This Article Abstract Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Shioi, T. Articles by Sasayama, S. Search for Related Content PubMed PubMed Citation Articles by Shioi, T. Articles by Sasayama, S.

(Circulation. 1996;94:2930-2937.)
© 1996 American Heart Association, Inc.

Articles

Persistent Expression of Cytokine in the Chronic Stage of Viral Myocarditis in Mice

Tetsuo Shioi, MD; Akira Matsumori, MD; Shigetake Sasayama, MD

the Department of Cardiovascular Medicine, Kyoto University, Japan.

Correspondence to Akira Matsumori, MD, Department of Cardiovascular Medicine, Kyoto University, 54 Kawaracho, Shogoin, Sakyo-ku, Kyoto 606, Japan. E-mail amat@kuhp.kyoto-u.ac.jp.

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Background Dilated cardiomyopathy (DCM) is one of the most frequent causes of heart failure of unknown origin. One possible cause of DCM is considered to be a sequel to myocarditis. However, the mechanism of progression from viral myocarditis to DCM is still not clear.

Methods and Results The expression of the immunoregulatory cytokines interferon (IFN)- and interleukin (IL)-2 and the proinflammatory cytokines IL-1ß and tumor necrosis factor (TNF)- in the heart tissue was studied in a murine model of postmyocarditis DCM induced by encephalomyocarditis virus. IFN-, IL-1ß, and TNF- mRNA increased 3 days after virus inoculation. IL-2 mRNA was detectable 7 days after inoculation. The peak expression of all cytokine genes examined was seen 7 days after inoculation. The expression of these cytokine genes decreased thereafter but persisted 80 days after inoculation. IL-1ß gene expression in the chronic stage was relatively high compared with other cytokines and was correlated with the ratio of heart weight to body weight and the extent of fibrotic lesions. Immunohistochemical analysis revealed that some of the mononuclear cells, endothelial cells, and interstitial macrophages were positive for IL-1ß or TNF- and fibroblasts were positive for IL-1ß in the heart tissue of mice 80 days after inoculation.

Conclusions Persistent expression of cytokines was seen in a murine model of postmyocarditis DCM. These cytokines may have important implications in the pathogenesis of DCM.

Key Words: cardiomyopathy • heart failure • interleukins • myocarditis • remodeling

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
Dilated cardiomyopathy is a set of heterogeneous diseases of left ventricular dysfunction of unknown origin. One possible cause of DCM is considered to be a sequel to myocarditis, because cellular infiltration and myocardial necrosis in the myocardium have been found in biopsy or autopsy samples in some patients with DCM.^{1 2}

Viral infection is one important cause of myocarditis. The coxsackievirus B group has been implicated by serological studies.^{3 4} Enteroviral RNA sequences have been demonstrated in the myocardium of patients with myocarditis or DCM.^{5 6} We developed a murine model of postmyocarditis DCM to elucidate the mechanism of progression from viral myocarditis to DCM. In this model, heart weight and the cavity dimension of the left ventricle were increased, and myocardial fibrosis and hypertrophy of myocardial fiber were evident in the chronic stage of myocarditis induced by EMCV.⁷

It is considered that the coordinate action of multiple cytokines probably determines the nature, severity, and duration of immunoinflammatory responses.^{8 9} We and others reported the role of proinflammatory cytokines in the pathogenesis of acute myocarditis induced by virus or autoimmune mechanism.^{10 11 12} However, the role of cytokines in the pathogenesis of cardiomyopathic changes in the chronic stage of myocarditis has not been studied. We examined cytokine expression in the heart tissue of a murine model of postmyocarditis DCM. The expression of the immunoregulatory cytokines IFN- and IL-2 and of the proinflammatory cytokines IL-1ß and TNF- was investigated by semiquantitative reverse-transcriptase PCR and immunohistochemical analysis from the onset of the disease to the chronic stage.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Viral Infection of Mice
Stocks of the M (myocardiotrophic) variant of EMCV were prepared as described^{12 13} and stored at -70°C until use. Virus titers were determined by plaque formation on FL cell monolayers as described.¹³

Inbred male DBA/2 mice were obtained from the Shizuoka Agricultural Cooperation Association (Shizuoka, Japan). At 4 weeks of age, mice were inoculated intraperitoneally with 0.1 mL EMCV diluted in PBS to a concentration of 1x10² pfu/mL. The mice were killed by cervical dislocation on days 1, 3, 7, 14, 28, and 80. Uninfected 4- and 16-week-old mice were used as controls. Each group consisted of four to six animals.

RNA Preparation and cDNA Synthesis
Samples prepared from hearts with apparent myocardial damage on histopathological examination were analyzed by PCR. Total RNA was isolated by the guanidinium thiocyanate–phenol-chloroform-isoamylalcohol procedure.¹⁴ The RNA concentration was measured spectrophotochemically.

Total RNA (10 µg) was subjected to first-strand cDNA synthesis in a 40-µL reaction mixture containing 50 mmol/L Tris-HCl (pH 8.3), 75 mmol/L KCl, 3 mmol/L MgCl₂, 1 mmol/L of each dNTP (Perkin-Elmer Cetus), 0.825 optical density random hexamers (Pharmacia LKB Biotechnology Inc), 40 U of RNAasin (Promega Corp), and 200 U murine leukemia virus reverse transcriptase (Gibco BRL). The reaction mixture was incubated at 37°C for 60 minutes, heated to 70°C for 5 minutes to denature the reverse transcriptase, then cooled on ice for 3 minutes. Water (60 µL) was added to each sample, and samples were stored at -20°C.

