Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 1997;95:715-722

This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fujise, K.
Right arrow Articles by Beck, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fujise, K.
Right arrow Articles by Beck, P. J.
Right arrowPubmed/NCBI databases
*Substance via MeSH

(Circulation. 1997;95:715-722.)
© 1997 American Heart Association, Inc.


Articles

A Tissue Plasminogen Activator/P-Selectin Fusion Protein Is an Effective Thrombolytic Agent

Kenichi Fujise, MD; Bryan Mitch Revelle, BS; Lowell Stacy, PhD; Edwin L. Madison, PhD; Edward T.H. Yeh, MD; James T. Willerson, MD; Pamela J. Beck, PhD

the Divisions of Molecular Medicine and Cardiology (K.F., E.T.H.Y.), Department of Internal Medicine; Cardiovascular Research Center (K.F., E.T.H.Y.), Institute of Molecular Medicine for the Prevention of Human Diseases; and Department of Internal Medicine (K.F., E.T.H.Y., J.T.W., P.J.B.), The University of Texas Health Science Center (Houston); Texas Heart Institute (J.T.W.), Houston, Tex; Texas Biotechnology Corporation (B.M.R., L.S., P.J.B.), Houston, Tex; and Department of Vascular Biology (E.L.M.), Scripps Research Institute, La Jolla, Calif.

Correspondence to Dr Kenichi Fujise, Cardiovascular Research Center, Institute of Molecular Medicine for the Prevention of Human Diseases, The University of Texas–Houston Health Science Center, Ste 4200, 6431 Fannin, Houston TX 77030. E-mail kfujise@heart.med.uth.tmc.edu.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background P-selectin is expressed on the surface of activated endothelial cells and platelets. We hypothesized that a tissue plasminogen activator (TPA)/P-selectin fusion protein would have not only thrombolytic activity but also might target TPA to the thrombi. In addition, it seemed possible that this chimeric protein would competitively inhibit the binding of native P-selectin on endothelial cells and platelets to leukocytes and thus further promote thrombolysis.

Methods and Results The full-length, plasminogen activator inhibitor-1–resistant form of TPA (TPAIR) together with two TPAIR/P-selectin fusion constructs (P280IR and P121IR) were expressed with the use of baculovirus vectors. After infection of Sf-21 cells with the recombinant baculovirus, recombinant TPAIR and P-selectin/TPAIR fusion proteins were purified with the use of metal ion chromatography. The intact protease activity of TPAIR and the ligand binding capability of P-selectin were confirmed through indirect chromogenic and cell binding assays, respectively. These molecules were assessed both in vitro and in vivo for thrombolytic activity. In vitro clot lysis assays indicated equal efficacy of TPAIR, P280IR, and P121IR (P>.5). The in vivo efficacy was tested in a cyclic flow variation model with the use of the rat mesenteric artery. Compared with saline control treatment, reduction in cyclic flow variations was significant (P<.05) and similar (P>.5) among TPAIR, P280IR, and P121IR. No significant bleeding was noted among treated animals.

Conclusions Chimeric proteins P280IR and P121IR have clot lysis activities that are similar to TPAIR both in vitro and in vivo. These chimeric proteins also bind to P-selectin ligand in vitro. Thus, these proteins may provide an efficient method of targeting TPA to the thrombotic region. Further experimental analysis with the use of larger animal coronary occlusion models should help determine the future value of these proteins as clinical therapeutic agents.


Key Words: plasminogen activators • thrombolysis • P-selectin • cyclic flow variations • acute coronary syndromes


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
P-selectin (PADGEM or GMP-140) is a 140-kD glycoprotein member of the selectin family of vascular adhesion molecules.1 P-selectin is typically stored in the {alpha}-granules of platelets2 and the Weibel-Palade bodies of endothelial cells3 until cellular activation is initiated by a variety of circumstances; this includes treatment with thrombin,4 histamine,5 or oxygen-derived free radicals6 or ischemia and subsequent reperfusion,7 all of which may induce the rapid mobilization of P-selectin to the cell surface within minutes. Once present on the cell surface, P-selectin appears to have a critical function in neutrophil rolling, a phenomenon that occurs during the early phases of inflammation8 and is believed to be critical for the recruitment of leukocytes to areas of vascular injury. P-selectin ligands include sLex and sLex-related carbohydrates that are distributed on the surfaces of neutrophils, monocytes, and some leukocytes.9

Acute coronary events, such as unstable angina and myocardial infarction, are a series of dynamic multicellular endovascular incidents involving not only coagulation cascades but also platelets, endothelial cells, neutrophils, and monocytes.10 It is becoming increasingly clear that P-selectin is involved in this acute thrombotic process that may initiate when thrombin induces rapid translocation of P-selectin from {alpha}-granules and Weibel-Palade bodies to the plasma membrane. P-selectin on the endothelial cell and platelet surfaces may then increase neutrophil and monocyte adherence to these cells.11 Alternatively, the binding of P-selectin to ligands on neutrophils and monocytes may stimulate the activation of these cells as evidenced by increased superoxide anion release.12 The superoxide anion produced in this manner may further stimulate P-selectin surface expression on platelets and endothelial cells,11 thus amplifying the thrombotic cascade. Also, monocytes, when stimulated by platelets through P-selectin, express tissue factor on their surface.13 Tissue factor, the principal cellular initiator of coagulation, binds factors VII and VIIa to form the tissue factor/factor VIIa complex that activates factors IX and X14 and further stimulate the coagulation cascade. The key role of P-selectin in the thrombotic process is perhaps best documented by research showing that antibody blockade of P-selectin retards fibrin deposition and clot formation in an animal thrombosis model.10

It also appears that P-selectin may be involved in several clinically relevant complications associated with thrombosis. P-selectin has been shown to be involved in the pathogenesis of reperfusion injury of the myocardium,15 reperfusion injury of the coronary artery,16 toxin-induced acute hemorrhagic tissue injury,17 and postischemic no-reflow.18 Thus, blocking the interaction between P-selectin and its ligands might not only reduce thrombosis10 but also prevent complications associated with thrombosis. Blockade of P-selectin/ligand interaction in vivo has been achieved previously with one of four methods: anti–P-selectin antibody,19 anti-sLex antibody,20 soluble P-selectin,21 or soluble sLex.22

