Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 1996;93:1493-1495

This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vincenti, V.
Right arrow Articles by Persico, M. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vincenti, V.
Right arrow Articles by Persico, M. G.
Right arrowPubmed/NCBI databases
*OMIM
*Substance via MeSH

(Circulation. 1996;93:1493-1495.)
© 1996 American Heart Association, Inc.


Articles

Assignment of the Vascular Endothelial Growth Factor Gene to Human Chromosome 6p21.3

Valeria Vincenti, MS; Caterina Cassano, MS; Mariano Rocchi, PhD; M. Graziella Persico, PhD

From the International Institute of Genetics and Biophysics, CNR, Naples (V.V., M.G.P.), and the Istituto di Genetica, Bari (C.C., M.R.), Italy.

Correspondence to M. Graziella Persico, International Institute of Genetics and Biophysics, CNR, Via Guglielmo Marconi 12, 80125 Naples, Italy.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background Vascular endothelial growth factor (VEGF) is an endothelial cell–specific growth factor and a regulator of physiological and pathological angiogenesis. Four different proteins are produced by alternative splicing of a unique transcript generated from a single-copy gene. Knowledge of the chromosomal location of the VEGF gene would help in determining a linkage to any known human congenital syndrome and/or to known chromosomal rearrangements in tumors.

Methods and Results A human chromosome mapping panel was used to assign the VEGF gene to human chromosomes by polymerase chain reaction using VEGF-specific oligonucleotide primers. Amplified DNA fragments were fractionated on a 1% agarose gel. A single band of the expected size was obtained only from the DNA of those hybrid cell lines that contained the human chromosome 6. Three YAC clones containing the VEGF gene were obtained by screening the ICI Diagnostics library. In situ hybridization was then used to locate the VEGF gene in the 6p21.3 region.

Conclusions The location of the VEGF gene in the 6p21.3 region is a potential starting point for a linkage study. In addition, the isolation of YAC clones containing the VEGF gene will contribute to the construction of the physical map of this chromosomal region.


Key Words: angiogenesis • growth substances • genes


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Vascular endothelial growth factor (VEGF) is a growth factor for endothelial cells in vitro; it elicited an angiogenic response in several in vivo assays.1 2 In addition, VEGF is able to increase the permeability of capillary vessels to different macromolecules. VEGF consists of a family of polypeptide isoforms, generated from a single-copy gene by alternative splicing of the primary transcript.3 VEGF is secreted by intact cells as a dimer of the four isoforms of 121, 165, 189, and 206 amino acids. All forms, except homodimeric VEGF121, can bind heparin in vitro and bind heparan derivatives of the extracellular matrix in vivo. VEGF produced from several cell types binds to the two endothelial cell–specific receptors Flt-1 and Flk-1/KDR.4 5 VEGF mRNA is expressed in a variety of normal adult tissues and during embryonic development, as well as in many tumors. VEGF mRNA expression is upregulated by oxygen deprivation in vitro in several cell types as well as by ischemia in vivo.6 Intravenous administration of VEGF results in enhanced collateral vessel formation in the rabbit ischemic hind limb.7 8


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Polymerase Chain Reaction Amplification Analysis and Chromosomal Mapping Panel
The hamsterxhuman hybrid cell lines were characterized for their human chromosome content.9 Oligonucleotide primers (sense, GTGGTGAAGTTCATGGATGTCTA; antisense, TTGGTGAGGTTTGATCCGCATAA) were chosen from the published VEGF genomic sequence to amplify a 1119-bp portion of the human VEGF gene.3 Three hundred nanograms of DNA from each cell line was amplified in 25 µL of 50 mmol/L KCl, 1.5 mmol/L MgCl2, 10 mmol/L Tris-HCl (pH 8.5), 20 µg/mL gelatin, 0.2 mmol/L each dNTP, 0.2 µmol/L each oligonucleotide, and 0.5 units Ampli-Taq polymerase (Perkin-Elmer Cetus). Reactions were performed for 35 rounds of amplification as follows: 45 seconds at 94°C for denaturation, 40 seconds at 60°C for annealing, and 2 minutes at 72°C for extension. Amplified DNA fragments were fractionated on a 1% agarose gel in TBE (53 mmol/L Tris-base, 53 mmol/L boric acid, 1.2 mmol/L EDTA). DNA was then transferred onto nylon Hybond-N membranes (Amersham Inc) according to the manufacturer's instructions. Hybridization reactions were performed at 65°C as previously described.9 The VEGF probe corresponding to a 0.6-kb EcoRI-BamHI cDNA fragment spanning the entire human VEGF121 isoform was provided by Dr H. Weich, Braunschweig, Germany.

