(Circulation. 1996;93:2092-2096.)
© 1996 American Heart Association, Inc.
Articles |
From the Department of Cardiovascular Medicine, University of New South Wales/Prince Henry Hospital, Sydney, Australia.
Correspondence to Prof David Wilcken, Department of Cardiovascular Medicine, Clinical Sciences Bldg, Prince Henry Hospital, Little Bay, NSW 2036, Australia.
| Abstract |
|---|
|
|
|---|
Methods and Results We determined the genotypes for
three microsatellite markers located near or in the
angiotensinogen, angiotensin II (type-1)
receptor, and renin genes in the children and related the allele
frequencies to grandparental CAD. We found a significant association
between the angiotensinogen marker in children and
grandparental CAD (
2=42.2, P=.00001)
with these children having an excess of the 125-bp and 129-bp
alleles (odds ratio, 2.5; 95% confidence interval, 1.7 to 3.7).
Greatest grandparental risk was when their grandchildren had the
125-bp/125-bp, 129-bp/129-bp, or 125-bp/129-bp genotypes (odds
ratio, 7.75; 95% confidence interval, 2.2 to 27). There was no
association between the microsatellites at either the
angiotensin II (type-1) receptor (P=.8) or renin
(P=.2) genes in children and grandparental CAD and none
between the angiotensinogen and ACE polymorphisms in
relation to CAD family history.
Conclusions This study identifies a significant association between an angiotensinogen marker in children and grandparental CAD. There was no association between the microsatellites at either the angiotensin II (type-1) receptor or renin genes and CAD in this population. We conclude that the angiotensinogen polymorphism as well as the ACE polymorphism may explain a part of the risk related to a family history of CAD.
Key Words: angiotensinogen angiotensin receptors renin coronary disease genes genetics
| Introduction |
|---|
|
|
|---|
In a recent study we found that the D allele of the I/D polymorphism of the ACE gene in children was associated with CAD in their grandparents.2 Case-control studies also have suggested that the I/D polymorphism of the ACE gene is an important independent risk factor for CAD,3 4 a finding not confirmed in some other studies.5 6 However, the D allele also has been found to be associated with hypertrophic,7 ischemic, and idiopathic dilated cardiomyopathies,8 left ventricular hypertrophy,9 and carotid wall thickening.10 The increasing evidence that the ACE genotype is an independent risk factor for cardiovascular disease led us to explore the other components of the RAS in this same population of school children selected during a study aimed at identifying young high-risk families.
In the RAS, angiotensinogen is cleaved by renin to produce the inactive peptide angiotensin I. The ACE then converts angiotensin I to angiotensin II. Angiotensin II is a potent systemic and local vasoconstrictor that stimulates vascular smooth muscle cell growth and migration, activates monocytes, stimulates the synthesis of plasminogen-activator inhibitor, and may be involved in platelet activation and aggregation.11 The D/D genotype of the ACE gene is associated with increased circulating12 and cellular13 concentrations of ACE, which may result in increased levels of angiotensin II. ACE inhibitors have been shown to reduce recurrent myocardial infarction and mortality and morbidity in patients with ischemic heart disease and congestive cardiac failure.14 15
The plasma concentration of angiotensinogen, the substrate for renin, is another clear determinant of angiotensin II levels. Recently, the M235T polymorphism of the angiotensinogen gene was found to be associated with CAD in New Zealand16 and Japanese17 case-control studies. Increased levels of angiotensinogen have been associated with hypertension, and polymorphisms in the angiotensinogen gene have shown linkage to18 and association with hypertension19 and preeclampsia.20
Cleavage of angiotensinogen by renin is the rate-limiting step in the RAS and is therefore likely to influence the levels of angiotensin II. Increased circulating renin was shown to be associated with increased risk of myocardial infarction in hypertensive patients in one study,21 but this was not confirmed in another.22 However, there are data to show that polymorphisms in the renin gene may be associated with both hypertension23 and family history of hypertension.24 The cellular effects of angiotensin II are mediated by the AT1 receptor,25 which is present in vascular smooth muscle cells and the myocardium.26 Gene variants in the AT1 receptor gene have been found to interact with the ACE genotype to increase the risk of myocardial infarction27 and have been associated with hypertension.28
Because of these findings and the importance of the RAS in cardiovascular regulation, in this present study we investigated the distribution of three informative microsatellite markers in the genes coding for angiotensinogen, the AT1 receptor, and renin in a population of schoolchildren and related the findings to the occurrence of coronary events in their grandparents. In addition, we explored interactions between these microsatellite markers and the ACE genotype (determined previously in this same population) in relation to coronary events in grandparents.