TPA is one of two types of plasminogen activator derived from independent genes. TPA converts the plasma-borne zymogen, plasminogen, into the active protease, plasmin, which in turn degrades the fibrin meshwork of thrombi. Despite opening as much as 81% of arteries within 90 minutes,23 treatment of acute coronary thrombosis with TPA has been associated with platelet activation and other resultant reocclusion, hemorrhage, and reperfusion injuries.24

These limitations of current thrombolytic agents have led to a search for new, third-generation pharmaceuticals with greater efficacy and specificity.25 Strategies that have been used to develop these drugs include increasing the plasma half-life of thrombolytic agents by introducing amino acid substitutions or deletions into recombinant proteins and increasing fibrin specificities by either increasing fibrin binding sites or conjugating thrombolytics with antifibrin antibody.26

In this article, we describe the production of two chimeric TPAIR/P-selectin proteins and report their characterization with the use of both in vitro and in vivo function studies. In vitro clot lysis activity was investigated with platelet-rich thrombi, with the use of a well-described clot lysis model,27 and in vivo activity was tested with the use of a rat mesenteric artery CFV model28 29 30 in which not only thrombin but also platelets play important roles in the formation of thrombi. The results presented here indicate that these chimeric proteins have equal efficacy to TPAIR and may potentially be a valuable alternative therapy for acute ischemic syndrome.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Preparation of Mutant TPA/P-Selectin Fusion Constructs
TPAIR contains the following amino acid substitutions: Tyr67Asn, Ser69Ala, Asn117Gln, Lys296Glu, Arg298Glu, and Arg299Glu. It has been shown previously by Madison and coworkers31 that specific substitution of residues 296, 298, and 299 reduces the affinity of TPA for PAI-1. Amino acid residues 67 and 69 are located in the EGF domain and appear to be important in the receptor-mediated clearance of the molecule.32 33 The substitution at residue 117 eliminates one of the high mannose glycosylation sites and consequently enhances specific fibrin binding and slows plasma clearance.34 Consequently, these multiple substitutions are expected to increase TPA plasma half-life, enhance fibrin specificity, and reduce inhibition by PAI-1 and thereby increase thrombolytic activity.

Recombinant DNA methods were performed as described previously.35 The first chimeric construct consists of P-selectin amino acids 1 through 121, which comprise the P-selectin lectin domain fused to full-length TPAIR. The protein expressed from this construct is denoted P121IR (Fig 1Down). The second construct is similar with the exception that it includes P-selectin amino acids 1 through 280, which include the lectin, EGF-like, and first two short CR (CR1 and CR2) domains fused to the amino terminus of the mature full length TPAIR. The protein derived from this second construct is denoted P280IR.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 1. Structures of the P-selectin/TPA chimeric fusion proteins that were constructed as described in "Methods." A, TPAIR; B, P280IR; C, P121IR. SGN indicates signal peptide of TPA; PRO, propeptide of TPA; Lectin, lectin domain of P-selectin; EGF, epidermal growth factor–like domain of P-selectin; and CR1 and CR2, the first and second consensus repeat domains of P-selectin. Although not noted, the mature, full-length TPA consists of the finger (amino acid sequence 1-43), EGF (44-91), kringle-1 (92-172), kringle-2 (180-261), and serine protease (276-527) domains.

Each TPAIR/P-selectin fusion construct was prepared with the use of PCR. The following oligonucleotide primer was used to create a BglII site at the 5' end of both P-selectin fusions: TCGAAGATCTTGGACTTATCAT. Oligonucleotide primers GGCAAGATCTTGTGTAACACAA and GCTGAGATCTCACAGCTTTA were used to generate BglII sites at the fusion joints located at the end of the lectin domain or at the end of the second short consensus repeat (CR2), respectively. Both of the resultant, cloned PCR-generated fragments were sequenced with the use of the Sequenase method (United States Biochemical) to ensure that they did not contain any synthesis errors. Each P-selectin fragment was ligated in frame into the unique BglII site located at nucleotide 103 in the TPAIR cDNA sequence. This placed the P-selectin lectin domain at the amino terminus of each mature fusion protein.

Protein Production Using Baculovirus Expression System
Cell Culture
Sf-21 cells were purchased from Clonetech and propagated at 27°C in supplemented Grace's Insect Cell Culture Medium (Gibco Life Technologies) to which 10% fetal calf serum (Gibco Life Technologies) and 1% penicillin and streptomycin (Gibco Life Technologies) were added.

Expression of Fusion Proteins
Typically, 20 T-175 Falcon flasks (Becton Dickinson) were seeded with 50 million Sf-21 cells. After a 15- to 18-hour incubation, these cells were infected with recombinant or wild-type baculovirus stocks. Infected cultures were grown in supplemented Grace's insect media with 10% fetal calf serum for 12 hours followed by exchange of the media with 0.5% fetal calf serum and supplemented Grace's media. The culture supernatant containing the secreted, recombinant protein was harvested at 72-hour intervals for 10 to 12 days after infection. Protein expression was monitored by immunofluorescence, ELISA, and TPA activity assays.

35S-Labeling Experiments
At 48 hours after infection, culture medium was replaced with Grace's methionine and cysteine deficient media (Gibco Life Technologies) containing 200 µCi/mL 35S-Express Protein Label (DuPont-New England Nuclear). Cells were incubated for 4 hours with gentle rocking every 30 minutes. The culture supernatant was recovered, and cells were lysed with a solution of 50 mmol/L Tris, pH 8.0, 150 mmol/L NaCl, 0.02% sodium azide, 1% Nonidet P-40 (nonylphenoxy polyethoxy ethanol), 0.57 mol/L (100 µg/mL) phenylmethylsulfonyl fluoride, and 1 mg/mL aprotinin. Recombinant proteins were immunoprecipitated with a 2.5 µg/mL final concentration of goat anti-human TPA polyclonal antibody (American Diagnostica) and 1% protein A/Sepharose. Precipitated proteins were fractionated by SDS-PAGE and autoradiographed.

Purification and Characterization of TPAIR Fusion Proteins
Purification of TPAIR Fusion Proteins
Recombinant proteins were purified as noted by Furlong and coworkers36 with the following modifications. The average loading flow rate was 5 mL/min. The eluted fractions were dialyzed for a minimum of 24 hours with at least two buffer changes (0.02 mmol/L NH4HCO3) at 4°C and subsequently lyophilized.