Polymerase Chain Reaction
The cDNA was diluted 1:10, then 2 µL was amplified by PCR. Each PCR reaction contained 100 µmol/L of each dNTP, 0.5 µmol/L of each specific primer, 10 mmol/L Tris-HCl (pH 8.3), 50 mmol/L KCl, 1.5 mmol/L MgCl₂, 0.001% gelatin, and 0.25 U Taq polymerase (Cetus) in a volume of 20 µL.

A sense primer (A) and an antisense primer (B) were synthesized by use of the published cDNA sequences for each of the following: IFN-,¹⁵ IL-1ß,¹⁶ IL-2,¹⁷ TNF-,¹⁸ EMCV,¹⁹ and ß-actin.²⁰ The actual sequences of the oligonucleotides were as follows: IFN--A, 5'AACGCTACACACTGCATCT3'; IFN--B, 5'TGCTCATTGTAATGCTTGG3'; IL-1ß-A, 5'GCAACTGTTCCTGAACTCA3'; IL-1ß-B, 5'CTCGGAGCCTGTAGTGCAG3'; IL-2-A, 5'AACAGCGCACCCACTTCAA3'; IL-2-B, 5'TTGAGATGATGCTTTGACA3'; TNF--A, 5'ATGAGCACAGAAAGCATGATCCGC3'; TNF--B, 5'CCAAAGTAGACCTGCCCGGACTC3'; EMCV-A, 5'GTCGTGAAGGAAGCAGTTCC3'; EMCV-B, 5'CACGTGGCTTTTGGCCGCAGAGGC3'; ß-actin-A, 5'ATGGATGACGATATCGCT3'; and ß-actin-B, 5'ATGAGGTAGTCTGTCAGGT3'.

Primers for cytokine genes and ß-actin gene were designed to cross introns to avoid confusion between mRNA and genomic DNA. Primers for EMCV were derived from sequences in the 5'-untranslated region of the EMCV genome.¹³ Oligonucleotides were purchased from Oligos Etc, Inc.

IL-1ß and ß-actin mRNAs and EMCV genome RNA were analyzed by 21 cycles of amplification, and IL-2, IFN-, and TNF- mRNAs were analyzed by 24 cycles of amplification in a thermal cycler (Cetus) for semiquantification. Each cycle consisted of denaturation at 94°C for 1 minute, annealing at 55°C for 1 minute, and extension at 72°C for 1 minute.

The cDNA derived from EMCV-infected FL cells was the positive control for EMCV analysis. The cDNA derived from concanavalin A (Sigma Chemical Co) and phorbol 12-myristate 13-acetate (Sigma)–stimulated mouse spleen cells was the positive control of PCR with the other primers. A PCR reaction that included water instead of cDNA was the negative control. These controls were included in every PCR reaction.

DNA Probes
The following recombinant cDNA clones were used to prepare DNA probes: murine IFN-¹⁵ (Pst I fragment, provided by Genentech, Inc), murine IL-2¹⁷ (pmut-1, BamHI fragment, purchased from American Type Culture Collection), and murine TNF-¹⁸ (EcoRI fragment, provided by Genentech, Inc). The PCR products of murine IL-1ß and ß-actin were subcloned into the EcoRV site of pBluescript (Stratagene Inc). The DNA sequence was confirmed by dideoxy-chain termination and was used to prepare the probes. All cDNA probes were labeled by random priming with [-³²P]dCTP (Amersham Inc).

The oligonucleotide used to prepare the probe for EMCV was¹³ 5'GATTTCCGCTGCCTGCAAAGGGTCGCTACAGACGTTGCTT3'. The oligonucleotide was labeled with T4 polynucleotide kinase (Toyobo) and [-³²P]ATP (Amersham).

Southern Hybridization
A portion of the PCR reaction product was then electrophoresed on 2% agarose gels and transferred to nylon membranes (NEN). These were prehybridized in a solution containing 50% formamide, 1% SDS, 1 mol/L NaCl, 0.1% Ficoll, 0.1% polyvinyl pyrrolidone, and 0.1% BSA at 42°C for 3 to 4 hours. The hybridization solution was identical to that used for prehybridization, except that it included 200 µg/mL salmon sperm DNA and labeled probe. Hybridization proceeded at 42°C overnight. The blots were washed twice with 2xSSC/1% SDS at room temperature for 10 minutes, then with 2xSSC/1% SDS at 65°C for 5 minutes for the EMCV probe or 0.1xSSC/1% SDS at 65°C for 30 minutes twice for the other probes. The blots were analyzed with a FUJIX bioimaging analyzer BAS 2000.

Verification of the Semiquantitative Analysis
We performed semiquantitative PCR analysis according to the method described by Wesselingh et al²¹ and Herskowitz et al.²² To demonstrate that our PCR strategy used for the semiquantitative analysis was valid throughout a range of cDNA concentrations, 10-fold serial dilutions of positive-control cDNA were amplified by PCR, probe-hybridized, and quantified by radioanalytic scanning for each primer. As indicated in Fig 1, there was a linear correlation between the amount of cDNA and the yield of PCR products. These serial dilutions of the positive control were amplified in each assay to generate a standard curve, which ensured a fixed relationship between the initial cDNA input and the densitometric readout.

View larger version (25K): [in this window] [in a new window]   Figure 1. Semiquantitative PCR analysis of ß-actin mRNA using cDNA derived from concanavalin A and phorbol 12-myristate 13-acetate–stimulated murine spleen cells as templates. Tenfold serial dilutions of cDNA were amplified for 21 cycles of PCR, probe hybridized, and quantified by radioanalytic scanning. Photograph of Southern hybridization and results of radioanalytic scanning are shown.