| Methods |
|---|
|
|
|---|
Family History
All information regarding coronary events in parents and
grandparents was obtained via a structured questionnaire from the
children's parents as described previously.29 The
specific questions asked were whether or not there was a history of
heart attack, death from CAD, coronary bypass surgery,
angioplasty, hypertension, stroke, or diabetes and the age at which any
event occurred. We classified parents and grandparents as having had a
coronary event if there was a clear history of myocardial
infarction, death from CAD, or a history of coronary bypass
surgery or angioplasty. We restricted the coronary event
questionnaire to these major events to minimize error of
classification. We confined the study to the occurrence of events in
grandparents only because parents were generally young (mean age of
fathers, 41 years; range, 27 to 67 years; of mothers, 39 years; range,
24 to 57 years) and had had too few coronary events for a
meaningful statistical analysis. Family history was
recorded as the number of grandparents who had had a
coronary event. In the total population of 404 children, there
were 189 children with no grandparent who had had a coronary
event and 215 children with one or more grandparents who had had
coronary events (155 with 1 affected grandparent, 44 children
with 2 affected grandparents, 14 with 3 affected grandparents, and 2
with all 4 grandparents affected).
Genotyping
We used finger-prick blood samples spotted onto filter paper
as the source of DNA. The DNA was extracted as previously
described2 and used as a template for PCR amplification of
microsatellite markers located in or close to the
angiotensinogen, AT1 receptor, and renin genes.
The primers and PCR conditions used for the amplification of a
microsatellite located 3' of the last exon of the
angiotensinogen gene were from the protocol of Kotelevtsev
et al.30 The primers and PCR conditions used for the
amplification of a microsatellite located in the 3' end of the
AT1 receptor gene were from the protocol of Davies et
al.31 The primers used for the amplification of a
microsatellite located in the renin gene, obtained from the Genethon
database,32 were 5'AACCCGAGGTGTCTGTGG 3'and
5'AGGGAACAAAATGTGACCTGTAT 3'. PCR was performed in 25-µL volumes
containing 100 ng DNA, 10 pmol/L of each primer, 1.5 mmol/L
MgCl2, 200 mmol/L dNTP, 50 mmol/L KCl, 5 mmol/L
Tris-HCl, pH 8.3, 0.1% gelatin and 0.5 U Taq polymerase
(Advanced Biotechnologies). Samples were subjected to denaturing at
94°C for 3 minutes, 30 cycles of denaturing at 94°C for 1 minute,
annealing at 62°C for 1 minute, and extension at 72°C for 2 minutes
and a final extension at 72°C for 5 minutes.
Products were visualized on 6% nondenaturing polyacrylamide gels, run for 4.5 hours, with silver staining. Sizes of the PCR products were determined using the CREAM (Kem-En-Tec Software Systems, version 4.1) gel analysis system. There are 11 alleles for the angiotensinogen microsatellite ranging in size from 115 bp to 135 bp, 12 alleles for the AT1 receptor gene microsatellite ranging in size from 133 bp to 155 bp, and 11 alleles for the renin microsatellite ranging in size from 175 bp to 195 bp.
Statistics
We used
2 tests to determine differences
in allele frequency of the three microsatellites in different
family history, age, and sex groups. We used logistic regression
analysis to assess relationships between the three
polymorphisms and CAD, and odds ratios were calculated as an
estimate of relative risk of family history of CAD associated with each
allele. Adjusted odds ratios were calculated to assess possible
relationships between family history of CAD, the ACE genotype,
and the microsatellite markers for the angiotensinogen,
AT1 receptor, and renin genes. Family history was regarded
as the dependent variable and the ACE genotype and
microsatellite markers as independent variables. Statistical
analyses were performed with the SPSS-X statistics software,
version IV (SPSS Inc).