Protein Concentration
Total protein in lyophilized samples was determined with the use of a Coomassie protein assay (Pierce). ELISAs were performed essentially as described previously.37 Goat anti-human TPA polyclonal antibody (American Diagnostica) was used to coat the wells. The mouse anti-human monoclonal antibody PAM-2 (American Diagnostica) was used as the detecting antibody. Concentrations of TPAIR were determined with the use of a standard curve derived from known concentrations of a purchased TPA antigen standard (American Diagnostica).

Assessment of P-Selectin Binding Activity of the Molecule
For the cell binding assay, recombinant protein was immunoprecipitated with goat anti-mouse magnetic beads (DynaBeads; Dynal Inc) that were preadsorbed with anti-TPA mouse monoclonal antibody PAM-2 (American Diagnostica) with the use of the manufacturer's recommended concentrations and procedures (Dynal). Binding assays were performed as described previously.38

Assessment of Catalytic Activity of TPAIR Segment of the Molecule
For the TPAIR activity assay, Spectrozyme DESAFIB (soluble fibrin, American Diagnostica) TPA activity assays 39 were run according to the manufacturer's recommendations with the exception that Falcon 96-well dishes were used and the amounts of all reagents and samples were reduced by one fifth of the original recommended volumes. All experiments were performed in duplicate or triplicate.

In Vitro Clot Lysis Assay
Clots were prepared as described previously.27 In brief, PRP was obtained by centrifuging the whole blood from a healthy donor at 1000g for 4 minutes. One milliliter of PRP, 1.0x105 cpm of [125I]fibrinogen (Amersham), 2.5 mmol of CaCl2, and 0.5 NIH unit of human {alpha}-thrombin (100 NIH U/mL; American Diagnostica) were mixed, immediately introduced into silicon tubing (internal diameter, 4 mm), and allowed to clot for 1 hour at 37°C. The tubing was then cut into 1-cm slices, which were washed in PBS for a minimum of 2 hours at 4°C. The fibrinolytic activity of TPAIR, P280IR, and P121IR was determined as described previously.27 40 Briefly, the PRP clots were incubated at 37°C with gentle shaking in 1 mL of autologous plasma of the same blood type (fresh frozen plasma; Golf Coast Blood Bank). Equal amounts of each recombinant protein, as determined by ELISA and DESAFIB activity assay, were tested for clot lysis activity. At times 0; 30 minutes; and 1, 1.5, 2, 3, and 18 hours, 50 mL of liquid sample was removed for gamma counting. The percent clot lysis was calculated by comparing the released 125I with the total 125I incorporated into the clot.

In Vivo Clot Lysis Assay
The activity of recombinant proteins was assessed with the use of a rat mesenteric artery CFV model,28 29 30 which was modified as follows. Male Wistar rats (InBred, Munich substrain, Harlan Co) weighing 250 to 274 g were used. The first branch of the mesenteric artery that bifurcates into a branch of {approx}300 mm in diameter was identified and isolated. During the dissection procedure, care was taken to touch the artery as infrequently as possible. Stretch pulled polyethylene tubing (PE-10; Clay Adams) was inserted so that its tip was located just distal to the bifurcation. No epinephrine/lidocaine mixture was used to dilate the vessel.41 The vessel preparation was positioned on a triocular microscope (BIOMAX, BX40, Olympus) attached to a color video recording system (CCD-IRIS, Sony) or, in some cases, to a 35-mm camera (model SC36, type 12, Olympus).

To induce CFVs, a short segment ({approx}300 µm) of the other branch of the cannulated artery was compressed 10 to 20 times with the use of a stainless steel rod attached to a micromanipulator. It was typically observed that the thrombus formed after 1 to 2 minutes and gradually increased its size over the next 5 to 10 minutes until the lumen was occluded. Within minutes, this clot was spontaneously dissolved into emboli, and flow was reestablished. The sizes of the thrombi were similar among experiments, typically 300 to 400 mm in diameter. The cycle of spontaneous thrombus formation and dissolution repeated itself several times per hour. After the cyclic flow was established, video recording was initiated. The percent luminal stenosis was visually assessed each minute and recorded in gradations of 0%, 25%, 50%, 75%, 90%, or 100% occlusion by a trained cardiologist, to whom the identities of the solutions being tested were not known. The vessel diameters just proximal (upstream) and distal (downstream) to the injured segment were recorded each minute with the use of a precalibrated video screen. When thrombi embolized, the event was recorded. The estimated blood flow across the lesion was assessed semiquantitatively and graded as 0 (no flow), 1 (sluggish flow), 2 (normal flow).

Immediately after vessel injury to induce CFVs, a saline solution was infused over a 20-minute interval at the rate of 1 µL/min (baseline phase) with the use of an infusion pump (Harvard Apparatus). When it was determined that CFVs had been established, the test compound was administered at the same rate (intervention phase). This was followed by infusion of saline at the same rate for a short time (recovery phase). Equal amounts of recombinant protein as determined by ELISA and DESAFIB activity assay were tested for the ability to alter CFVs.

Statistical Analysis
Data are presented as mean±SEM. StatView (Abacus Concepts) was used to perform statistical analysis. Unless noted, a nonparametric analysis (Mann-Whitney test) was used to compare the mean of the percent changes of values in question. A value of P<.05 was considered significant.

In Vitro Clot Lysis
The percent clot lysis from each group was compared with the use of an unpaired t test. The values were taken from six repeated experiments.