Histopathology
Heart sections were fixed in 10% formalin, embedded in paraffin, and stained with hematoxylin-eosin or Masson's trichrome. The morphometric examination of the extent of cellular infiltration or fibrosis was performed as described.²³ Briefly, the number of points that lay over the whole left ventricular myocardium, infiltration, and fibrosis were counted by use of an eyepiece grid with 100 points. The areas of the respective parts were calculated by the formula 0.01xnumber of pointsxgrid area. The area of infiltration or fibrosis (%) was defined as (area of infiltration or fibrosis/area of left ventricular myocardium)x100.

Immunohistochemistry
Heart sections were embedded in O.C.T. compound tissue medium (Miles Inc), snap-frozen on dry ice, and stored at -70°C. Tissues were sectioned on a cryostat at 4 to 10 µm. Tissue sections were fixed for 10 minutes in 4% paraformaldehyde at 4°C. The following primary antibodies were used: hamster monoclonal anti–mouse IL-1ß (Genzyme Corp) at a concentration of 50 µg/mL, rabbit polyclonal anti–mouse TNF- (Genzyme Corp) diluted 1:1000, and rat monoclonal anti–mouse macrophage (clone F4/80, BMA) diluted 1:200. All dilutions were made with PBS containing 1% BSA. Incubation with primary antibody was carried out at 4°C overnight. Biotinylated goat anti–hamster IgG (Cedarlane) diluted 1:100, biotinylated goat anti–rabbit IgG (DAKO) diluted 1:300, and biotinylated rabbit anti–rat IgG (DAKO) diluted 1:300 were used as secondary antibodies, respectively. Incubations with secondary antibodies were carried out at room temperature for 30 minutes. After incubation with avidin-biotin-horseradish peroxidase complexes (Vector Laboratories), peroxidase was visualized by 3',3'-diaminobenzidine followed by incubation with diaminobenzidine enhancing solution (Vector Laboratories). Counterstain was performed with methyl green. (1) Omission of the primary antibody and (2) blockage of anti–mouse IL-1ß and anti–mouse TNF- with recombinant rat IL-1ß (provided by Otsuka Pharmaceutical Co) and recombinant mouse TNF- (Genzyme), respectively, were used as controls.

Statistical Analysis
The amounts of IL-1ß and TNF- mRNA in the hearts from infected mice were compared with those from control mice by one-way ANOVA. Relationships between two variables were tested by linear regression analysis. The results were considered statistically significant at P<.05.

	Results

Top Abstract Introduction Methods Results Discussion References

 
PCR Analysis of Viral Genome RNA
In our previous study, no infectious virus was isolated 14 days after inoculation.¹³ In PCR analysis, viral RNA was detected within 24 hours after inoculation (Fig 2). Viral RNA increased prominently 3 days after inoculation and peaked 7 days after inoculation (Fig 3). It rapidly decreased thereafter but was detectable 80 days after inoculation, consistent with our previous report.¹³

View larger version (53K): [in this window] [in a new window]   Figure 2. Photograph of a representative analysis of IL-1ß, TNF-, IL-2, IFN-, and ß-actin mRNA and EMCV genome RNA by semiquantitative PCR. RNA was extracted from control hearts and hearts obtained at days 1, 3, 7, 14, 28, and 80. The cDNA was synthesized, then amplified by PCR and probe-hybridized. Two representative samples from each group are shown. Number of amplification cycles in PCR reaction is given in parentheses.

View larger version (80K): [in this window] [in a new window]   Figure 3. Semiquantitative PCR analysis of EMCV genome RNA in heart tissue. Sample groups consisted of control and inoculated mice killed at days indicated. Each group consisted of four to six animals. EMCV PCR products were normalized to ß-actin. Results are expressed as mean maximal response ±SEM. Note that the y axis is expressed as a logarithmic scale.

PCR Analysis of Cytokine Genes
The mRNA for the two cytokines characteristically produced by macrophages, IL-1ß and TNF-, were detectable in the hearts of control mice (Fig 2). These cytokine mRNAs increased 3 days after inoculation to reach maximal levels 7 days after inoculation (Fig 4). TNF- mRNA decreased thereafter. However, TNF- mRNA in the hearts from mice 80 days after inoculation was higher than in uninfected mice, although the difference was not significant. The expression of IL-1ß gene was elevated for a more prolonged period. Eighty days after inoculation, the level of IL-1ß mRNA was about one third of its peak value at 7 days after inoculation.

View larger version (46K): [in this window] [in a new window]   Figure 4. Semiquantitative PCR analysis of IL-1ß, TNF-, IL-2, and IFN- mRNA. Sample groups consisted of control and inoculated mice killed at the days indicated. Each group consisted of four to six animals. IL-1ß, TNF-, IL-2, and IFN- PCR products were normalized to ß-actin. Results are expressed as mean maximal response ±SEM. *P<.05 by one-way ANOVA.

Unlike the monocyte and multiple-source cytokines, IFN- and IL-2 mRNA were not detected in the hearts of uninfected mice (Fig 2). IFN- mRNA was detectable 3 days after infection, reaching a peak 7 days after inoculation (Fig 4). IL-2 mRNA was first detected 7 days after inoculation, when its expression was highest. Although the expression of IFN- and IL-2 mRNA decreased rapidly thereafter, they were detectable 80 days after inoculation.