Consent
All blood samples were obtained with the informed consent of
parents and agreement of the children. The study was approved by the
Ethics Committee of the University of New South Wales.
| Results |
|---|
|
|
|---|
|
Angiotensinogen Allele Frequency and Family History
of CAD
There was a significant association between a family history of
CAD (one or more affected grandparents) and the microsatellite located
3' of the last exon of the angiotensinogen gene
(
2=42.2, P=.00001). As can be seen
from the Table
, in the children with a family history of CAD, there was
a significant excess of the 125-bp (P<.01) and 129-bp
(P<.01) alleles and a decrease in the 115-bp
(P<.01), 117-bp (P<.01), and 119-bp
(P=.07) alleles compared with those without a family
history of CAD.
Odds ratios were calculated as an estimate of relative risk of a family history of CAD associated with each allele. While there was no risk associated with 115-bp, 117-bp, 119-bp, 121-bp, 123-bp, 127-bp, 131-bp, 133-bp, and 135-bp alleles, there was excess risk associated with both the 125-bp and 129-bp alleles. The odds ratio for the 125-bp allele compared with any other allele (excluding the 129-bp allele) was 2.73 (95% CI, 1.6 to 4.5), and the odds ratio for the 129-bp allele compared with any other allele (excluding the 125-bp allele) was 2.6 (95% CI, 1.5 to 4.2). The odds ratio of either the 125-bp or 129-bp allele compared to any other allele was 2.5 (95% CI, 1.7 to 3.7).
Angiotensinogen Genotype and Family History
of CAD
Because of the association between CAD family history and the
125-bp and 129-bp alleles, the relationship between children having
genotypes containing these alleles and CAD family history
was also investigated. In children having either a 125-bp or 129-bp
allele with another allele compared with children with all
other genotypes (except 125-bp or 129-bp homozygotes), the odds
ratio was 2.1 (95% CI, 1.3 to 3.3). However, in children homozygous
for the 125-bp or 129-bp alleles or having a 125-bp/129-bp
genotype, the odds ratio is increased to 7.75 (95% CI, 2.2 to
27). In children homozygous for the 125 bp or 129 bp or having the
125-bp/129-bp genotype compared with children having only one
of either the 125-bp or 129-bp allele, the odds ratio was 3.7 (95%
CI, 1.03 to 13).
AT1 Receptor and Renin Microsatellites and Family
History of CAD
There was no association between a family history of CAD and
either of the microsatellites at the AT1 receptor
(P=.8) and renin (P=.2) genes. As can be seen in
the Table
, there are no differences in the allele frequencies with
family history of CAD at either of these loci.
ACE Genotype, Angiotensinogen Microsatellite,
and Family History of CAD
Because of the previous association between the ACE
genotype and CAD family history in this same population, we
investigated the relationship between the ACE genotype, the
angiotensinogen microsatellite, and CAD family history
using logistic regression analysis. There was no association
between the angiotensinogen microsatellite marker and the
ACE polymorphism in relation to CAD family history. The adjusted
odds ratios for the 125-bp (odds ratio, 2.7; 95% CI, 1.6 to 4.5) and
129-bp alleles (odds ratio, 2.6; 95% CI, 1.5 to 4.2) are not
different from the unadjusted.
| Discussion |
|---|
|
|
|---|
An important consideration of this study is the accuracy of self-reported family history questionnaires. Førde and Thelle33 found 78% agreement between a self-reported history of myocardial infarction in first-degree relatives and the diagnosis from doctors' records, hospital records, and death certificates. There was 86% agreement in a similar recent Australian study.34 In the population of schoolchildren from which the present population was selected, random checking of the questionnaires in 10% of the population by telephone or a second completed questionnaire showed 97% accuracy in reporting, with underreporting of coronary events being more likely than overreporting, as we had previously found.29 In addition, we restricted our questionnaire to information on definitive coronary events (myocardial infarction, coronary bypass surgery, angioplasty, death from CAD) to minimize error. We concluded that the family history information obtained from our population was accurate and that any inaccuracies (largely underreporting) would tend to reduce rather than amplify our risk estimates.