In Vivo Experiments
The percent change in CFVs was calculated as follows:

Positive values represent increases in CFVs, whereas negative values indicate decreases in CFV during the interventional phase. The percent change in BFR was calculated as follows:

Positive values represent increases in BFR, whereas negative values indicate decreases in BFR during the interventional phase. A weighed percent change in vessel diameter was used to take into consideration the fact that vessel diameter slowly increases over time. With this method, the percent change in vessel diameter was calculated as follows:

Mean diameter of baseline phase was the average of the vessel diameters of both control and recovery phases. Positive values represent increases in vessel diameters, whereas negative values indicate decreases in CFVs during the intervention phase.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Analysis of Recombinant Protein
Lyophilized samples of chromatographically fractionated TPAIR, P280IR, and P121IR were quantified with the use of ELISA. Mean concentrations of the TPAIR, P280IR, and P121IR in solutions of 10 mg/mL total protein were 168.8±32.5 ng/mL (16.9 ng/mg of total protein), 203.7±9.7 ng/mL (20.4 ng/mg), and 252.7±80.8 ng/mL (25.3 ng/mg), respectively. The specific activities of TPAIR, P280IR, and P121IR were determined to be 3.8x109, 2.2x109, and 2.7x109 IU/mg, respectively. A lyophilized protein sample (10 mg/mL of total protein) isolated from mock or negative control fractionation of wild-type baculovirus infected cell lysate had no TPA present as determined by ELISA, DESAFIB, or clot lysis activity assays.

To determine the integrity of the recombinant proteins, Sf-21 cells were infected with TPAIR, P280IR, P121IR, and wild-type (mock) baculovirus. After pulse-labeling with 35S-methionine, radiolabeled proteins were immunoprecipitated with an anti-TPA polyclonal antibody and analyzed by SDS-PAGE and autoradiography. The results of this experiment are shown in Fig 2Down. In agreement with the predicted molecular weights as determined from the amino acid sequences of the proteins (Fig 1Up), TPAIR, P280IR, and P121IR had molecular masses of 50, 110, and 80 kD, respectively. Proteins of similar size were detected in the appropriate lyophilized samples, and their identities were confirmed by Western blot analysis (data not shown).



View larger version (64K):
[in this window]
[in a new window]
 
Figure 2. SDS-PAGE of immunoprecipitated TPAIR/P selectin chimeric proteins from Sf-21 cells infected is shown: M, protein markers; A, TPAIR; B, P280IR; C, P121IR; and D, mock immunoprecipitation from cells infected with wild-type virus. Right, protein was immunoprecipitated from cell lysate. Left, protein from the infected culture supernatants.

In Vitro Clot Lysis and P-Selectin Binding Activity
Each recombinant protein was tested for in vitro clot lysis activity. As can be seen from the results in Fig 3A through 3CDown, the thrombolytic activity of each protein was dose dependent. Also, the three baculovirus-expressed proteins were equally effective at lysing clots at each time point tested (P>.99 for all) (Fig 3DDown). From these data, it appears that TPAIR, P280IR, and P121IR produced equivalent clot lysis in vitro.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 3. In vitro clot lysis assays. A, TPAIR dose response: 1000 (1000 IU/mL), 500 (500 IU/mL), 250 (250 IU/mL), and 125 (125 IU/mL) signify the amounts of TPAIR that were added to each assay. B, P280IR dose response: 1000 (1000 IU/mL), 500 (500 IU/mL), 250 (250 IU/mL), and 125 (125 IU/mL). C, P121IR dose response: 1000 (1000 IU/mL), 500 (500 IU/mL), 250 (250 IU/mL), and 125 (125 IU/mL). D, Comparison of each of three proteins assayed at highest concentration (1000 IU/mL) (*P>=.0001). PBS was used as a negative control in A through C. Supernatant from wild-type baculovirus stock was processed in the same way fusion proteins were processed. This was used as a negative control in D.

The TPA/P-selectin proteins were also investigated for the ability to bind a monocytic cell line in a P-selectin–dependent manner. As detailed in the TableDown, both fusion proteins appeared to bind the human monocytic cell line in a calcium-dependent manner that can be competitively inhibited by treating the cells with anti-sLex antibody CSLEX (Becton Dickinson).


View this table:
[in this window]
[in a new window]
 
Table 1. Binding Capability of P-selectin/TPAIR Fusion Proteins to P-Selectin Ligand

In Vivo Assessment of Thrombolytic Activity
Initiation of CFV and Its Baseline Characteristics
Cyclic flow was successfully initiated in 18 of 27 rats (66%). Typically, after vascular injury, thrombosis occurred within 3 to 5 minutes and completely occluded the vessel lumen. Occlusion was associated with vasospasm (vasoconstriction) distal to the site of injury. When the thrombus broke down and embolized, the vessel dilated to its previous size, and flow resumed within 1 to 2 minutes (Fig 4Down). Once initiated, CFVs continued for >=1 hour. During that time, the average percent stenosis was relatively constant (67.4±4.0%, 72.6±5.2%, and 69.3±9.8% for the first, second, and third 20-minute period, respectively; P>.2 for all). There was an average of 4.3±1.1 emboli noted during each 20-minute period, and the frequency at which they occurred did not change significantly over the course of the experiment. An average of 3.9±0.4, 5.1±1.5, and 4.0±1.4 was measured during the first, second, and third 20-minute periods, respectively (P>.2). The average flow rating was 1.34±0.2 and did not change over the course of the experiments or when control saline infusions were administered. The average flow ratings were 1.38±0.1, 1.33±0.2, and 1.31±0.2 for the first, second, and third 20-minute periods, respectively (P>.2).



View larger version (68K):
[in this window]
[in a new window]
 
Figure 4. CFVs in a rat mesenteric artery injury model. Top, Vessel treated as described in the text to initiate and monitor CFVs in the rat messenteric artery model. Top left, Vessel has no thrombus and no occlusion. Top middle, Same section of vessel 50% occluded by a developing thrombus. Top right, Same vessel after complete occlusion. Bottom, Results of visually monitoring and scoring of CFVs that have been plotted against time (minutes). A, Typical TPAIR infusion started at the beginning of the intervention phase (black arrow). The drug infusion was stopped at the end of this period, and a saline infusion was restarted (open arrow). B, Typical negative control experiment in which a saline infusion was started at time 0 and continued throughout the experimental time course.

Percent Change in CFVs
Compared with saline, TPAIR, P280IR, and P121IR/TPAIR decreased CFVs by 39.0±8.4%, 34.4±11.4%, and 36.4±13.1%, respectively. These decreases were all significant compared with that of saline (-8.8±6.7%) and had the following probabilities: TPAIR (P<.005), P280IR (P<.01), and P121IR (P<.05). There were no significant differences noted among the three proteins tested (Fig 5Down).



