD, the ACE genotype, and the microsatellite markers for the angiotensinogen, AT1 receptor, and renin genes. Family history was regarded as the dependent variable and the ACE genotype and microsatellite markers as independent variables. Statistical analyses were performed with the SPSS-X statistics software, version IV (SPSS Inc).

Consent
All blood samples were obtained with the informed consent of parents and agreement of the children. The study was approved by the Ethics Committee of the University of New South Wales.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Genetic Characteristics of the Population
The allele frequencies of the microsatellites in the angiotensinogen, AT1 receptor, and renin genes are shown in the TableDown. There were no significant differences in allele frequencies for any of the microsatellites between the sexes (P=.9, P=.9, P=.4, respectively) or with age (P=.9, P=.3, P=.8, respectively).


View this table:
[in this window]
[in a new window]
 
Table 1. Allele Frequencies of the Microsatellites in the Angiotensinogen, Angiotensin II Type 1 Receptor, and Renin Genes in Children (Aged 6 to 13 Years) in Relation to Family History of Coronary Artery Disease in Their Grandparents

Angiotensinogen Allele Frequency and Family History of CAD
There was a significant association between a family history of CAD (one or more affected grandparents) and the microsatellite located 3' of the last exon of the angiotensinogen gene ({chi}2=42.2, P=.00001). As can be seen from the TableUp, in the children with a family history of CAD, there was a significant excess of the 125-bp (P<.01) and 129-bp (P<.01) alleles and a decrease in the 115-bp (P<.01), 117-bp (P<.01), and 119-bp (P=.07) alleles compared with those without a family history of CAD.

Odds ratios were calculated as an estimate of relative risk of a family history of CAD associated with each allele. While there was no risk associated with 115-bp, 117-bp, 119-bp, 121-bp, 123-bp, 127-bp, 131-bp, 133-bp, and 135-bp alleles, there was excess risk associated with both the 125-bp and 129-bp alleles. The odds ratio for the 125-bp allele compared with any other allele (excluding the 129-bp allele) was 2.73 (95% CI, 1.6 to 4.5), and the odds ratio for the 129-bp allele compared with any other allele (excluding the 125-bp allele) was 2.6 (95% CI, 1.5 to 4.2). The odds ratio of either the 125-bp or 129-bp allele compared to any other allele was 2.5 (95% CI, 1.7 to 3.7).

Angiotensinogen Genotype and Family History of CAD
Because of the association between CAD family history and the 125-bp and 129-bp alleles, the relationship between children having genotypes containing these alleles and CAD family history was also investigated. In children having either a 125-bp or 129-bp allele with another allele compared with children with all other genotypes (except 125-bp or 129-bp homozygotes), the odds ratio was 2.1 (95% CI, 1.3 to 3.3). However, in children homozygous for the 125-bp or 129-bp alleles or having a 125-bp/129-bp genotype, the odds ratio is increased to 7.75 (95% CI, 2.2 to 27). In children homozygous for the 125 bp or 129 bp or having the 125-bp/129-bp genotype compared with children having only one of either the 125-bp or 129-bp allele, the odds ratio was 3.7 (95% CI, 1.03 to 13).

AT1 Receptor and Renin Microsatellites and Family History of CAD
There was no association between a family history of CAD and either of the microsatellites at the AT1 receptor (P=.8) and renin (P=.2) genes. As can be seen in the TableUp, there are no differences in the allele frequencies with family history of CAD at either of these loci.