Of course, the angiotensinogen polymorphism in the children cannot make a direct contribution to coronary events in their grandparents. The increase in the frequency of the angiotensinogen 125-bp and 129-bp alleles in children reflects an increase in the 125-bp and 129-bp allele frequency in the grandparents who have CAD. Therefore, grandparents with CAD transmit the 125-bp and 129-bp alleles to their offspring more often than grandparents without CAD. The positive association between the 125-bp and 129-bp alleles in children and CAD in their grandparents is consistent with the angiotensinogen locus being associated with susceptibility to CAD. The cleavage of angiotensinogen is the rate-limiting step in the production of angiotensin II. It has been shown that angiotensin II production is sensitive to small changes in both circulating and local angiotensinogen concentration under normal and pathophysiological conditions.35 36 37 38 Angiotensinogen mRNA is increased in heart tissue in in vivo models of hypertrophy39 and heart failure40 41 and in the media and neointima after vascular injury.42 It is possible that the marker in this study is linked to mutations in or close to the angiotensinogen gene, which modifies expression of the gene. Because there are alleles of the angiotensinogen polymorphism that are underrepresented and overrepresented in children with affected grandparents, there may be both susceptibility and protective angiotensinogen gene variants.
While we found no association between either the AT1 and renin gene polymorphisms in children and CAD in their grandparents, the possibility that these genes could be involved in the pathogenesis of CAD cannot be eliminated. Absence of linkage between the polymorphism and functional variations in the genes could account for a lack of association. The identification of a highly significant association between the angiotensinogen gene and family history of CAD in our study demonstrates that microsatellites may be useful for the detection of relevant associations.
Summary
The present study shows that the microsatellite marker located
at the 3' end of the angiotensinogen gene in children is
associated with CAD in their grandparents. We found no evidence of an
association between either of the polymorphisms at the
AT1 and renin genes and family history of CAD in this
study. Our results indicate that the angiotensinogen
polymorphism, as well as the ACE polymorphism, may explain a
part of the risk related to a family history of CAD.
| Selected Abbreviations and Acronyms |
|---|
|
| Acknowledgments |
|---|
Received September 13, 1995; revision received December 28, 1995; accepted January 2, 1996.
| References |
|---|
|
|
|---|
2.
Badenhop RF, Wang XL, Wilcken DEL.
Angiotensin-converting enzyme genotype in
children and coronary events in their grandparents.
Circulation. 1995;91:1655-1658.
3. Cambien F, Poirier O, Lecarf L, Evans A, Cambou J-P, Arveiler D, Luc G, Bard J-M, Bara L, Ricard S, Tiret L, Amouyel P, Alhenc-Gelas F, Soubrier F. Deletion polymorphism in the gene for angiotensin-converting enzyme is a potent risk factor for myocardial infarction. Nature. 1992;359:641-644. [Medline] [Order article via Infotrieve]
4. Tiret L, Kee F, Poirier O, Nicaud V, Lecarf L, Evans A, Cambou J-P, Arvieler D, Luc G, Amouyel P, Cambien F. Deletion polymorphism in angiotensin-converting enzyme gene associated with parental history of myocardial infarction. Lancet. 1993;341:991-992. [Medline] [Order article via Infotrieve]
5. Bøhn M, Berge KE, Bakken A, Erikssen J, Berg K. Insertion/deletion (I/D) polymorphism at the locus for angiotensin I-converting enzyme and myocardial infarction. Clin Genet. 1993;44:292-297.[Medline] [Order article via Infotrieve]
6.
Lindpainter K, Pfeffer MA, Kreutz R, Stampfer MJ,
Grodstein F, LaMotte F, Buring J, Hennekens CH. A prospective
study of an angiotensin converting enzyme gene
polymorphism and the risk of ischemic heart
disease. N Engl J Med. 1995;332:706-711.
7. Marian AJ, Yu Q-T, Workman R, Greve G, Roberts R. Angiotensin-converting enzyme polymorphism in hypertrophic cardiomyopathy and sudden cardiac death. Lancet. 1993;342:1085-1086. [Medline] [Order article via Infotrieve]
8. Raynolds MV, Bristow MR, Bush EW, Abraham WT, Lowes BD, Zisman LS, Taft CS, Perryman MB. Angiotensin converting enzyme DD genotype in patients with ischaemic and idiopathic dilated cardiomyopathy. Lancet. 1993;342:1073-1075. [Medline] [Order article via Infotrieve]
9.
Schunkert H, Hense H-W, Holmer SR, Stender M, Perz S,
Keil U, Lorell BH, Riegger GAJ. Association between a deletion
polymorphism of the
angiotensin-converting-enzyme gene and left
ventricular hypertrophy. N
Engl J Med. 1994;330:1634-1638.
10.
Bonithon-Kopp C, Ducimetière P, Touboul PJ,
Fève J-M, Billaud E, Courbon D, Héraud V. Plasma
angiotensin-converting enzyme activity and carotid wall
thickening. Circulation. 1994;89:952-954.