View larger version (37K):
[in this window]
[in a new window]
 
Figure 5. Reduction in CFVs in a rat mesenteric artery injury model. CFVs were induced (six per treatment group), and the effect of the following inhibitors was monitored: A, TPAIR; B, P280IR; and C, P121IR.

Percent Change in Vessel Diameter and Blood Flow
Compared with saline, the three recombinant TPA proteins did not change either the proximal or distal vessel diameter significantly (P>.55 for proximal, P>.35 for distal). However, each appeared to cause a significant (P<.05) increase in blood flow, with percent change in BFRs of 61.8±32.8% (TPAIR), 12.9±12.9% (P280IR), and 44.3±9.3% (P121IR) compared with a saline control (-4.7±9.0%).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
In the present study, we demonstrated that it is feasible to express intact TPAIR/P-selectin chimeric proteins. Because fusion proteins often have reduced function compared with the original parent molecules from which they are made,42 43 44 it is important to note that these chimeric proteins appear to be as active as the original TPAIR when tested in both in vitro and in vivo clot lysis models. Additionally, our in vitro adhesion assay results indicate that the chimeric proteins have also retained P-selectin binding activity and specificity.

Chimeric Thrombolytic Molecules
Despite their widespread use, the currently available thrombolytic agents have a number of significant limitations, as mentioned.45 One of the molecular biological efforts in this area has been to overcome these shortcomings by creating new thrombolytic molecules with favorable biological characteristics, such as enhanced clot specificity. Bode and coworkers46 chemically conjugated plasminogen activators with monoclonal antibodies directed against fibrin and showed 5- to 10-fold higher thrombolytic potency than wild-type plasminogen activators in vivo. Other investigators47 48 used recombinant technology to create a fusion protein of an antifibrin antibody with TPA, demonstrating a significantly increased thrombolytic activity in vivo and in vitro. Dwerchin and coworkers49 conjugated antiplatelet monoclonal antibodies to TPA and showed significantly enhanced thrombolytic potency toward platelet-rich clots.

TPA/P-Selectin Chimeric Molecules
These chimeric molecules and other mutants may have higher clot specificity and enhanced thrombolysis, yet they have no direct effects on myocardial and vascular inflammation that is inevitably associated with coronary thrombosis. Our objective was to design chimeric thrombolytic molecules that would have both enhanced clot specificity and anti-inflammatory properties. We have attempted to create such a thrombolytic molecule by fusing TPAIR with the carbohydrate binding domain of human P-selectin. We hypothesized that disruption of the P-selectin/ligand interaction might diminish inflammation by reducing monocyte and neutrophil recruitment to reperfused tissue. Additionally, it seems likely that such a molecule might exhibit increased clot specificity since activated leukocytes located at the thrombus would presumably display high concentrations of the sLex selectin ligand. We also hypothesized that the binding of the P-selectin portion of the chimeric proteins to leukocytes might mask P-selectin ligands from counterreceptors on the surfaces of platelets, endothelial cells, and other leukocytes, possibly enhancing thrombolysis.

Perhaps the best experimental support for these theories are the findings of numerous investigators that indicate that soluble P-selectin can reduce inflammation through blockade of P-selectin/ligand interactions.21 50 51 Additionally, Palabrica and coworkers10 have shown that leukocyte accumulation in the developing thrombus promotes fibrin deposition in an arteriovenous thrombogenic shunt model in baboons. Their report shows that leukocyte adhesion and the subsequent growth of thrombi were inhibited by a monoclonal antibody against P-selectin, thus indicating that blockade of the adherence of leukocytes to platelets can retard thrombus formation. Further studies completed by Mulligan and coworkers20 have determined that sLex-related oligosaccharides reduce leukocyte accumulation in immune complex–induced acute lung injury. Finally, the presence of soluble P-selectin has been shown to reduce neutrophil adherence to plastic surfaces coated with P-selectin, further indicating that neutrophil binding to activated endothelium and platelets may also be disrupted by the presence of soluble P-selectin.52

In Vivo Clot Lysis Model
The rat mesenteric artery model of CFVs that we used is a high-flow arterial system in which platelet-rich thrombi are created by endothelial injury. This system was chosen because platelets, neutrophils, coagulation factors, and endothelial cells are all crucial for the generation of CFVs. The importance of platelets has been clearly shown by previous investigators who administered aspirin and other thromboxane synthetase inhibitors to abolish CFVs in canine coronary arteries.53 54 Also, blockade of glycoprotein IIb/IIIa receptors on the platelet surface by a monoclonal antibody has been shown to prevent CFVs.55 The role of thrombin and other coagulation factors in the initiation and maintenance of CFVs has been further elucidated by Eidt and coworkers,56 who demonstrated that heparin and the thrombin inhibitor, MCI-9038, abolish CFVs in an open-chest canine coronary artery model. This conclusion is supported by other reports that indicate that a mutant TPA molecule is able to prevent CFVs after restoring flow in a canine coronary thrombosis model.57

Using this rat model to generate and maintain CFVs, we have demonstrated that the P-selectin/TPAIR chimeric proteins are equally effective as the original TPAIR protein at reducing the frequency of CFVs and at maintaining blood flow in a natural microenvironment. This model proved to be ideal for testing the small quantities of chimeric protein that were available.

Study Limitations
We were not able to demonstrate the superiority of the P-selectin/TPAIR chimeric proteins over original TPAIR in any of the in vivo or vitro systems that we used. It is possible that the persistence and reoccurrence of the thrombi that are present in this CFV model may not be as dependent on leukocytes and coagulation factors as are thrombi that completely occlude the vessel lumen or that are present in other, larger animals with vascular systems that are more similar to humans. Although it is possible that our chimeric molecules with biologically active P-selectin moiety can prevent myocardial and arterial inflammation and reperfusion injury,21 50 51 52 we did not test such effects in our experimental model. We also did not test our chimeric molecules for increased clot specificity. In vivo coronary artery occlusion experiments that measure inflammation and reperfusion injury of both the coronary artery and myocardium with the use of a larger animal model will further test the therapeutic potential of these chimeric proteins.

Conclusions
Thrombolytically active, chimeric TPAIR/P-selectin fusion proteins can be expressed in a baculovirus system. These proteins appear to be as biologically active as TPAIR when tested in both in vitro and in vivo clot lysis models. In vitro cell adhesion assays also indicate that the proteins retain P-selectin binding activity. Further experimental analysis with the use of larger animal coronary occlusion models should help to determine the future value of these proteins as clinical therapeutic agents.


*    Selected Abbreviations and Acronyms
 
BFR = blood flow rating
CFV = cyclic flow variation
CR = consensus repeat
EGF = epidermal growth factor
PAI-1 = plasminogen activator inhibitor-1
PCR = polymerase chain reaction
PRP = platelet-rich plasma
sLex = sialyl Lewis X
TPA = tissue plasminogen activator
TPAIR = inhibitor-resistant TPA


*    Acknowledgments
 
We thank Dr Perumal Thiagarajan, Division of Hematology, University of Texas Houston Health Science Center, and Dr Haruo Araki, Kumamoto, Japan, for their useful suggestions in developing both the in vitro and in vivo models of thrombolysis. We thank Dr Joseph F. Sambrook for the kind gift of the TPAIR cDNA.


*    Footnotes
 
Guest Editor for this article was Pierre Theroux, MD, Montreal Heart Institute, Montreal, Canada.

Received June 17, 1996; revision received August 28, 1996; accepted September 12, 1996.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 

  1. Lasky LA. Selectins: interpreters of cell-specific carbohydrate information during inflammation. Science. 1992;258:964-969.[Abstract/Free Full Text]
  2. Stenberg PE, McEver RP, Shuman MA, Jacques YV, Bainton DF. A platelet alpha-granule membrane protein (GMP-140) is expressed on the plasma membrane after activation. J Cell Biol. 1985;101:880-886.[Abstract/Free Full Text]
  3. Bonfanti R, Furie BC, Furie B, Wagner DD. PADGEM is a component of Weibel-Palade bodies in endothelial cells. Blood. 1989;73:1109-1112.[Abstract/Free Full Text]
  4. McEver RP, Beckstead JH, Moore KL, Marshall-Carlton L, Bainton DF. GMP-140, a platelet alpha-granule membrane protein, is also synthesized by vascular endothelial cells and is localized in Weibel-Palade bodies. J Clin Invest. 1989;84:92-99.
  5. Hattori R, Hamilton KK, Fugate RD, McEver RD, Sims PJ. Stimulated secretion of endothelial von Willebrand factor is accompanied by rapid redistribution to the cell surface of the intracellular granule membrane protein GMP-140. J Biol Chem. 1989;264:7768-7771.[Abstract/Free Full Text]
  6. Patel KD, Zimmerman GA, Prescott SM, McEver RP, McIntyre TM. Oxygen radicals induce human endothelial cells to express GMP-140 and bind neutrophils. J Cell Biol. 1991;112:749-759.[Abstract/Free Full Text]
  7. Palluy O, Marliere L, Gris JC, Bonne C, Modat G. Hypoxia/reoxygenation stimulates endothelium to promote neutrophil adhesion. Free Radic Biol Med. 1992;13:21-30.[Medline] [Order article via Infotrieve]
  8. Lawerence MB, Springer TA. Leukocytes roll on a selectin at physiologic flow rates: distinction from and prerequisite for adhesion through integrins. Cell. 1991;65:859-873.[Medline] [Order article via Infotrieve]
  9. Foxall C, Watson SR, Dowbenko D, Fennie C, Lasky LA, Kiso M, Hasegawa A, Asa D, Brandley BK. The three members of the selectin receptor family recognize a common carbohydrate epitope, the sialyl Lewisx oligosaccharide. J Cell Biol. 1992;117:895-902.[Abstract/Free Full Text]
  10. Palabrica T, Lobb R, Furie BC, Aronovitz M, Benjamin C, Hsu Y-M, Sajer SA, Furie B. Leukocyte accumulation promoting fibrin deposition is mediated in vivo by P-selectin on adherent platelets. Nature. 1992;359:848-851.[Medline] [Order article via Infotrieve]
  11. Hamburger SA, McEver RP. GMP-140 mediates adhsion of stimulated platelets to neutrophils. Blood. 1990;75:550-554.[Abstract/Free Full Text]
  12. Nagata K, Tsuji T, Todoroki N, Katagiri Y, Tanoue K, Yamazaki H, Hanai N, Irimura T. Activated platelets induce superoxide anion release by monocytes and neutrophils through P-selectin (CD62). J Immunol. 1993;151:3267-3273.[Abstract]
  13. Celi A, Pellegrini G, Lorenzet R, De Blasi A, Ready N, Furie BC, Furie B. P-selectin induces the expression of tissue factor on monocytes. Proc Natl Acad Sci U S A. 1994;91:8767-8771.[Abstract/Free Full Text]
  14. Osterud B, Rapaport SI. Activation of factor IX by the reaction product of tissue factor and factor VII: additional pathway for initiating blood coagulation. Proc Natl Acad Sci U S A. 1977;74:5260-5264.[Abstract/Free Full Text]
  15. Weyrich AS, Ma XL, Lefer DJ, Albertine KH, Lefer AM. In vivo neutralization of P-selectin protects feline heart and endothelium in myocardial ischemia and reperfusion injury. J Clin Invest. 1993;91:2620-2629.
  16. Chen L, Nichols WW, Yang B, Hendricks JB, Metha JL. Monoclonal antibody to P-selectin (PB1.3) protect against loss of coronary flow reserve and myocardial segmental dysfunction following coronary occlusion and reperfusion in dogs. J Am Coll Cardiol. 1994;440A:804-806.
  17. Mulligan MS, Polley MJ, Bayer RJ, Nunn MR, Paulson JC, Ward PA. Neutrophil-dependent acute lung injury: requirement for P-selectin (GMP-140). J Clin Invest. 1992;88:1600-1607.
  18. Jerome SN, Dore M, Paulson JC, Smith CW, Korthuis RJ. P-selectin and ICAM-1 dependent adherence reactions: role in the genesis of postischemic no-reflow. Am J Physiol. 1994;266:H1316-1321.[Abstract/Free Full Text]
  19. Winn RK, Liggitt D, Vedder NB, Paulson JC, Harlan JM. Anti-P-selectin monoclonal antibody attenuates reperfusion injury to the rabbit ear. J Clin Invest. 1993;92:2042-2047.
  20. Mulligan MS, Paulson JC, Frees SD, Zheng ZL, Lowe JB, Ward PA. Protective effects of oligosaccharides in P-selectin-dependent lung injury. Nature. 1993;364:149-151.[Medline] [Order article via Infotrieve]
  21. Dunlop LC, Skinner MP, Bendall LJ, Favaioro EJ, Castaidi PA, Gorman JJ, Gamble JK, Vadas MA, Berndt MC. Characterization of GMP-140 (P-selectin) as a circulating plasma protein. J Exp Med. 1992;175:1147.[Abstract/Free Full Text]
  22. Buerke M, Weyrich AS, Zheng X, Gaeta FCA, Forrest MJ, Lefer AM. Sialyl Lewis X-containing oligosaccharide attenuates myocardial reperfusion injury in cats. J Clin Invest. 1994;93:1140-1148.
  23. GUSTO. The effects of tissue plasminogen activator, streptokinase, or both on coronary artery patency, ventricular function and survival after acute myocardial infarction. N Engl J Med. 1993;329:1615-1622.[Abstract/Free Full Text]
  24. GUSTO. An international randomized trial comparing four thrombolytic strategies for acute myocardial infaction. N Engl J Med. 1993;329:673-682.[Abstract/Free Full Text]
  25. Collen D. Toward improved thrombolytic therapy. Lancet. 1993;342:34-36.[Medline] [Order article via Infotrieve]
  26. Holvoet P, Dewerchin M, Stassen J, Lijnen HR, Tollenaere T, Gaffiney PJ, Collen D. Thrombolytic profiles of clot-targeted plasminogen activators: parameters determining potency and initial and maximal rates. Circulation. 1993;87:1007-1016.[Abstract/Free Full Text]
  27. Shohet RV, Spitzer S, Madison EL, Bassel-Duby R, Gething M-J, Sambrook JF. Inhibitor-resistant tissue-type plasminogen activator: an improved thrombolytic agent in vitro. Thromb Haemost. 1994;71:124-128.[Medline] [Order article via Infotrieve]
  28. Araki H, Nishi K. Effects of vascular constriction on occlusive thrombus formation of rat mesenteric artery. Thromb Res. 1986;44:39-45.[Medline] [Order article via Infotrieve]
  29. Araki H, Nishi K, Jougasaki M. Effects of thrombosis on vascular tone in rat mesenteric arteries with endothelium in vivo. Circ Res. 1990;67:312-318.[Abstract/Free Full Text]
  30. Araki H, Nishi K, Ishihara N, Okajima K. Inhibitory effects of activated protein C and heparin on thrombotic arterial occlusion in rat mesenteric arteries. Thromb Res. 1991;62:209-216.[Medline] [Order article via Infotrieve]
  31. Madison EL, Goldsmith EJ, Gerard RD, Gething M-J, Sambrook JF. Serpin-resistant mutants of human tissue-type plasminogen activator. Nature. 1989;339:721-725.[Medline] [Order article via Infotrieve]
  32. Bassel-Duby R, Jiang R, Bittick T, Madison E, McGookey D, Orth K, Shohet RS, Sambrook J, Gething MJ. Tyrosine 67 in the epidermal growth factor-like domain of tissue-type plasminogen activator is important for clearance by a specific hepatic receptor. J Biol Chem. 1992;267:9668-9677.[Abstract/Free Full Text]
  33. Suzuki S, Saito M, Suzuki N, Kato H, Nagaoka N, Yoshitake S, Mizuo H, Yuzuriha T, Yui Y, Kawai C. Thrombolytic properties of a novel modified human tissue-type plasminogen activator (E6010): a bolus injection of E6010 has equivalent potency of lysing young and aged canine coronary thrombi. J Cardiovasc Pharmacol. 1991;17:738-746.[Medline] [Order article via Infotrieve]
  34. Keyt BA, Paoni NF, Refino CJ, Berleau L, Nguyen H, Chow A, Lai J, Pena L, Pater C, Ogez J, Etchverry T, Botstein D, Bennett WF. A faster-acting and more potent form of tissue plasminogen activator. Proc Natl Acad Sci U S A. 1994;91:3670-3674.[Abstract/Free Full Text]
  35. Sambrook JF, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory; 1989.
  36. Furlong AM, Thomsen DR, Marotti KR, Post LE, Sharma SK. Active human tissue plasminogen activator secreted from insect cells using a baculovirus vector. Biotech Appl Biochem. 1988;10:454-464.[Medline] [Order article via Infotrieve]
  37. Harlow E, Lane D. Antibodies: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory; 1988.
  38. Revelle BM, Scott D, Kogan TK, Zheng J, Beck PJ. Structure-function analysis of P-selectin sialyl Lewisx binding interactions: mutagenic alteration of ligand binding specificity. J Biol Chem. 1996;271:4289-4297.[Abstract/Free Full Text]
  39. Ranby M, Norman B, Wallen P. A sensitive assay for tissue plasminogen activator. Thromb Res. 1982;27:743-749.[Medline] [Order article via Infotrieve]
  40. Larsen GR, Henson K, Blue Y. Variants of human tissue-type plasminogen activator. J Biol Chem. 1988;263:1023-1029.[Abstract/Free Full Text]
  41. Hjemdahl P, Chronos NAF, Wilson DJ, Bouloux P, Goodall AH. Epinephrine sensitizes human platelets in vivo and in vitro as studied by fibrinogen binding and P-selectin expression. Arterioscler Thromb. 1994;14:77-84.[Abstract/Free Full Text]
  42. Lijnen HR, Nelles L, van Hoef B, Demarsin E, Collen D. Characterization of a chimeric plasminogen activator consisting of amion acid 1-274 of tissue-type plasminogen activator and amino acid 138-411 of single-chain urokinase type plasminogen activator. J Biol Chem. 1988;263:19083-19091.[Abstract/Free Full Text]
  43. Novokhatny V, Medved L, Lijnen HR, Ingham K. Tissue-type plasminogen activator (tPA) interacts with urokinase-type plasminogen activator (uPA) via tPA's lysine binding site: an explanation of the poor fibrin affinity of recombinant tPA/uPA chimeric molecules. J Biol Chem. 1995;270:8680-8685.[Abstract/Free Full Text]
  44. Boutaud A, Castellino FJ. The construction and expression of chimeric urokinase-type plasminogen activator genes containing kringle domains of human plasminogen. Arch Biochem Biophys. 1993;303:222-230.[Medline] [Order article via Infotrieve]
  45. Collen D. Designing thrombolytic agents: focus on safety and efficacy. Am J Cardiol. 1992;69:71A-81A.[Medline] [Order article via Infotrieve]
  46. Bode C, Matsueda G, Hui KY, Haber E. Antibody-directed urokinase: a specific fibrinolytic agent. Science. 1985;229:765-767.[Abstract/Free Full Text]
  47. Holveot P, Laroche Y, Stassen JM. Pharmacokinetic and thrombolytic properties of chimeric plasminogen activators consisting of a single chain Fv fragment of a fibrin-specific antibody used to single-chain urokinase. Blood. 1993;81:696-703.[Abstract/Free Full Text]
  48. Dewerchin M, Vandamme AM, Holvoet P, De Cock F, Lemmens G, Lijnen HR, Stassen JM, Collen D. Thrombolytic and pharmacokinetic properties of a recombinant chimeric plasminogen activator consisting of a fibrin fragment D-dimer specific humanized monoclonal antibody and a truncated single-chain urokinase. Thromb Haemost. 1992;68:170-179.[Medline] [Order article via Infotrieve]
  49. Dwerchin M, Lijnen HR, Van Hoef B, De Cock F, Collen D. Biochemical properties of conjugates of urokinase-type plasminogen activator with a monoclonal antibody specific for cross-linked fibrin. Eur J Biochem. 1989;185:141-149.[Medline] [Order article via Infotrieve]
  50. Wong CS, Gamble JR, Skinner MP, Lucas CM, Berndt MC, Vadas MA. Adhesion protein GMP140 inhibits superoxide anion release by human neutrophils. Proc Natl Acad Sci U S A. 1991;88:2397-2401.[Abstract/Free Full Text]
  51. Gamble JR, Skinner MP, Berndt MC, Vadas MA. Prevention of activated neutrophil adhesion to endothelium by soluble adhesion protein GMP140. Science. 1990;249:414-417.[Abstract/Free Full Text]
  52. Lefer AM, Ma XL. PMN adherence to cat ischemic-reperfused mesenteric vascular endothelium under flow: role of P-selectin. J Appl Physiol. 1994;76:33-38.[Abstract/Free Full Text]
  53. Folts JD, Crowell EB, Rowe GG. Platelet aggregation in partially obstructed vessels and its elimination with aspirin. Circulation. 1976;54:365-370.[Abstract/Free Full Text]
  54. Bush LR, Champbell WB, Buja LM, Tilton GD, Willerson JT. Effects of the selective thromboxane synthetase inhibitor dazoxiben on variations in coronary blood flow in stenosed canine coronary arteries. Circulation. 1984;69:1161-1170.[Abstract/Free Full Text]
  55. Coller BS, Scudder LE. Inhibition of dog platelet function by in vivo infusion of F(ab')2 fragments of a monoclonal antibody to the platelet glycoprotein IIb/IIIa receptor. Blood. 1985;66:1456-1459.[Abstract/Free Full Text]
  56. Eidt JF, Allison P, Noble S, Ashton J, Golino P, McNatt J, Buja M, Willerson JT. Thrombin is an important mediator of platelet aggregation in stenosed canine coronary arteries with endothelial injury. J Clin Invest. 1989;84:18-25.
  57. Nicolini FA, Nichols WW, Metha JL, Saldeen TG, Schofield R, Ross M, Player DW, Pohl GB, Mattsson C. Sustained reflow in dogs with coronary thrombosis with K2P, a novel mutant of tissue-plasminogen activator. J Am Coll Cardiol. 1992;20:228-235.[Abstract]



This article has been cited by other articles:


Home page
BloodHome page
B.-S. Ding, N. Hong, J.-C. Murciano, K. Ganguly, C. Gottstein, M. Christofidou-Solomidou, S. M. Albelda, A. B. Fisher, D. B. Cines, and V. R. Muzykantov
Prophylactic thrombolysis by thrombin-activated latent prourokinase targeted to PECAM-1 in the pulmonary vasculature
Blood, February 15, 2008; 111(4): 1999 - 2006.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
K. Danielyan, B.-S. Ding, C. Gottstein, D. B. Cines, and V. R. Muzykantov
Delivery of Anti-Platelet-Endothelial Cell Adhesion Molecule Single-Chain Variable Fragment-Urokinase Fusion Protein to the Cerebral Vasculature Lyses Arterial Clots and Attenuates Postischemic Brain Edema
J. Pharmacol. Exp. Ther., June 1, 2007; 321(3): 947 - 952.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Zaitsev, K. Danielyan, J.-C. Murciano, K. Ganguly, T. Krasik, R. P. Taylor, S. Pincus, S. Jones, D. B. Cines, and V. R. Muzykantov
Human complement receptor type 1-directed loading of tissue plasminogen activator on circulating erythrocytes for prophylactic fibrinolysis
Blood, September 15, 2006; 108(6): 1895 - 1902.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B.-S. Ding, C. Gottstein, A. Grunow, A. Kuo, K. Ganguly, S. M. Albelda, D. B. Cines, and V. R. Muzykantov
Endothelial targeting of a recombinant construct fusing a PECAM-1 single-chain variable antibody fragment (scFv) with prourokinase facilitates prophylactic thrombolysis in the pulmonary vasculature
Blood, December 15, 2005; 106(13): 4191 - 4198.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
A. Katoh, H. Ikeda, T. Murohara, N. Haramaki, H. Ito, and T. Imaizumi
Platelet-Derived 12-Hydroxyeicosatetraenoic Acid Plays an Important Role in Mediating Canine Coronary Thrombosis by Regulating Platelet Glycoprotein IIb/IIIa Activation
Circulation, December 22, 1998; 98(25): 2891 - 2898.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
S. C. Makrides
Therapeutic Inhibition of the Complement System
Pharmacol. Rev., March 1, 1998; 50(1): 59 - 88.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fujise, K.
Right arrow Articles by Beck, P. J.
Right arrow Search for Related Content