IL-1ß gene expression in the hearts of mice 28 and 80 days after inoculation was positively correlated with HW/BW and the extent of fibrotic lesions, which include replacement fibrosis after necrosis (Fig 5). The amount of IFN-, IL-2, and TNF- mRNAs in the hearts of mice 28 and 80 days after inoculation were not significantly correlated with HW/BW or the extent of fibrosis (data not shown).

View larger version (15K): [in this window] [in a new window]   Figure 5. IL-1ß gene expression in hearts of mice 28 and 80 days after inoculation was positively correlated with HW/BW and the degree of fibrotic lesions. Vertical axis represents amount of IL-1ß mRNA expressed as arbitrary units.

Histopathology
There were no apparent histopathological findings in the hearts from mice 1 day after inoculation (Fig 6B) compared with those from control mice (Fig 6A). The hearts from mice 3 days after inoculation (Fig 6C) occasionally showed small foci of degenerated myocytes. Cellular infiltration was not evident at this stage. The hearts from mice 7 days after inoculation (Fig 6D) showed extensive cellular infiltration and myocardial cell necrosis. Fourteen days after inoculation, EMCV-infected murine hearts showed reduced mononuclear cell infiltration and fibrosis around the necrotic area (Fig 6E). The hearts at 80 days after inoculation showed dense fibrosis surrounding calcification (Fig 6F) and hypertrophy of the myocytes (Fig 6G). Occasionally, clusters of mononuclear cell infiltration were observed at this stage (Fig 6H). The time course of the extent of cellular infiltration is shown (Fig 7).

View larger version (1098K): [in this window] [in a new window]   Figure 6. Photomicrographs of histopathological findings in murine heart sections. A, Heart from a control 4-week-old DBA/2 mouse. B, At 1 day after inoculation, there were no apparent histopathological findings. C, At 3 days after inoculation, small foci of degenerated myocytes were seen. D, At 7 days after inoculation, extensive cellular infiltration and myocardial cell necrosis were seen. E, At 14 days after inoculation, reduced mononuclear cell infiltration and fibrosis around necrotic area were seen. F, At 80 days after inoculation, dense fibrosis surrounding calcification was seen. G, At 80 days after inoculation, hypertrophy of myocytes was seen. H, At 80 days after inoculation, clusters of mononuclear cell infiltration were observed. Hematoxylin-eosin stain; magnification x160.

View larger version (30K): [in this window] [in a new window]   Figure 7. Time course of extent of cellular infiltration. Sample groups consisted of control and inoculated mice killed at days indicated. Results are expressed as mean±SEM.

Immunohistochemistry
We made immunohistochemical analyses to localize IL-1ß and TNF- protein within the heart tissue. In the control group of uninfected mice, the hearts were found to be negative for IL-1ß and TNF- immunoreactivities.

Three days after inoculation, IL-1ß immunoreactivity was found in the vascular endothelial cells and interstitial cells (Fig 8A). Interstitial cells positive for IL-1ß were predominantly macrophages (Fig 8B). Seven days after inoculation, infiltrating mononuclear cells (Fig 8C), endothelial cells, and macrophages were positive for IL-1ß immunoreactivities. Eighty days after inoculation, IL-1ß staining was seen in the fibroblasts surrounding necrotic areas (Fig 8D) as well as some of the cells in the clusters of mononuclear cells (Fig 8E). Some endothelial cells and interstitial macrophages were also positive for IL-1ß (Fig 8F) at this stage.

View larger version (1298K): [in this window] [in a new window]   Figure 8. Localization of IL-1ß and TNF- protein by immunohistochemical analysis. A, At 3 days after inoculation, endothelial cells (arrows) and interstitial cells (arrowhead) were positive for IL-1ß. Magnification x400. B, At 3 days after inoculation, serial section of heart tissue stained with antibody to IL-1ß (right) and antibody to macrophages (left). Interstitial cells (arrowheads) positive for IL-1ß were predominantly macrophages. Endothelial cells (arrow) were also positive for IL-1ß. Magnification x80. C, At 7 days after inoculation, infiltrating mononuclear cells were positive for IL-1ß. Magnification x400. D, At 80 days after inoculation, fibroblasts surrounding necrosis were positive for IL-1ß. Magnification x400. E, At 80 days after inoculation, some of the infiltrating mononuclear cells were positive for IL-1ß. Magnification x400. F, At 80 days after inoculation, some endothelial cells (arrow) and interstitial cells (arrowhead) were positive for IL-1ß. Magnification x400. G, At 3 days after inoculation, endothelial cells (arrow) and interstitial cells (arrowhead) were positive for TNF-. Magnification x400. H, At 7 days after inoculation, infiltrating mononuclear cells were positive for TNF-. Magnification x400. I, At 80 days after inoculation, some of the infiltrating mononuclear cells were positive for TNF-. Magnification x400. J, At 80 days after inoculation, some endothelial cells were positive for TNF-. Magnification x400.

Three days after inoculation, TNF- immunoreactivity was found in the vascular endothelial cells and interstitial macrophages (Fig 8G). Seven days after inoculation, infiltrating mononuclear cells (Fig 8H), endothelial cells, and macrophages were positive for TNF- immunoreactivities. Eighty days after inoculation, TNF- staining was seen in some of the infiltrating mononuclear cells (Fig 8I). Some endothelial cells and interstitial macrophages were also positive for TNF- (Fig 8J) at this stage.

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
This study showed that multiple cytokines were expressed during the acute stage of myocarditis in the different time courses. Interestingly, the expression of cytokines persisted as long as 80 days after inoculation.