11. Dzau VJ. Cell biology and genetics of angiotensin in cardiovascular disease. J Hypertens. 1994;12(suppl 4):S3-S10.
12. Rigat B, Hubert C, Alhenc-Gelas F, Cambien F, Corvol P, Soubrier F. An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half the variance of serum enzyme levels. J Clin Invest. 1990;86:1343-1346.
13. Costerousse O, Allegrini J, Lopez M, Alhenc-Gelas F. Angiotensin I-converting enzyme in human circulating mononuclear cells: genetic polymorphism of expression in T lymphocytes. Biochem J. 1993;290:33-40.
14. Pfeffer M, Braunwald E, Boye L, the SAVE Investigators. Effect of captopril on mortality and morbidity in patients with left ventricular dysfunction after myocardial infarction. N Engl J Med. 1992;327:669-677. [Abstract]
15. The SOLVD Investigators. Effects of enalapril on mortality and the development of heart failure in asymptomatic patients with reduced left ventricular ejection fractions. N Engl J Med. 1992;327:685-691. [Abstract]
16. Katsuya T, Koike G, Yee TW, Sharpe N, Jackson R, Norton R, Horiuchi M, Pratt RE, Dzau VJ, MacMahon S. Association of angiotensinogen gene T235 variant with increased risk of coronary heart disease. Lancet. 1995;345:1600-1603. [Medline] [Order article via Infotrieve]
17.
Ishigami T, Umemura S, Iwamoto T, Tamura K, Hibi K,
Yamaguchi S, Nyuui N, Kimura K, Miyaza N, Ishii M. Molecular
variant of angiotensinogen gene is associated with
coronary atherosclerosis.
Circulation. 1995;91:951-954.
18.
Caulfield M, Lavender P, Farrall M, Path MRC, Munroe P,
Lawson M, Turner P, Clark AJL. Linkage of the
angiotensinogen gene to essential hypertension.
N Engl J Med. 1994;330:1629-1633.
19. Jeunemaitre X, Soubrier F, Kotelevtsev YV, Lifton RP, Williams CS, Charru A, Hunt SC, Hopkins PN, Williams RR, Lalouel J-M, Corvol P. Molecular basis of human hypertension: role of angiotensinogen. Cell. 1992;71:169-180. [Medline] [Order article via Infotrieve]
20. Ward K, Hata A, Jeunemaitre X, Helin C, Nelson L, Namikawa C, Farrington PF, Ogasawara M, Suzumori K, Tomoda S, Berrebi S, Sasaki M, Corvol P, Lifton RP, Lalouel JM. A molecular variant of angiotensinogen associated with preeclampsia. Nat Genet. 1993;4:59-61. [Medline] [Order article via Infotrieve]
21. Alderman MH, Madhavan S, Ooi WL, Cohen H, Sealey JE, Laragh JH. Association of renin-sodium profile with risk of myocardial infarction in patients with hypertension. N Engl J Med. 1991;324:1098-1104. [Abstract]
22.
Meade TW, Cooper JA, Peart WS. Plasma renin
activity and ischemic heart disease. N
Engl J Med. 1993;329:616-619.
23. Jeunemaitre X, Rigat B, Charru A, Houot AM, Soubrier F, Corvol P. Sib pair analysis of renin gene haplotypes in human essential hypertension. Hum Genet. 1992;88:301-306. [Medline] [Order article via Infotrieve]
24. Okura T, Kitami Y, Hiwada K. Restriction fragment length polymorphisms of human renin gene: association study with a family history of essential hypertension. J Hum Hypertens. 1993;7:457-461. [Medline] [Order article via Infotrieve]
25. Chiu AT, Herblin WF, McCall DE, Ardecky RJ, Carini DJ, Dunica JV, Pease LJ, Wong PC, Wexler RR, Johnson AL, Timmermans PBMWN. Identification of angiotensin II receptor subtypes. Biochem Biophys Res Commun. 1989;165:196-203. [Medline] [Order article via Infotrieve]
26.
Paxton WG, Runge M, Horaist C, Cohen C, Alexander RW,
Berstein KE. Immunohistochemical localization of rat
angiotensin II AT1 receptor. Am J
Physiol. 1993;264:F989-F995.