ACE Genotype, Angiotensinogen Microsatellite, and Family History of CAD
Because of the previous association between the ACE genotype and CAD family history in this same population, we investigated the relationship between the ACE genotype, the angiotensinogen microsatellite, and CAD family history using logistic regression analysis. There was no association between the angiotensinogen microsatellite marker and the ACE polymorphism in relation to CAD family history. The adjusted odds ratios for the 125-bp (odds ratio, 2.7; 95% CI, 1.6 to 4.5) and 129-bp alleles (odds ratio, 2.6; 95% CI, 1.5 to 4.2) are not different from the unadjusted.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
This study defines a significant association between the microsatellite marker located 3' of the last exon of the angiotensinogen gene in children (a young population unaffected by "dropout" as the result of early death from vascular disease) and coronary events in their grandparents. In children with grandparents who have had coronary events, there was a significant excess of the 125-bp and 129-bp alleles. The alleles were associated with increased risk of CAD family history in a dose-dependent manner in that the greatest grandparental risk was seen with children homozygous for the 125-bp or the 129-bp alleles. So far as we are aware, these observations have not been reported previously. Since the associations demonstrated are strong and are in second-degree relatives, the findings are consistent with them being of considerable importance in the assessment of cardiovascular risk.

An important consideration of this study is the accuracy of self-reported family history questionnaires. Førde and Thelle33 found 78% agreement between a self-reported history of myocardial infarction in first-degree relatives and the diagnosis from doctors' records, hospital records, and death certificates. There was 86% agreement in a similar recent Australian study.34 In the population of schoolchildren from which the present population was selected, random checking of the questionnaires in 10% of the population by telephone or a second completed questionnaire showed 97% accuracy in reporting, with underreporting of coronary events being more likely than overreporting, as we had previously found.29 In addition, we restricted our questionnaire to information on definitive coronary events (myocardial infarction, coronary bypass surgery, angioplasty, death from CAD) to minimize error. We concluded that the family history information obtained from our population was accurate and that any inaccuracies (largely underreporting) would tend to reduce rather than amplify our risk estimates.

Of course, the angiotensinogen polymorphism in the children cannot make a direct contribution to coronary events in their grandparents. The increase in the frequency of the angiotensinogen 125-bp and 129-bp alleles in children reflects an increase in the 125-bp and 129-bp allele frequency in the grandparents who have CAD. Therefore, grandparents with CAD transmit the 125-bp and 129-bp alleles to their offspring more often than grandparents without CAD. The positive association between the 125-bp and 129-bp alleles in children and CAD in their grandparents is consistent with the angiotensinogen locus being associated with susceptibility to CAD. The cleavage of angiotensinogen is the rate-limiting step in the production of angiotensin II. It has been shown that angiotensin II production is sensitive to small changes in both circulating and local angiotensinogen concentration under normal and pathophysiological conditions.35 36 37 38 Angiotensinogen mRNA is increased in heart tissue in in vivo models of hypertrophy39 and heart failure40 41 and in the media and neointima after vascular injury.42 It is possible that the marker in this study is linked to mutations in or close to the angiotensinogen gene, which modifies expression of the gene. Because there are alleles of the angiotensinogen polymorphism that are underrepresented and overrepresented in children with affected grandparents, there may be both susceptibility and protective angiotensinogen gene variants.

While we found no association between either the AT1 and renin gene polymorphisms in children and CAD in their grandparents, the possibility that these genes could be involved in the pathogenesis of CAD cannot be eliminated. Absence of linkage between the polymorphism and functional variations in the genes could account for a lack of association. The identification of a highly significant association between the angiotensinogen gene and family history of CAD in our study demonstrates that microsatellites may be useful for the detection of relevant associations.

Summary
The present study shows that the microsatellite marker located at the 3' end of the angiotensinogen gene in children is associated with CAD in their grandparents. We found no evidence of an association between either of the polymorphisms at the AT1 and renin genes and family history of CAD in this study. Our results indicate that the angiotensinogen polymorphism, as well as the ACE polymorphism, may explain a part of the risk related to a family history of CAD.


*    Selected Abbreviations and Acronyms
 
AT1 = angiotensin II type 1
CAD = coronary artery disease
CI = confidence interval
D, I/D = deletion, insertion/deletion
PCR = polymerase chain reaction
RAS = renin-angiotensin system


*    Acknowledgments
 
This study was supported by the National Health and Medical Research Council of Australia. We would like to thank Judith Lynch and Michelle Marshall for collection of blood samples and questionnaire information from school children and A.S. Sim and Dr Jun Wang for laboratory assistance.

Received September 13, 1995; revision received December 28, 1995; accepted January 2, 1996.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Sharp SD, Williams RR, Hunt SC, Schumacher MC. Coronary risk factors and the severity of angiographic coronary artery disease in members of high-risk pedigrees. Am Heart J. 1992;123:279-284. [Medline] [Order article via Infotrieve]

2. Badenhop RF, Wang XL, Wilcken DEL. Angiotensin-converting enzyme genotype in children and coronary events in their grandparents. Circulation. 1995;91:1655-1658. [Abstract/Free Full Text]

3. Cambien F, Poirier O, Lecarf L, Evans A, Cambou J-P, Arveiler D, Luc G, Bard J-M, Bara L, Ricard S, Tiret L, Amouyel P, Alhenc-Gelas F, Soubrier F. Deletion polymorphism in the gene for angiotensin-converting enzyme is a potent risk factor for myocardial infarction. Nature. 1992;359:641-644. [Medline] [Order article via Infotrieve]

4. Tiret L, Kee F, Poirier O, Nicaud V, Lecarf L, Evans A, Cambou J-P, Arvieler D, Luc G, Amouyel P, Cambien F. Deletion polymorphism in angiotensin-converting enzyme gene associated with parental history of myocardial infarction. Lancet. 1993;341:991-992. [Medline] [Order article via Infotrieve]

5. Bøhn M, Berge KE, Bakken A, Erikssen J, Berg K. Insertion/deletion (I/D) polymorphism at the locus for angiotensin I-converting enzyme and myocardial infarction. Clin Genet. 1993;44:292-297.[Medline] [Order article via Infotrieve]

6. Lindpainter K, Pfeffer MA, Kreutz R, Stampfer MJ, Grodstein F, LaMotte F, Buring J, Hennekens CH. A prospective study of an angiotensin converting enzyme gene polymorphism and the risk of ischemic heart disease. N Engl J Med. 1995;332:706-711. [Abstract/Free Full Text]

7. Marian AJ, Yu Q-T, Workman R, Greve G, Roberts R. Angiotensin-converting enzyme polymorphism in hypertrophic cardiomyopathy and sudden cardiac death. Lancet. 1993;342:1085-1086. [Medline] [Order article via Infotrieve]

8. Raynolds MV, Bristow MR, Bush EW, Abraham WT, Lowes BD, Zisman LS, Taft CS, Perryman MB. Angiotensin converting enzyme DD genotype in patients with ischaemic and idiopathic dilated cardiomyopathy. Lancet. 1993;342:1073-1075. [Medline] [Order article via Infotrieve]

9. Schunkert H, Hense H-W, Holmer SR, Stender M, Perz S, Keil U, Lorell BH, Riegger GAJ. Association between a deletion polymorphism of the angiotensin-converting-enzyme gene and left ventricular hypertrophy. N Engl J Med. 1994;330:1634-1638. [Abstract/Free Full Text]

10. Bonithon-Kopp C, Ducimetière P, Touboul PJ, Fève J-M, Billaud E, Courbon D, Héraud V. Plasma angiotensin-converting enzyme activity and carotid wall thickening. Circulation. 1994;89:952-954. [Abstract/Free Full Text]

11. Dzau VJ. Cell biology and genetics of angiotensin in cardiovascular disease. J Hypertens. 1994;12(suppl 4):S3-S10.

12. Rigat B, Hubert C, Alhenc-Gelas F, Cambien F, Corvol P, Soubrier F. An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half the variance of serum enzyme levels. J Clin Invest. 1990;86:1343-1346.

13. Costerousse O, Allegrini J, Lopez M, Alhenc-Gelas F. Angiotensin I-converting enzyme in human circulating mononuclear cells: genetic polymorphism of expression in T lymphocytes. Biochem J. 1993;290:33-40.

14. Pfeffer M, Braunwald E, Boye L, the SAVE Investigators. Effect of captopril on mortality and morbidity in patients with left ventricular dysfunction after myocardial infarction. N Engl J Med. 1992;327:669-677. [Abstract]

15. The SOLVD Investigators. Effects of enalapril on mortality and the development of heart failure in asymptomatic patients with reduced left ventricular ejection fractions. N Engl J Med. 1992;327:685-691. [Abstract]

16. Katsuya T, Koike G, Yee TW, Sharpe N, Jackson R, Norton R, Horiuchi M, Pratt RE, Dzau VJ, MacMahon S. Association of angiotensinogen gene T235 variant with increased risk of coronary heart disease. Lancet. 1995;345:1600-1603. [Medline] [Order article via Infotrieve]

17. Ishigami T, Umemura S, Iwamoto T, Tamura K, Hibi K, Yamaguchi S, Nyuui N, Kimura K, Miyaza N, Ishii M. Molecular variant of angiotensinogen gene is associated with coronary atherosclerosis. Circulation. 1995;91:951-954. [Abstract/Free Full Text]

18. Caulfield M, Lavender P, Farrall M, Path MRC, Munroe P, Lawson M, Turner P, Clark AJL. Linkage of the angiotensinogen gene to essential hypertension. N Engl J Med. 1994;330:1629-1633. [Abstract/Free Full Text]

19. Jeunemaitre X, Soubrier F, Kotelevtsev YV, Lifton RP, Williams CS, Charru A, Hunt SC, Hopkins PN, Williams RR, Lalouel J-M, Corvol P. Molecular basis of human hypertension: role of angiotensinogen. Cell. 1992;71:169-180. [Medline] [Order article via Infotrieve]

20. Ward K, Hata A, Jeunemaitre X, Helin C, Nelson L, Namikawa C, Farrington PF, Ogasawara M, Suzumori K, Tomoda S, Berrebi S, Sasaki M, Corvol P, Lifton RP, Lalouel JM. A molecular variant of angiotensinogen associated with preeclampsia. Nat Genet. 1993;4:59-61. [Medline] [Order article via Infotrieve]

21. Alderman MH, Madhavan S, Ooi WL, Cohen H, Sealey JE, Laragh JH. Association of renin-sodium profile with risk of myocardial infarction in patients with hypertension. N Engl J Med. 1991;324:1098-1104. [Abstract]

22. Meade TW, Cooper JA, Peart WS. Plasma renin activity and ischemic heart disease. N Engl J Med. 1993;329:616-619. [Abstract/Free Full Text]

23. Jeunemaitre X, Rigat B, Charru A, Houot AM, Soubrier F, Corvol P. Sib pair analysis of renin gene haplotypes in human essential hypertension. Hum Genet. 1992;88:301-306. [Medline] [Order article via Infotrieve]

24. Okura T, Kitami Y, Hiwada K. Restriction fragment length polymorphisms of human renin gene: association study with a family history of essential hypertension. J Hum Hypertens. 1993;7:457-461. [Medline] [Order article via Infotrieve]

25. Chiu AT, Herblin WF, McCall DE, Ardecky RJ, Carini DJ, Dunica JV, Pease LJ, Wong PC, Wexler RR, Johnson AL, Timmermans PBMWN. Identification of angiotensin II receptor subtypes. Biochem Biophys Res Commun. 1989;165:196-203. [Medline] [Order article via Infotrieve]

26. Paxton WG, Runge M, Horaist C, Cohen C, Alexander RW, Berstein KE. Immunohistochemical localization of rat angiotensin II AT1 receptor. Am J Physiol. 1993;264:F989-F995. [Abstract/Free Full Text]

27. Tiret L, Bonnardeaux A, Poirier O, Ricard S, Marques-Vidal P, Evans A, Arveiler D, Luc G, Kee F, Ducimetière P, Soubrier F, Cambien F. Synergistic effects of angiotensin-converting enzyme and angiotensin-II type 1 receptor gene polymorphisms on risk of myocardial infarction. Lancet. 1994;344:910-913. [Medline] [Order article via Infotrieve]

28. Bonnardeaux A, Davies E, Jeunemaitre X, Féry I, Charru A, Clauser E, Tiret L, Cambien F, Corvol P, Soubrier F. Angiotensin II type 1 receptor gene polymorphisms in human essential hypertension. Hypertension. 1994;24:63-69. [Abstract/Free Full Text]

29. Wilcken DEL, Wang XL, Greenwood J, Lynch J. Lipoprotein (a) and apolipoprotein B and A-1 in children and coronary events in their grandparents. J Pediatr. 1993;123:519-526. [Medline] [Order article via Infotrieve]

30. Kotelevtsev YV, Clauser E, Corvol P, Soubrier F. Dinucleotide repeat polymorphism in the human angiotensinogen gene. Nucleic Acids Res. 1991;19:6978. [Free Full Text]

31. Davies E, Bonnardeaux A, Lathrop GM, Corvol P, Soubrier F. Angiotensin II (type-1) receptor locus: CA repeat polymorphism and genetic mapping. Hum Mol Genet. 1994;3:838. [Free Full Text]

32. Genethon. Nature Genet. 1994;7:254-255.

33. Førde OH, Thelle DS. The Tromsø Heart Study: risk factors for coronary heart disease related to the occurrence of myocardial infarction in first-degree relatives. Am J Epidemiol. 1977;105:192-199. [Abstract/Free Full Text]

34. Silberberg J, Alexander H, Wlodarczyk J, Basta M, Hensley M, Hughes J, Ray C. Accuracy of reported family history of heart disease: the impact of the don't know responses. Aust N Z J Med. 1994;24:386-389. [Medline] [Order article via Infotrieve]

35. Griendling KK, Murphy TJ, Alexander RW. Molecular biology of the renin-angiotensin system. Circulation. 1993;87:1816-1828. [Free Full Text]

36. Lee MA, Bohm M, Paul M, Ganten D. Tissue renin angiotensin systems: their role in cardiovascular disease. Circulation. 1993;87(suppl IV):IV-7-IV-13.

37. Dzau VJ, Re R. Tissue renin angiotensin system in cardiovascular medicine: a paradigm shift? Circulation. 1994;89:493-498. [Free Full Text]

38. Eggena P, Barrett JD. Regulation and functional consequences of angiotensinogen gene expression. J Hypertens. 1992;10:1307-1311. [Medline] [Order article via Infotrieve]

39. Baker KM, Chernin MI, Wixson SK, Aceto JF. Renin-angiotensin system involvement in pressure-overload cardiac hypertrophy in rats. Am J Physiol. 1990;259:H324-H332. [Abstract/Free Full Text]

40. Finckh H, Hellman W, Ganten D. Enhanced cardiac angiotensinogen gene expression and angiotensin converting enzyme activity in tachypacing-induced heart failure in rats. Basic Res Cardiol. 1991;86:303-316. [Medline] [Order article via Infotrieve]

41. Schunkert H, Ingelfinger JR, Hirsch AT. Evidence for tissue-specific activation of renal angiotensinogen mRNA expression in chronic stable experimental heart failure. J Clin Invest. 1992;90:1523-1529.

42. Rakugi H, Jacob HJ, Krieger JE, Ingelfinger JR, Pratt RE. Vascular injury induces angiotensinogen gene expression in media and neomedia. Circulation. 1993;87:283-290.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
S. B. Harrap and S. Petrou
Utility of genetic approaches to common cardiovascular diseases
Am J Physiol Heart Circ Physiol, July 1, 2001; 281(1): H1 - H6.
[Full Text] [PDF]


Home page
ThoraxHome page
Y. Takemoto, M. Sakatani, S. Takami, T. Tachibana, J. Higaki, T. Ogihara, T. Miki, T. Katsuya, T. Tsuchiyama, A. Yoshida, et al.
Association between angiotensin II receptor gene polymorphism and serum angiotensin converting enzyme (SACE) activity in patients with sarcoidosis
Thorax, June 1, 1998; 53(6): 459 - 462.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Badenhop, R. F.
Right arrow Articles by Wilcken, D. E.L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Badenhop, R. F.
Right arrow Articles by Wilcken, D. E.L.