The role of proinflammatory cytokines, such as IL-1ß and TNF-, in the pathogenesis of myocarditis in the acute phase has been investigated. We and others reported that neutralization of endogenous TNF ameliorates the severity of myocarditis induced by virus or autoimmune mechanism.^{10 11} Lane et al¹² showed that IL-1ß or TNF- could promote coxsackievirus B3–induced myocarditis in resistant B 10.A mice. However, the role of cytokines in the pathogenesis of postmyocarditis DCM has not been studied. This is the first report that investigates the expression of the immunoregulatory cytokines IFN- and IL-2, as well as the proinflammatory cytokines IL-1ß and TNF-, in the chronic stage of myocarditis, when no infectious virus is isolated and cardiomyopathic changes are evident.

The rapid induction of IL-1ß and TNF- mRNA at 3 days after inoculation, when few cell infiltrates could be seen, suggests that these cytokines are produced by intrinsic cells in the heart tissue at this stage. Immunohistochemical analysis revealed that endothelial cells and interstitial macrophages were positive for IL-1ß and TNF- immunoreactivities 3 days after inoculation. The expression of these cytokines is likely to influence the induction of the local inflammatory process.²⁴

IFN- and IL-2 mRNAs were not detected in the hearts from control mice. IFN- mRNA appeared 3 days after inoculation. IL-2 mRNA appeared 7 days after inoculation. T-cell infiltration into the heart peaks at day 7 to 14 after inoculation in this model.^{25 26} Temporal correlation between cellular infiltration and IL-2 and IFN- mRNA production suggests that infiltrating cells, rather than resident heart cells, account for the appearance of IFN- and IL-2 mRNAs in the heart. IFN- and IL-2 protein are likely to be produced, because the production of IFN- and IL-2 is regulated mainly at the transcriptional level.^{27 28}

One of the most important findings in this study was that the expression of IFN-, IL-1ß, IL-2, and TNF- persisted as long as 80 days after virus inoculation. IL-2, which is produced exclusively by T lymphocytes, is likely to be produced by infiltrating mononuclear cells, which are occasionally seen 80 days after inoculation. The presence of IL-2 mRNA suggests that T cells activated in a major histocompatibility complex–dependent manner are present in the heart tissue in the chronic stage. The temporal expression of IL-2 and IFN- mRNA in the chronic phases was correlated with that of the EMCV genome RNA. This suggests that the expression of IL-2 and IFN- is triggered by persistent viral infection in this model, although autoimmune mechanisms also should be considered, because focal accumulation of mononuclear cells was preceded by myosin-induced autoimmune myocarditis in a rat model.²⁹

Recently, the mechanism of immune–mediated myocyte injury has been extensively studied.³⁰ Cytokines such as IL-1ß or TNF- have negative inotropic effects on the isolated perfused heart,³¹ papillary muscle preparation,³² and cultured myocytes.³³ IL-1ß has deleterious effects on myocyte metabolism in vitro.³⁴ IL-1ß activates fibroblasts,³⁵ which might significantly affect the remodeling process of the heart.³⁶ IL-1ß induces hypertrophy of cultured cardiac myocytes associated with induction of fetal genes.³⁷ In addition to these humoral effects, cytokines may activate cytotoxic T cells, which might cause direct myocyte injury,³⁸ and may induce cell adhesion molecules, which might regulate persistent inflammatory cell traffic within the myocardium.³⁹

In this study, IL-1ß gene expression in the chronic stage was relatively high compared with other cytokines and was positively correlated with HW/BW and the extent of fibrotic lesions, thus indicating the possible role of IL-1ß in the pathogenesis of cardiomyopathic changes in this model. IFN-, IL-2, and TNF- gene expressions in the chronic stage were not significantly correlated with HW/BW or the extent of fibrosis. It is possible that the degree of the upregulation of IFN-, IL-2, and TNF- genes in the chronic stage was not large enough to test the correlation.

In addition to DCM, persistent enteroviral infections are implicated in the pathogenesis of chronic fatigue syndrome⁴⁰ and juvenile-onset diabetes mellitus.⁴¹ This study showed that EMCV RNA persistence is associated with persistent cytokine gene expression, which might affect the disease process of these disorders.⁴²

Conventionally, the diagnosis of myocarditis has been based mainly on histopathological analysis of endomyocardial biopsy samples.⁴³ We found that resident cells in the heart, such as endothelial cells and macrophages, could be the source of cytokines in the course of myocarditis, in addition to infiltrating cells. The analysis of local production of cytokines in endomyocardial biopsy samples by sensitive PCR assay might bring about new insights into the pathophysiology of myocarditis and DCM.

In conclusion, enhanced expression of cytokines was observed in a murine model of postmyocarditis cardiomyopathy. The degree of cytokine expression in the chronic stage was correlated with that of cardiomyopathic changes. These cytokines may have important implications in the pathogenesis of DCM, although future studies designed to test the hypothesis, such as chronic treatment with cytokine inhibitors, are required.⁴⁴

	Selected Abbreviations and Acronyms

 

DCM = dilated cardiomyopathy EMCV = encephalomyocarditis virus HW/BW = ratio of heart weight to body weight IFN = interferon IL = interleukin PCR = polymerase chain reaction TNF = tumor necrosis factor

	Acknowledgments

 
We thank Genentech Inc for murine IFN- and TNF- cDNA clones, Otsuka Pharmaceutical Co for recombinant rat IL-1ß, and Drs Matsui and Sato for helpful discussions.

Received April 23, 1996; revision received June 20, 1996; accepted July 1, 1996.

	References

Top Abstract Introduction Methods Results Discussion References

 

1. MacArthur CGC, Tarin D, Goodwin JE, Hallidie-Smith KA. The relationship of myocarditis to dilated cardiomyopathy. Eur Heart J. 1984;5:1023-1035.[Abstract/Free Full Text]
   
2. Parrillo JE, Aretz TH, Palacios I, Fallon JT, Block PC. The results of transvenous endomyocardial biopsy can frequently be used to diagnose myocardial diseases in patients with idiopathic heart failure: endomyocardial biopsies in 100 consecutive patients revealed a substantial incidence of myocarditis. Circulation. 1984;69:93-101.[Abstract/Free Full Text]
   
3. Kawai C, Matsumori A, Fujuwara H. Myocarditis and dilated cardiomyopathy. Annu Rev Med. 1989;38:221-239.[Medline] [Order article via Infotrieve]
   
4. Cambridge G, Macarthur CGC, Waterson AP, Goodwin JF, Oakley CM. Antibodies to coxsackie B viruses in primary congestive cardiomyopathy. Br Heart J. 1979;41:692-696.[Abstract/Free Full Text]
   
5. Bowles NE, Richardson PJ, Olsen EGJ, Archard LC. Detection of coxsackie-B-virus-specific RNA sequences in myocardial biopsy samples from patients with myocarditis and dilated cardiomyopathy. Lancet. 1986;1:1120-1123.[Medline] [Order article via Infotrieve]
   
6. Bowles NE, Rose ML, Taylor P, Banner NR, Morgan-Capner P, Cunningham L, Archard LC, Yacoub MH. End-stage dilated cardiomyopathy: persistence of enterovirus RNA in myocardium at cardiac transplantation and lack of immune response. Circulation. 1989;80:1128-1136.[Abstract/Free Full Text]
   
7. Matsumori A, Kawai C. An animal model of congestive (dilated) cardiomyopathy: dilatation and hypertrophy of the heart in the chronic stage in DBA/2 mice with myocarditis caused by encephalomyocarditis virus. Circulation. 1982;66:355-360.[Abstract/Free Full Text]
   
8. Balkwill FR, Burke F. The cytokine network. Immunol Today. 1989;10:299-304.[Medline] [Order article via Infotrieve]
   
9. Arai KI, Lee F, Miyajima A, Miyatake S, Arai N, Yokota T. Cytokines: coordinators of immune and inflammatory responses. Annu Rev Biochem. 1990;59:783-836.[Medline] [Order article via Infotrieve]
   
10. Yamada T, Matsumori A, Sasayama S. Therapeutic effect of anti–tumor necrosis factor- antibody on the murine model of viral myocarditis induced by encephalomyocarditis virus. Circulation. 1994;89:846-851.[Abstract/Free Full Text]
    
11. Smith SC, Allen PM. Neutralization of endogenous tumor necrosis factor ameliorates the severity of myosin-induced myocarditis. Circ Res. 1992;70:856-863.[Abstract/Free Full Text]
    
12. Lane JR, Neumann DA, Lafond-Walker A, Herskowitz A, Rose NR. Interleukin-1 or tumor necrosis factor can promote coxsackievirus B3-induced myocarditis in resistant B 10.A mice. J Exp Med. 1992;175:1123-1129.[Abstract/Free Full Text]
    
13. Kyu B-S, Matsumori A, Sato Y, Okada I, Chapman NM, Tracy S. Cardiac persistence of cardioviral RNA detected by polymerase chain reaction in a murine model of cardiomyopathy. Circulation. 1992;86:522-530.[Abstract/Free Full Text]
    
14. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156-159.[Medline] [Order article via Infotrieve]
    
15. Gray PW, Goeddel DV. Cloning and expression of murine immune interferon cDNA. Proc Natl Acad Sci U S A. 1983;80:5842-5846.[Abstract/Free Full Text]
    
16. Gray PW, Glaister D, Chen E, Goeddel DV, Pennica D. Two interleukin 1 genes in the mouse: cloning and expression of the cDNA for the murine IL-1ß. J Immunol. 1986;137:3644-3648.[Abstract]
    
17. Yokota T, Arai N, Lee F, Rennick D, Mosmann T, Arai K-I. Use of a cDNA expression vector for isolation of mouse interleukin 2 cDNA clones: expression of T-cell growth-factor activity after transfection of monkey cells. Proc Natl Acad Sci U S A. 1985;82:68-72.[Abstract/Free Full Text]
    
18. Pennica D, Hayflick JS, Bringham TS, Palladino MA, Goeddel DV. Cloning and expression in Escherichia coli of the cDNA for murine tumor necrosis factor. Proc Natl Acad Sci U S A. 1985;82:6060-6064.[Abstract/Free Full Text]
    
19. Bae YS, Eun HM, Yoon JW. Genomic differences between diabetogenic and nondiabetogenic encephalomyocarditis virus. Virology. 1989;170:282-287.[Medline] [Order article via Infotrieve]
    
20. Tokunaga K, Taniguchi H, Yoda K, Shimizu M, Sakiyama S. Nucleotide sequence of a full-length cDNA for mouse cytoskeletal ß-actin mRNA. Nucleic Acids Res. 1986;14:2829.[Free Full Text]
    
21. Wesselingh SL, Power C, Glass JD, Tyor WR, McArthur JC, Farber JM, Griffin JW, Griffin DE. Intracerebral cytokine messenger RNA expression in acquired immunodeficiency syndrome dementia. Ann Neurol. 1993;33:576-582.[Medline] [Order article via Infotrieve]
    
22. Herskowitz A, Choi S, Ansari AA, Wesselingh S. Cytokine mRNA expression in postischemic/reperfused myocardium. Am J Pathol. 1995;146:419-428.[Abstract]
    
23. Furukawa Y, Matsumori A, Hirozane T, Sasayama S. Angiotensin II receptor antagonist TCV-116 reduces graft coronary artery disease and preserves graft status in a murine model, a comparative study with captopril. Circulation. 1996;93:333-339.[Abstract/Free Full Text]
    
24. Jaattela M. Biology of disease: biologic activities and mechanisms of action of tumor necrosis factor-alpha/cachectin. Lab Invest. 1991;64:724-742.[Medline] [Order article via Infotrieve]
    
25. Kishimoto C, Kuribayashi K, Masuda T, Tomioka N, Kawai C. Immunologic behavior of lymphocytes in experimental viral myocarditis: significance of T lymphocytes in the severity of myocarditis and silent myocarditis in BALB/c-nu/nu mice. Circulation. 1985;71:1247-1254.[Abstract/Free Full Text]
    
26. Kishimoto C, Kuribayashi K, Fukuma K, Masuda T, Tomioka N, Abelmann WH, Kawai C. Immunologic identification of lymphocyte subsets in experimental murine myocarditis with encephalomyocarditis virus. Circulation. 1987;61:715-725.
    
27. Taniguchi T. Regulation of cytokine gene expression. Annu Rev Immunol. 1988;6:439-464.[Medline] [Order article via Infotrieve]
    
28. Efrat S, Pilo S, Kaempfer R. Kinetics of induction and molecular size of mRNAs encoding human interleukin-2 and gamma-interferon. Nature. 1982;297:236-239.[Medline] [Order article via Infotrieve]
    
29. Kodama M, Hanawa H, Saeki M, Hosono H, Inomata T, Suzuki K, Shibata A. Rat dilated cardiomyopathy after autoimmune giant cell myocarditis. Circ Res. 1994;75:278-284.[Abstract/Free Full Text]
    
30. Barry WH. Mechanisms of immune-mediated myocyte injury. Circulation. 1994;89:2421-2432.[Abstract/Free Full Text]
    
31. Hosenpud JD, Campbell SM, Mendelson DJ. Interleukin-1-induced myocardial depression in an isolated beating heart preparation. J Heart Transplant. 1989;8:460-464.[Medline] [Order article via Infotrieve]
    
32. Finkel MS, Oddis CV, Jacob TD, Watkins SC, Hattler BG, Simmons RL. Negative inotropic effects of cytokines on the heart mediated by nitric oxide. Science. 1992;257:387-389.[Abstract/Free Full Text]
    
33. Balligand J-L, Ungureanu D, Kelly RA, Kobzik L, Pimental D, Smith TW, Michel T. Abnormal contractile function due to induction of nitric oxide synthesis in rat cardiac myocytes follows exposure to activated macrophage-conditioned medium. J Clin Invest. 1993;91:2314-2319.
    
34. Hosenpud JD. The effect of interleukin 1 on myocardial function and metabolism. Clin Immunol Immunopathol. 1993;68:175-180.[Medline] [Order article via Infotrieve]
    
35. Libby P, Warner SJ, Friedman GB. Interleukin 1: a mitogen for human vascular smooth muscle cells that induces the release of growth-inhibitory prostanoid. J Clin Invest. 1988;81:487-498.
    
36. Boluyt MO, O'Neill L, Meredith AL, Bing OHL, Brooks WW, Conrad CH, Crow MT, Lakatta EG. Alternation in cardiac gene expression during the transition from stable hypertrophy to heart failure: marked upregulation of genes encoding extracellular matrix components. Circ Res. 1994;75:23-32.[Abstract/Free Full Text]
    
37. Thaik CM, Calderone A, Takahashi N, Colucci WS. Interleukin-1ß modulates the growth and phenotype of neonatal rat cardiac myocytes. J Clin Invest. 1995;96:1093-1099.
    
38. Woodley SL, McMillan M, Shelby J, Lynch DH, Roberts LK, Ensley RD, Barry WH. Myocyte injury and contraction abnormalities produced by cytotoxic T lymphocytes. Circulation. 1991;83:1410-1418.[Abstract/Free Full Text]
    
39. Seko Y, Ishiyama S, Nishikawa T, Kasajima T, Hiroe M, Kagawa N, Osada K, Suzuki S, Yagita H, Okumura K, Yazaki Y. Restricted usage of T cell receptor V-Vß genes in infiltrating cells in the hearts of patients with acute myocarditis and dilated cardiomyopathy. J Clin Invest. 1995;96:1035-1041.
    
40. Cunningham L, Bowles NE, Lane RJM, Dubowitz V, Archard LC. Persistence of enteroviral RNA in chronic fatigue syndrome is associated with the abnormal production of equal amounts of positive and negative strands of enteroviral RNA. J Gen Virol. 1990;71:1399-1402.[Abstract/Free Full Text]
    
41. Fohlman J, Friman G. Is juvenile diabetes a viral disease? Ann Med. 1993;25:569-574.[Medline] [Order article via Infotrieve]
    
42. Bendtzen K, Mandrup-Poulsen T, Nerup J, Nielsen JH, Dinarello CA, Svenson M. Cytotoxicity of human pI 7 interleukin-1 for pancreatic islets of Langerhans. Science. 1986;232:1545-1547.[Abstract/Free Full Text]
    
43. Aretz HT. Myocarditis: the Dallas criteria. Hum Pathol. 1987;18:619-624.[Medline] [Order article via Infotrieve]
    
44. Dinarello CA. Modalities for reducing interleukin 1 activity in disease. Immunol Today. 1993;14:260-264.[Medline] [Order article via Infotrieve]
    

This article has been cited by other articles:

				I. Kindermann, M. Kindermann, R. Kandolf, K. Klingel, B. Bultmann, T. Muller, A. Lindinger, and M. Bohm Predictors of Outcome in Patients With Suspected Myocarditis Circulation, August 5, 2008; 118(6): 639 - 648. [Abstract] [Full Text] [PDF]

				R. Dennert, H. J. Crijns, and S. Heymans Acute viral myocarditis Eur. Heart J., July 9, 2008; (2008) ehn296v1. [Abstract] [Full Text] [PDF]

				M. Hausler, B. Sellhaus, S. Scheithauer, B. Gaida, S. Kuropka, K. Siepmann, A. Panek, W. Berg, A. Teubner, K. Ritter, et al. Myocarditis in newborn wild-type BALB/c mice infected with the murine gamma herpesvirus MHV-68 Cardiovasc Res, November 1, 2007; 76(2): 323 - 330. [Abstract] [Full Text] [PDF]

				K. Reifenberg, H.-A. Lehr, M. Torzewski, G. Steige, E. Wiese, I. Kupper, C. Becker, S. Ott, P. Nusser, K.-I. Yamamura, et al. Interferon-{gamma} Induces Chronic Active Myocarditis and Cardiomyopathy in Transgenic Mice Am. J. Pathol., August 1, 2007; 171(2): 463 - 472. [Abstract] [Full Text] [PDF]

				Y. Abe, K. Ono, T. Kawamura, H. Wada, T. Kita, A. Shimatsu, and K. Hasegawa Leptin induces elongation of cardiac myocytes and causes eccentric left ventricular dilatation with compensation Am J Physiol Heart Circ Physiol, May 1, 2007; 292(5): H2387 - H2396. [Abstract] [Full Text] [PDF]

				E. Westphal, Li Chen, C. Pilowski, S. Koch, H. Ebelt, U. Muller-Werdan, K. Werdan, and H. Loppnow Endotoxin-activated cultured neonatal rat cardiomyocytes express functional surface-associated interleukin-1{alpha} Innate Immunity, February 1, 2007; 13(1): 25 - 34. [Abstract] [PDF]

				K. Nishikawa, M. Yoshida, M. Kusuhara, N. Ishigami, K. Isoda, K. Miyazaki, and F. Ohsuzu Left ventricular hypertrophy in mice with a cardiac-specific overexpression of interleukin-1 Am J Physiol Heart Circ Physiol, July 1, 2006; 291(1): H176 - H183. [Abstract] [Full Text] [PDF]

				S. Rutschow, J. Li, H.-P. Schultheiss, and M. Pauschinger Myocardial proteases and matrix remodeling in inflammatory heart disease Cardiovasc Res, February 15, 2006; 69(3): 646 - 656. [Abstract] [Full Text] [PDF]

				J.-F. Wang, A. Meissner, S. Malek, Y. Chen, Q. Ke, J. Zhang, V. Chu, T. G. Hampton, C. S. Crumpacker, W. H. Abelmann, et al. Propranolol ameliorates and epinephrine exacerbates progression of acute and chronic viral myocarditis Am J Physiol Heart Circ Physiol, October 1, 2005; 289(4): H1577 - H1583. [Abstract] [Full Text] [PDF]

				U. Kuhl, M. Pauschinger, B. Seeberg, D. Lassner, M. Noutsias, W. Poller, and H.-P. Schultheiss Viral Persistence in the Myocardium Is Associated With Progressive Cardiac Dysfunction Circulation, September 27, 2005; 112(13): 1965 - 1970. [Abstract] [Full Text] [PDF]

				K. Grun, B. Markova, F.-D. Bohmer, A. Berndt, H. Kosmehl, and C. Leipner Elevated expression of PDGF-C in coxsackievirus B3-induced chronic myocarditis Eur. Heart J., April 1, 2005; 26(7): 728 - 739. [Abstract] [Full Text] [PDF]

				U. Kuhl, M. Pauschinger, M. Noutsias, B. Seeberg, T. Bock, D. Lassner, W. Poller, R. Kandolf, and H.-P. Schultheiss High Prevalence of Viral Genomes and Multiple Viral Infections in the Myocardium of Adults With "Idiopathic" Left Ventricular Dysfunction Circulation, February 22, 2005; 111(7): 887 - 893. [Abstract] [Full Text] [PDF]

				K. Yamamoto, T. Shioi, K. Uchiyama, T. Miyamoto, S. Sasayama, and A. Matsumori Attenuation of virus-induced myocardial injury by inhibition of the angiotensin II type 1 receptor signal and decreased nuclear factor-kappa B activation in knockout mice J. Am. Coll. Cardiol., December 3, 2003; 42(11): 2000 - 2006. [Abstract] [Full Text] [PDF]

				R. Nishio, T. Shioi, S. Sasayama, and A. Matsumori Carvedilol increases the production of interleukin-12 and interferon-{gamma} and improves the survival of mice infected with the encephalomyocarditis virus J. Am. Coll. Cardiol., January 15, 2003; 41(2): 340 - 345. [Abstract] [Full Text] [PDF]

				A. Matsumori Cytokines in myocarditis and dilated cardiomyopathy Eur. Heart J. Suppl., December 1, 2002; 4(suppl_I): I42 - I45. [Abstract] [PDF]

				R. Nishio, S. Sasayama, and A. Matsumori Left ventricular pressure-volume relationship in a murine model of congestive heart failure due to acute viral myocarditis J. Am. Coll. Cardiol., October 16, 2002; 40(8): 1506 - 1514. [Abstract] [Full Text] [PDF]