YAC Isolation and Fluorescent In Situ Hybridization Analysis
A human YAC library was screened to isolate VEGF-specific clones. The ICI library10 was screened at the YAC screening center DIBIT-HSR, Milan, Italy, by polymerase chain reaction analysis using the primers described above. Human metaphase chromosome preparations, probe labeling, and in situ hybridization were performed as previously described.11


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Chromosome Mapping With Somatic Cell Hybrid Panel
A human chromosome mapping panel was used to assign the VEGF gene to human chromosome 6. A human VEGF-specific fragment was amplified from 300 ng of cell hybrid DNA template. A single band of the expected size (1119 bp) was obtained only from the DNA of the hybrid cell lines containing chromosome 6 (TableDown). Southern blot hybridization of the polymerase chain reaction products with a VEGF-specific probe confirmed the identity of the reaction product (data not shown).


View this table:
[in this window]
[in a new window]
 
Table 1. Segregation of VEGF Sequence in HumanxHamster Hybrids

In situ hybridization was used to determine regional location of the VEGF gene. Three independent YAC clones (10CC7, 9DE2, and 28FD11) containing the VEGF gene were obtained by screening of the ICI library.10 Metaphase chromosome spreads were prepared from phytohemagglutinin-stimulated whole blood by standard techniques. Total DNA from YAC clones 10CC7 and 28FD11 was labeled with biotin-16-dUTP by nick translation. A probe concentration of 5 ng/mL was used, with 300 ng of human Cot-1 competitor DNA/µL. Hybridization to all four chromatids in the 6p21.3 region was observed in all 10 metaphase spreads that were analyzed for each YAC probe used.

The FigureDown shows a typical hybridization of the YAC clone 28FD11 to the 6p21.3 region of both chromatids of both chromosomes.



View larger version (48K):
[in this window]
[in a new window]
 
Figure 1. Fluorescent in situ hybridization of the YAC clone 28FD11 on metaphase chromosomes showing specific hybridization to chromosome 6p. Metaphase chromosome spreads were prepared from phytohemagglutinin-stimulated whole blood by standard techniques.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
The VEGF primary protein sequence shares homology with another angiogenic factor, placenta growth factor (PlGF).9 12 Both VEGF and PlGF contain the eight-cysteine-residue motif characteristic of platelet-derived growth factor. These factors are active as homodimers PlGF/PlGF and VEGF/VEGF and heterodimers PlGF/VEGF. The VEGF homodimer binds to both Flt-1 and KDR/Flk-1 receptors.4 5 The PlGF homodimer binds only to the Flt-1 receptor.5 It has been hypothesized that the two receptors also could form heterodimers and homodimers.12 Presumably, the three protein forms could bind with different affinity to the three endothelium-specific receptor isoforms, thereby eliciting specific signal transduction cascades. Mutations in the polypeptide chain could impair either dimer formation or binding to the receptor.

Flt-1 and Flk-1/KDR deficiencies cause in utero death of mouse embryos between 8.5 and 9.5 days postcoitum.13 14 The analysis of homozygous Flk-1/KDR null mutant embryos reveals a defect in the development of hemopoietic and endothelial cells.13 Organized blood vessels are not observed either in the embryo or in the yolk sac, and hemopoietic progenitors are severely reduced. These results suggest that Flk-1/KDR is essential for yolk sac blood-island formation and vasculogenesis in the mouse embryo.13 Mouse embryos homozygous for a targeted mutation in the Flt-1 locus produced endothelial cells in both extraembryonic regions but assembled these cells into abnormal vascular channels; such embryos died in utero at midsomite stages.14 These data suggest that the Flt-1 signaling pathway may regulate normal endothelial cell-cell or cell-matrix interaction during vascular development.14

The human VEGF gene was mapped to determine whether associated mutations could possibly correspond to any known human congenital syndrome and/or to known chromosomal rearrangements in tumors.

Several diseases whose genetic defect is unknown have been mapped to the human 6p21.3 band.15 Among these, we draw attention to the atrial septal defect secundum type and hemocromatosis. Both Flt-1 and KDR/Flk-1 receptor genes have recently been mapped on chromosomes 4 and 13, respectively.16 17 We have mapped the mouse Plgf gene to chromosome 12, one cM from D12Mit5, and the human PlGF gene to 14q24 using both FISH and genetic crosses. The comparative analysis of the phenotypes of transgenic mice and mapping of human disease genes could help in understanding the role of these growth factors and their receptors in normal and pathological angiogenesis.


*    Acknowledgments
 
This work was supported by grants from the Associazione Italiana Ricerca sul Cancro (AIRC), Progetto Finalizzato "Applicazioni Cliniche della Ricerca Oncologica"; the CNR; and the Ministero della Sanità, Istituto Superiore di Sanità "Progetto A.I.D.S. 1994-Roma-Italia" to Dr Persico and in part by grants from the AIRC and Telethon Program to Dr Rocchi.

Received January 9, 1996; revision received January 31, 1996; accepted February 1, 1996.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Keck PJ, Hauser SD, Krivi G, Sanzo K, Warren T, Feder J, Connolly DT. Vascular permeability factor, an endothelial cell mitogen related to PDGF. Science. 1989;246:1309-1312. [Abstract/Free Full Text]

2. Leung DW, Cachianes G, Kuang W, Goeddel DV, Ferrara N. Vascular endothelial growth factor is a secreted angiogenic mitogen. Science. 1989;246:1306-1309. [Abstract/Free Full Text]

3. Tischer E, Mitchell R, Hartman T, Silva M, Gospodarowicz D, Fiddes JC, Abraham JA. The human gene for vascular endothelial growth factor. J Biol Chem. 1991;266:11947-11954. [Abstract/Free Full Text]

4. De Vries C, Escobedo JA, Ueno H, Houck K, Ferrara N, Williams LT. The fms-like tyrosine kinase, a receptor for vascular endothelial growth factor. Science. 1992;255:989-991. [Abstract/Free Full Text]

5. Terman BI, Khandke L, Dougher-Vermazan M, Maglione D, Lassam NJ, Gospodarowicz D, Persico MG, Böhlen P, Eisinger MG. VEGF receptor subtypes KDR and FLT1 show different sensitivities to heparin and placenta growth factor. Growth Factors. 1994;11:187-195. [Medline] [Order article via Infotrieve]

6. Hashimoto E, Ogita T, Nakaoka T, Matsuoka R, Takao A, Kira Y. Rapid induction of vascular endothelial growth factor expression by transient ischemia in rat heart. Am J Physiol. 1994;267:1948-1954.

7. Takeshita S, Zheng LP, Brogi E, Kearney M, Pu L-Q, Bunting S, Ferrara N, Symes JF, Isner JM. Therapeutic angiogenesis: a single intraarterial bolus of vascular endothelial growth factor augments revascularization in a rabbit ischemic hind limb model. J Clin Invest. 1994;93:662-670.

8. Callow AD, Choi ET, Trachtenberg JD, Stevens SL, Connolly DT, Rodi C, Ryan U. Vascular permeability factor accelerates endothelial regrowth following balloon angioplasty. Growth Factors. 1994;10:223-228. [Medline] [Order article via Infotrieve]

9. Maglione D, Guerriero V, Viglietto G, Ferraro MG, Aprelikova O, Alitalo K, Del Vecchio S, Lei K-J, Chou JY, Persico MG. Two alternative mRNAs coding for the angiogenic factor, placenta growth factor (PlGF), are transcribed from a single gene of chromosome 14. Oncogene. 1993;8:925-931. [Medline] [Order article via Infotrieve]

10. Anand R, Villasante A, Tyler-Smith C. Construction of yeast artificial libraries with large inserts using fractionation by pulsed-field gel electrophoresis. Nucleic Acids Res. 1989;17:3425-3433. [Abstract/Free Full Text]

11. DiPalma T, Tucci M, Russo G, Maglione D, Lago CT, Romano A, Saccone S, DellaValle G, De Gregorio L, Dragani TA, Viglietto G, Persico MG. The placenta growth factor gene of the mouse. Mamm Genome. In press.

12. Maglione D, Guerriero V, Viglietto G, Delli-Bovi P, Persico MG. Isolation of human placenta cDNA coding for a protein related to the vascular permeability factor. Proc Natl Acad Sci U S A. 1991;88:9267-9271. [Abstract/Free Full Text]

13. Shalaby F, Rossant J, Yamaguchi TP, Gertsenstein M, Wu X-F, Breltman ML, Schuh AC. Failure of blood-island formation and vasculogenesis in Flk-1-deficient mice. Nature. 1995;376:62-66. [Medline] [Order article via Infotrieve]

14. Fong G-H, Rossant J, Gertsenstein M, Breltman ML. Role of the Flt-1 receptor tyrosine kinase in regulating the assembly of vascular endothelium. Nature. 1995;376:66-70. [Medline] [Order article via Infotrieve]

15. Volz A, Boyle JM, Cann HM, Cottingham RW, Orr HT, Ziegler A. Report of the Second International Workshop on Human Chromosome 6. Genomics. 1994;21:464-472.[Medline] [Order article via Infotrieve]

16. Spritz RA, Strunk KM, Lee ST, Lu-Kuo JM, Ward DC, Le Paslier D, Altherr MR, Dorman TE, Moir DT. A YAC contig spanning a cluster of human type III receptor protein tyrosine kinase genes (PDGFRA-KIT-KDR) in chromosome segment 4q12. Genomics. 1994;22:431-436. [Medline] [Order article via Infotrieve]

17. Rosnet O, Stephenson D, Mattei M-G, Marchetto S, Shibuya M, Chapman VM, Binbaum D. Close physical linkage of the FLT1 and FLT3 genes on chromosome 13 in man and chromosome 5 in mouse. Oncogene. 1993;8:173-179.[Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
JDRHome page
J. Dai and A.B.M. Rabie
VEGF: an Essential Mediator of Both Angiogenesis and Endochondral Ossification
Journal of Dental Research, October 1, 2007; 86(10): 937 - 950.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
M. Buraczynska, P. Ksiazek, I. Baranowicz-Gaszczyk, and L. Jozwiak
Association of the VEGF gene polymorphism with diabetic retinopathy in type 2 diabetes patients
Nephrol. Dial. Transplant., November 22, 2006; (2006) gfl641v1.
[Abstract] [Full Text] [PDF]


Home page
Ann OncolHome page
A Eroglu, S Gulec, C Kurtman, R Cam, and N Akar
Vascular endothelial growth factor 936 C/T polymorphism in cancer patients
Ann. Onc., September 1, 2006; 17(9): 1467 - 1468.
[Full Text] [PDF]


Home page
ThoraxHome page
A R L Medford and A B Millar
Vascular endothelial growth factor (VEGF) in acute lung injury (ALI) and acute respiratory distress syndrome (ARDS): paradox or paradigm?
Thorax, July 1, 2006; 61(7): 621 - 626.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
N. Kataoka, Q. Cai, W. Wen, X.-O. Shu, F. Jin, Y.-T. Gao, and W. Zheng
Population-Based Case-Control Study of VEGF Gene Polymorphisms and Breast Cancer Risk among Chinese Women.
Cancer Epidemiol. Biomarkers Prev., June 1, 2006; 15(6): 1148 - 1152.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
D. S. Faffe, L. Flynt, K. Bourgeois, R. A. Panettieri Jr., and S. A. Shore
Interleukin-13 and Interleukin-4 Induce Vascular Endothelial Growth Factor Release from Airway Smooth Muscle Cells: Role of Vascular Endothelial Growth Factor Genotype
Am. J. Respir. Cell Mol. Biol., February 1, 2006; 34(2): 213 - 218.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
E. Zygalaki, A. Stathopoulou, C. Kroupis, L. Kaklamanis, Z. Kyriakides, D. Kremastinos, and E. S. Lianidou
Real-Time Reverse Transcription-PCR Quantification of Vascular Endothelial Growth Factor Splice Variants
Clin. Chem., August 1, 2005; 51(8): 1518 - 1520.
[Full Text] [PDF]


Home page
Hum ReprodHome page
M. Bhanoori, K. Arvind Babu, N.G. Pavankumar Reddy, K. Lakshmi Rao, K. Zondervan, M. Deenadayal, S. Kennedy, and S. Shivaji
The vascular endothelial growth factor (VEGF) +405G>C 5'-untranslated region polymorphism and increased risk of endometriosis in South Indian women: a case control study
Hum. Reprod., July 1, 2005; 20(7): 1844 - 1849.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
S. Lee, S. M. Jilani, G. V. Nikolova, D. Carpizo, and M. L. Iruela-Arispe
Processing of VEGF-A by matrix metalloproteinases regulates bioavailability and vascular patterning in tumors
J. Cell Biol., May 23, 2005; 169(4): 681 - 691.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
S. J. Lee, S. Y. Lee, H.-S. Jeon, S. H. Park, J. S. Jang, G. Y. Lee, J. W. Son, C. H. Kim, W. K. Lee, S. Kam, et al.
Vascular Endothelial Growth Factor Gene Polymorphisms and Risk of Primary Lung Cancer
Cancer Epidemiol. Biomarkers Prev., March 1, 2005; 14(3): 571 - 575.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
G. Pages and J. Pouyssegur
Transcriptional regulation of the Vascular Endothelial Growth Factor gene-a concert of activating factors
Cardiovasc Res, February 15, 2005; 65(3): 564 - 573.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
N. Ferrara
Vascular Endothelial Growth Factor: Basic Science and Clinical Progress
Endocr. Rev., August 1, 2004; 25(4): 581 - 611.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
L. Jensen, H. Pilegaard, P. D. Neufer, and Y. Hellsten
Effect of acute exercise and exercise training on VEGF splice variants in human skeletal muscle
Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2004; 287(2): R397 - R402.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
D. Papazoglou, G. Galazios, M. I. Koukourakis, I. Panagopoulos, E. N. Kontomanolis, K. Papatheodorou, and E. Maltezos
Vascular endothelial growth factor gene polymorphisms and pre-eclampsia
Mol. Hum. Reprod., May 1, 2004; 10(5): 321 - 324.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
D.C Felmeden, A.D Blann, and G.Y.H Lip
Angiogenesis: basic pathophysiology and implications for disease
Eur. Heart J., April 1, 2003; 24(7): 586 - 603.
[Full Text] [PDF]


Home page
Cancer Res.Home page
A. Stevens, J. Soden, P. E. Brenchley, S. Ralph, and D. W. Ray
Haplotype Analysis of the Polymorphic Human Vascular Endothelial Growth Factor Gene Promoter
Cancer Res., February 15, 2003; 63(4): 812 - 816.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pathol.Home page
E S Bamberger and C W Perrett
Angiogenesis in epithelian ovarian cancer
Mol. Pathol., December 1, 2002; 55(6): 348 - 359.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
M. Shahbazi, A. A. Fryer, V. Pravica, I. J. Brogan, H. M. Ramsay, I. V. Hutchinson, and P. N. Harden
Vascular Endothelial Growth Factor Gene Polymorphisms Are Associated with Acute Renal Allograft Rejection
J. Am. Soc. Nephrol., January 1, 2002; 13(1): 260 - 264.
[Abstract] [Full Text] [PDF]


Home page
Sci SignalHome page
T. Matsumoto and L. Claesson-Welsh
VEGF Receptor Signal Transduction
Sci. Signal., December 11, 2001; 2001(112): re21 - re21.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
K. R. S. Brown, K. M. England, K. L. Goss, J. M. Snyder, and M. J. Acarregui
VEGF induces airway epithelial cell proliferation in human fetal lung in vitro
Am J Physiol Lung Cell Mol Physiol, October 1, 2001; 281(4): L1001 - L1010.
[Abstract] [Full Text] [PDF]


Home page
The OncologistHome page
F. J. Giles
The Vascular Endothelial Growth Factor (VEGF) Signaling Pathway: A Therapeutic Target in Patients with Hematologic Malignancies
Oncologist, October 1, 2001; 6(2008): 32 - 39.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
C. Robinson and S. Stringer
The splice variants of vascular endothelial growth factor (VEGF) and their receptors
J. Cell Sci., January 3, 2001; 114(5): 853 - 865.
[Abstract] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. D. Mueller, J.-L. Vigne, A. Minchenko, D. I. Lebovic, D. C. Leitman, and R. N. Taylor
Regulation of vascular endothelial growth factor (VEGF) gene transcription by estrogen receptors alpha and beta
PNAS, September 19, 2000; (2000) 200377097.
[Abstract] [Full Text]


Home page
Mol Hum ReprodHome page
J. Gogusev, J.B. de Joliniere, L. Telvi, M. Doussau, S. du Manoir, A. Stojkoski, and M. Levardon
Genetic abnormalities detected by comparative genomic hybridization in a human endometriosis-derived cell line
Mol. Hum. Reprod., September 1, 2000; 6(9): 821 - 827.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Aguayo, S. O'Brien, M. Keating, T. Manshouri, C. Gidel, B. Barlogie, M. Beran, C. Koller, H. Kantarjian, and M. Albitar
Clinical relevance of intracellular vascular endothelial growth factor levels in B-cell chronic lymphocytic leukemia
Blood, July 15, 2000; 96(2): 768 - 770.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
K. Tae, A. K. El-Naggar, E. Yoo, L. Feng, J. J. Lee, W. K. Hong, W. N. Hittelman, and D. M. Shin
Expression of Vascular Endothelial Growth Factor and Microvessel Density in Head and Neck Tumorigenesis
Clin. Cancer Res., July 1, 2000; 6(7): 2821 - 2828.
[Abstract] [Full Text]


Home page
BloodHome page
A. Aguayo, E. Estey, H. Kantarjian, T. Mansouri, C. Gidel, M. Keating, F. Giles, Z. Estrov, B. Barlogie, and M. Albitar
Cellular Vascular Endothelial Growth Factor Is a Predictor of Outcome in Patients With Acute Myeloid Leukemia
Blood, December 1, 1999; 94(11): 3717 - 3721.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
N. Ferrara and T. Davis-Smyth
The Biology of Vascular Endothelial Growth Factor
Endocr. Rev., February 1, 1997; 18(1): 4 - 25.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. D. Mueller, J.-L. Vigne, A. Minchenko, D. I. Lebovic, D. C. Leitman, and R. N. Taylor
Regulation of vascular endothelial growth factor (VEGF) gene transcription by estrogen receptors alpha and beta
PNAS, September 26, 2000; 97(20): 10972 - 10977.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vincenti, V.
Right arrow Articles by Persico, M. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vincenti, V.
Right arrow Articles by Persico, M. G.
Right arrowPubmed/NCBI databases
*OMIM
*Substance via MeSH