27. Tiret L, Bonnardeaux A, Poirier O, Ricard S, Marques-Vidal P, Evans A, Arveiler D, Luc G, Kee F, Ducimetière P, Soubrier F, Cambien F. Synergistic effects of angiotensin-converting enzyme and angiotensin-II type 1 receptor gene polymorphisms on risk of myocardial infarction. Lancet. 1994;344:910-913. [Medline] [Order article via Infotrieve]
28.
Bonnardeaux A, Davies E, Jeunemaitre X, Féry I,
Charru A, Clauser E, Tiret L, Cambien F, Corvol P, Soubrier F.
Angiotensin II type 1 receptor gene polymorphisms in
human essential hypertension.
Hypertension. 1994;24:63-69.
29. Wilcken DEL, Wang XL, Greenwood J, Lynch J. Lipoprotein (a) and apolipoprotein B and A-1 in children and coronary events in their grandparents. J Pediatr. 1993;123:519-526. [Medline] [Order article via Infotrieve]
30.
Kotelevtsev YV, Clauser E, Corvol P, Soubrier F.
Dinucleotide repeat polymorphism in the human
angiotensinogen gene. Nucleic Acids Res. 1991;19:6978.
31.
Davies E, Bonnardeaux A, Lathrop GM, Corvol P, Soubrier
F. Angiotensin II (type-1) receptor locus: CA repeat
polymorphism and genetic mapping. Hum Mol Genet. 1994;3:838.
32. Genethon. Nature Genet. 1994;7:254-255.
33.
Førde OH, Thelle DS. The Tromsø Heart Study:
risk factors for coronary heart disease related to the
occurrence of myocardial infarction in first-degree
relatives. Am J Epidemiol. 1977;105:192-199.
34. Silberberg J, Alexander H, Wlodarczyk J, Basta M, Hensley M, Hughes J, Ray C. Accuracy of reported family history of heart disease: the impact of the don't know responses. Aust N Z J Med. 1994;24:386-389. [Medline] [Order article via Infotrieve]
35.
Griendling KK, Murphy TJ, Alexander RW.
Molecular biology of the renin-angiotensin
system. Circulation. 1993;87:1816-1828.
36. Lee MA, Bohm M, Paul M, Ganten D. Tissue renin angiotensin systems: their role in cardiovascular disease. Circulation. 1993;87(suppl IV):IV-7-IV-13.
37.
Dzau VJ, Re R. Tissue renin
angiotensin system in cardiovascular
medicine: a paradigm shift? Circulation. 1994;89:493-498.
38. Eggena P, Barrett JD. Regulation and functional consequences of angiotensinogen gene expression. J Hypertens. 1992;10:1307-1311. [Medline] [Order article via Infotrieve]
39.
Baker KM, Chernin MI, Wixson SK, Aceto JF.
Renin-angiotensin system involvement in
pressure-overload cardiac hypertrophy in rats.
Am J Physiol. 1990;259:H324-H332.
40. Finckh H, Hellman W, Ganten D. Enhanced cardiac angiotensinogen gene expression and angiotensin converting enzyme activity in tachypacing-induced heart failure in rats. Basic Res Cardiol. 1991;86:303-316. [Medline] [Order article via Infotrieve]
41. Schunkert H, Ingelfinger JR, Hirsch AT. Evidence for tissue-specific activation of renal angiotensinogen mRNA expression in chronic stable experimental heart failure. J Clin Invest. 1992;90:1523-1529.
42.
Rakugi H, Jacob HJ, Krieger JE, Ingelfinger JR, Pratt
RE. Vascular injury induces angiotensinogen gene
expression in media and neomedia.
Circulation. 1993;87:283-290.
This article has been cited by other articles:
![]() |
S. B. Harrap and S. Petrou Utility of genetic approaches to common cardiovascular diseases Am J Physiol Heart Circ Physiol, July 1, 2001; 281(1): H1 - H6. [Full Text] [PDF] |
||||
![]() |
Y. Takemoto, M. Sakatani, S. Takami, T. Tachibana, J. Higaki, T. Ogihara, T. Miki, T. Katsuya, T. Tsuchiyama, A. Yoshida, et al. Association between angiotensin II receptor gene polymorphism and serum angiotensin converting enzyme (SACE) activity in patients with sarcoidosis Thorax, June 1, 1998; 53(6): 459 - 462. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1996 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |