(Circulation. 1997;95:1523-1531.)
© 1997 American Heart Association, Inc.
Articles |
From Cardiology Research, the VA Medical Center and Baylor College of Medicine, Houston, Tex.
Correspondence to Anne A. Knowlton, MD, Cardiology Research, 151C, VA Medical Center, 2002 Holcombe, Houston, TX 77030.
| Abstract |
|---|
|
|
|---|
Methods and Results Isolated adult feline cardiocytes were treated with a 14-mer phosphorothioate antisense (AS) to HSP 72 and then exposed to mild (8 hours) or severe (12 hours) hypoxia. With mild hypoxia, an increase in LDH release, a decrease in MTT uptake, and a decrease in live-to-dead ratios were seen in AS-treated cells compared with control cells and cells treated with the complementary sense sequence or with AS to major histocompatibility complex I. AS treatment converted mild hypoxic injury to a pattern of cell injury seen with severe injury. After severe hypoxia, all treatment groups showed an increase in LDH, a decrease in MTT uptake, and a decrease in live-to-dead ratios; AS-treated cells had the greatest increase in cell injury. AS treatment produced a 40% decrease in HSP 72 levels after hypoxia compared with control cells treated with hypoxia. A dose-response study showed inhibition of the increase in HSP 72 with as little as 5 µg (1.24 µmol/L) of AS.
Conclusions (1) Blocking an increase in HSP 72 with AS increases the susceptibility of adult cardiac myocytes to hypoxic injury. (2) HSP 72 is an important part of the normal cell response to stress and is important in protecting cardiac myocytes from hypoxia and reoxygenation.
Key Words: proteins, heat shock hypoxia ischemia antisense major histocompatibility complex 1
| Introduction |
|---|
|
|
|---|
Freshly isolated adult feline cardiocytes were treated with a 14-mer phosphorothioate AS to HSP 72 and then subjected to either mild (8 hours) or severe (12 hours) hypoxia. All measured parameters of injury, LDH release, MTT uptake, and live-to-dead ratio, demonstrated that AS increased susceptibility to hypoxic injury, whereas S and a second control AS oligonucleotide had no effect. AS treatment converted mild hypoxia to severe hypoxia. With severe hypoxia, although all indices of injury were worse for the AS-treated cells, the difference was not significant compared with control hypoxic cells. Thus, the beneficial effect of the increase in HSP 72 in response to hypoxia could be overcome by severe hypoxia. AS-treated cardiocytes had reduced levels of HSP 72 after hypoxia compared with control hypoxic cells. Blocking the endogenous stress response is deleterious to isolated adult cardiac myocytes. Thus, these findings suggest that the endogenous response of the cell to stress is protective and that the loss of this stress response may be maladaptive. The results of this study constitute the initial demonstration that AS DNA can be used in adult cardiac myocytes.
| Methods |
|---|
|
|
|---|
Hypoxia
Cells were made hypoxic by exposure to 90% nitrogen/10% carbon
dioxide in a specially designed chamber (Billups-Rothenberg). The
degree of hypoxia was monitored with an oxygen probe (Lazar, Inc) that
was mounted in the hypoxia chamber. The tip of the probe was immersed
in deionized water, and the amount of dissolved oxygen was monitored.
The dissolved oxygen declined from 140 mm Hg
(PO2) at baseline to 30 to 35 mm Hg with
hypoxia. This measurement remained stable over the course of the
experiment. During hypoxia, to prevent the cells from switching to
glycolysis, cells were incubated in modified DMEM without glucose or
glutamine (DMEM base, Gibco BRL). After hypoxia, cells were switched to
medium 199.
AS Oligonucleotide and Controls
AS and S Nucleotides
A 14-base phosphorothioate AS nucleotide
(5'-CAGGTCGATGCCGA-3') was synthesized by the Baylor Nucleic Acid
Core Facility to a highly conserved region of human HSP 72, the
inducible form of HSP 70. This sequence, 5'-TCGGCATCGACCTG-3' (S),
corresponds to bases 508 to 521 in the human gene24 and
occurs very close to the translation start site at base 489. A search
of the NIH Genbank for mammalian genes with the same sequence
identified 18 different exact matches, all HSP 70 genes from various
species, including human, cow, pig, rat, hamster, and mouse. Based on
this range of species containing the sequence and the overall high
conservation of the HSP 70 genes, it seemed likely that the cat gene,
which has not been cloned, would contain the same sequence. The search
also confirmed the specificity of the sequence, because only variants
of HSP 72 matched. Comparison of this sequence for human HSP 72 with
the human HSC 70 (the constitutive HSP 70), both of which code for the
amino acid sequence VGIDL, showed 5 of 14 bases mismatched
(TTGGTATTGATCTT).24 25 Thus, there is significant
sequence difference between HSC 70 and HSP 72 in this 14-base region.
The S form of the sequence 5'-TCGGATCGACCTG-3' was used as a
control.
A second control was the 14-base AS phosphorothioate oligonucleotide to MHCI, which corresponded to bases 178 to 191 of the cat gene (AS sequence, 5'-GCGTCGCTGTCGAA3').26 This second AS was used to control for activation of RNase H by dimer formation (between mRNA and AS). The S oligonucleotide will not form a dimer, unlike the AS. Therefore, to determine whether the increased susceptibility to hypoxia seen with AS to HSP 72 was secondary to activation of RNase H through formation of a dimer or whether this was a specific effect of AS to HSP 72, we used a second AS as a control. This second AS oligonucleotide has a purine/pyrimidine composition almost identical to the composition of the AS for HSP 72.
To confirm the presence of MHCI in the feline cardiocytes,
immunocytochemistry was performed. Briefly, cells were fixed for 5
minutes in 3.7% paraformaldehyde and 0.1% Triton X-100. After being
washed with PBS, the cells were incubated for 1 hour with an
anti-feline MHCI, followed by washing and incubation with an alkaline
phosphataseconjugated anti-mouse IgG. Sections were treated with
alkaline phosphatase enhancer and then developed with Fast Red
chromagen (Biomeda Corp). Second antibody alone was used as a control.
A panel of mouse monoclonal antibodies to feline MHCI was the generous
gift of William C. Davis (Washington State University, Pullman). The
antibodies (tissue culture supernatants) were used in a 1:50 dilution.
Anti-mouse IgG (Amersham) was used in a 1:100 concentration. These
antibodies confirmed the presence of MHCI (Fig 1A
).
|
Likewise, to verify that MHCI AS treatment resulted in a reduction of
MHCI, we used semiquantitative PCR because Western blotting was not
feasible in this membrane-bound protein and immunocytochemistry not
sufficiently quantitative. RNA was isolated with RNA Stat-60 (Tel-test
B). Because only small quantities of RNA can be isolated from the
isolated cardiocytes and the amount of MHCI message is low,
semiquantitative PCR of total RNA was used as well to compare levels of
MHCI mRNA. Two primers spanning part of the coding sequence were used
(Genbank sequence CATMHCIGLA). The primers, ACACCGCACAGATTTCCCGAGTGA
(S, 301 to 324) and CCTCCAGGTAGTTCCTCTCCTGCT (AS, 556 to 579),
generate a 279-bp product. PCR amplification of total RNA was performed
by denaturing 1 µg total RNA at 950°C for 3 minutes in a volume of
10 µL containing 1x RT buffer (Gibco BRL), 1.0 µmol/L AS
primer, and 1.0 mmol/L dNTP. Reverse transcription was initiated
by addition of 5 µL RT mix (1.5 µL RT; Promega, 10 U/µL), 1.5
µL RNAsin (Promega, 40 U/µL), 1.5 µL 0.1 mol/L DTT, and 0.5 µL
10x RT buffer) at 370°C for 60 minutes. To control for possible DNA
contamination, RNA samples were incubated in the reaction mixture
without RT. Amplification was performed by addition of 16 µL PCR mix
to 4 µL of the newly generated cDNA product, which yields 1x PCR
buffer, 0.2 mmol/L dNTP, 0.2 µmol/L of primer pairs,
1.5 mmol/L MgSO4, and 0.05 U/µL Taq
polymerase. PCR amplification was carried out for 40 cycles with an
annealing temperature of 550°C in an Eppendorf thermal cycler (model
5330). Otherwise, conditions were as previously
described.27 The reaction products were separated on a
1.5% agarose gel, stained with ethidium bromide, and photographed
under UV light for comparison. Cells treated with AS to MHCI had a
reduction in mRNA for MHCI compared with control cells and cells
treated with AS to HSP 72 (Fig 1B
), showing that AS to MHCI decreases
MHCI expression.
Uptake of Oligonucleotide
AS oligonucleotide (2.5 µg) was end-labeled with
[
-32P]ATP (Amersham) with T4 polynucleotide kinase
(Promega). Labeled oligonucleotide was purified with a spin column
(P30, BioRad) to remove unbound [
-32P]ATP. The labeled
oligonucleotide was mixed with 470 µg cold oligonucleotide, and 10
and 20 µg (2.27 and 4.54 µmol/L) oligonucleotide was added to
cardiocytes plated on P35 Petri dishes. Samples were collected over a
time course by washing the plates three times with PBS and lysing the
cells with isolation detergent (0.02% SDS in 4 mmol/L
Tris/1.5 mmol/L PMSF, pH 7.4). The cell lysate was then
precipitated with 10% ice-cold TCA, collected on a filter with a
manifold (Millipore), and washed with 5% TCA and then 95% ethanol.
The filter was dried and counted in a scintillation counter (LS60001C,
Beckmann).
Indices of Injury
LDH levels were measured on media samples with a colorimetric
assay (Sigma Chemical Co) measuring the conversion of pyruvic acid to
lactic acid by LDH.
MTT
Mitochondrial function, which correlates with overall cell
viability, was determined with MTT. Tetrazolium salts are reduced by
the respiratory chain; in the reduced state, MTT turns blue, which can
be quantified with a spectrophotometer.28 MTT is reduced
in both the early and late portions of the respiratory chain, so
assessment of its reduction allows evaluation of the entire respiratory
chain. For our purposes, cells were grown in 96-well microtiter plates
(Falcon, Becton Dickinson) coated with 0.2% laminin. A second plate
containing serial dilutions of normoxic myocytes from 10 000 to 312
cells per well was used as a reference standard curve for mitochondrial
function. Originally, 10 000 cells were plated in each well. After 24
hours, the medium was changed to DMEM base (no phenol red, no glucose,
and no glutamine), and the cells were exposed to hypoxia. With each
medium change, oligonucleotides were added as described. After hypoxia,
the cells were returned to medium 199, 20 µL/well of MTT stock (5
mg/mL in PBS) was added, and the cells were returned to the incubator.
SDS (10%, pH 7.2) was added after 4 hours of incubation with MTT, the
cells were incubated overnight, and optical density was measured with a
microtiter plate reader at 600 nm (Molecular Devices). The optical
density for each well was compared against the standard curve derived
from the normoxic control serial dilution of cells, and the number of
cells obtained from the standard curve was divided by the number
originally plated to give percent uptake of MTT.
Live-to-dead ratios, a simple index of cell viability, were determined by counting of a minimum of 60 cells per plate after the cells were incubated for 30 minutes with 1.05 µmol/L calcein AM and 4.0 µmol/L ethidium homodimer (Molecular Probes). The cells were then viewed under ultraviolet light. Live cells take up the calcein AM and are stained green, whereas dead and dying cells take up the ethidium homodimer and are stained red.29 Cells were scored as live or dead by an investigator blinded to treatment group.
Assessment of AS Effect
An ELISA recently developed in our laboratory by a previously
described approach was used to measure HSP 72 levels.30 31
This assay is similar to that described by Gutierrez and
Guerriero.32 The assay is a competitive type in which the
plate (Immulon I, Dynatech) is coated overnight with antigen (HSP 72,
0.03 µg/mL, Stress-Gen), and this antigen competes with unbound
antigen, either known standards or samples, to bind with antibody
(1:3000 dilution of antiHSP 72, Stress-Gen). After being coated, the
plate is blocked for 15 minutes at room temperature with 1% gelatin
(BioRad). Then the plate is washed and the samples and antiHSP 72
antibody are loaded. The mouse monoclonal antibody to HSP 72 (subtype
IgG1) used in the assay is widely used to study levels of HSP 72, and
its specificity has been well established.33 34 35 36 37 After
incubation overnight with the samples and first antibody, the plate is
washed and anti-mouse IgG-HRP (horseradish peroxidase, Amersham) is
added at a 1:1000 dilution for 4 hours. After incubation, the plate is
incubated with a substrate, OPD (o-phenylene diamine,
Sigma), for 30 minutes. The reaction was stopped with 4 mol/L
H2SO4. The plate was read in an ELISA plate
reader at 490 nm (Molecular Devices). This assay generates a linear
standard curve between 1 and 250 ng on a semilogarithmic plot. As we
assay 5 to 10 µL of sample, we are measuring 10 to 40 ng of HSP 72.
The results from this assay correlate well with measurements by Western
blotting on the same samples.30 Because the assay uses
human HSP 72 protein as a standard and feline HSP 72 is being assayed,
results are expressed as U/µg protein (converting nanograms to
units). Minor between-species variation in avidity of binding to the
antibody can alter the actual measured value but will not alter the
relative amounts measured in different samples. The levels of HSP 72
measured in the feline cardiac myocytes were similar to levels measured
by Gutierrez and Guerriero in the bovine heart.32
Western blot analyses for HSP 60, HSP 72, and HSC 70 were performed as previously described.38 AntiHSP 72 mouse monoclonal antibody (SPA-810, Stress-Gen) was used in a 1:2500 dilution. AntiHSC 70 mouse monoclonal antibody (an IgM, MA3-014, Affinity Bioreagents) was used in a 1:5000 dilution. AntiHSP 60 antibody (Stress-Gen) was used at a 1:5000 dilution.
Protein concentrations were determined with a bicinchoninic acid assay (Pierce).
Protein Labeling and Immunoprecipitation
To determine whether new synthesis of HSP 72 occurred after
hypoxia in either the presence or absence of AS to HSP 72, cells were
treated with [35S]methionine (100 µCi/mL medium) for 4
hours after hypoxia. Cells were then washed twice with PBS and
solubilized by scraping into ice-cold RIPA buffer (pH 7.4, 50
mmol/L Tris, 1% NP-40, 0.25% deoxycholate, 150 mmol/L NaCl,
1 mmol/L EGTA, 1 mmol/L PMSF, and 1 µg/mL each of
aprotinin, pepstatin, and leupeptin). Protein concentrations were
measured as above, and an equal quantity of total protein was
immunoprecipitated for each sample. The lysate was incubated on a
rocker panel at 40°C for 15 minutes with protein Gsepharose, then
centrifuged in a microfuge (16 000g) for 5 minutes at
40°C to clear the lysate. The lysate was then incubated overnight on
the rocker panel at 40°C with antiHSP 72 (SPA-810), followed by the
addition of protein Gsepharose for either 2 hours or overnight on a
rocker panel at 40°C. The sample was collected by centrifuging as
above, and three washes with RIPA buffer were performed. The whole
process was repeated on the supernatant to ensure that the lysate had
been exhaustively precipitated and that no HSP 72 remained in the
lysate. Thus, any findings can be interpreted as being
semiquantitative. The final beads for each incubation were collected,
resuspended in sample buffer, and separated on a 10% SDS-PAGE.
Immunoprecipitation from two different plates was combined for each
lane. The gel was fixed in isopropanol and acetic acid, soaked in
Amplify (Amersham), dried, and exposed to a preflashed film (Amersham)
for 10 days.
Northern blot analysis of HSP72 levels was performed as previously described.7
Statistics and Data Analysis
All results are reported as mean±SEM with the exception of the
LDH and MTT data, which are reported as mean±SD. Results represent the
mean of two or more experiments with multiple data determinations in
each experiment. Data were compared by one-way ANOVA followed by a
Student-Newman-Keuls test. Data comparing normalized values with
control values were compared with an ANOVA on ranks (Kruskal-Wallis)
followed by a Dunn's test; if data samples passed tests of normality
and of equal variance, one-way ANOVA was performed. All statistical
analysis was performed with Sigma-Stat (Jandel). A value of
P<.05 was considered significant.
| Results |
|---|
|
|
|---|
|
Pilot experiments were done to define the effect of hypoxia on the isolated adult cardiac myocytes. As a result of these pilot experiments, two different durations of hypoxia were selected for study: 8 hours for mild injury and 12 hours for severe injury. Eight hours of hypoxia results in a reduction in MTT metabolism, reflecting impaired mitochondrial function but no release of LDH, whereas 12 hours of hypoxia results in LDH release and a greater reduction in MTT metabolism (data below).
These two different hypoxia treatment times were used to examine the
effect of AS with mild and severe hypoxia. Cells received either
diluent, 2.27 µmol/L S, or 2.27 µmol/L AS
oligonucleotide. Because immunocytochemistry demonstrated that MHCI was
present in the isolated cardiocytes (Fig 1A
), in a subset of
experiments a second control was added with 2.27 µmol/L of
AS-MHCI.
Mild Hypoxia
LDH levels were determined on samples of medium collected
immediately after reoxygenation after 8 hours of hypoxia. Neither S nor
AS treatment in the absence of hypoxia had any affect on LDH values, as
shown in Fig 3A
. With hypoxia, however, AS-treated
myocytes had a significant increase in LDH, with a level of 1.77±0.12
versus 1.32±0.14 U/µg protein for S-treated (P<.05
versus all other groups, data not shown).
|
An MTT uptake assay, which assesses mitochondrial function, was used as
a second index of cell injury. As shown in Fig 3B
, myocytes not exposed
to hypoxia had MTT uptake in the
100 range, with no difference among
control, S-treated, and AS-treated myocytes. With hypoxia, all groups
had a significant reduction in MTT uptake, but that of the AS-treated
group was significantly lower than that of the S-treated group,
77.1±1.3% versus 91.5±1.6% (P<.05 versus all other
groups, data not shown).
Live-to-dead staining, as shown in Fig 4
, was done after
reoxygenation. With hypoxia, the percentage of live cells fell
significantly only in cells treated with AS, 72.3±3.2%
(P<.05 compared with all other groups, Fig 3C
), whereas
S-treated cells exposed to hypoxia had 90.2±3.6% live cells, no
different from normoxic cells.
|
HSP 72 levels were determined on myocytes treated with the same
protocol with an ELISA (Fig 5
). In untreated cardiac
myocytes, levels of HSP 72 were 1.92±0.12 U/µg protein. After
reoxygenation for 4 hours, HSP 72 levels were 3.23±0.28 U/µg protein
in diluent-treated cells and 2.31±0.35 U/µg protein in AS-treated
myocytes (P<.05). Thus, HSP 72 levels did increase with
hypoxia and reoxygenation, and this increase was blocked in AS-treated
cells.
|
Severe Hypoxia
To further examine the effect of AS treatment on the response to
hypoxic injury, myocytes were treated with 12 hours of hypoxia. As
illustrated in Fig 6A
, all groups had similar levels of
LDH in the absence of hypoxia; the level for S-treated cells was
1.13±0.08 U/µg protein. Posthypoxia LDH levels in all four groups
were elevated compared with normoxia (P<.05) in contrast to
8 hours of hypoxia. The AS-treated myocytes had the highest level of
LDH with hypoxia, 2.07±0.08 U/µg protein, significantly higher than
S-treated cells (1.92±0.09 U/µg protein, data for other groups not
shown).
|
Although the amount of LDH released was higher after 12 hours of hypoxia than after 8 hours, to ensure that we were not missing a later release, LDH levels were measured after 12 hours of hypoxia followed by 4 hours of reoxygenation (the latter in medium 199). All four groups showed low levels of LDH in their media, 1.06±0.10 (control), 1.15±0.01 (S), 1.05±0.02 (AS), and 1.04±0.06 (MHCI) U/µg protein at the second time point.
After 12 hours of hypoxia, all groups showed decreased metabolism of
MTT (Fig 6B
). Normoxic myocytes had MTT uptake rates of 93.5% to 100%
plus. After hypoxia, MTT uptake was decreased at 74.0±1.8% in S- and
67.0±2.5% in AS-treated myocytes (P<.05 versus normoxic;
data for other groups not shown but also significantly reduced).
As expected, live-to-dead ratios after 12 hours of hypoxia were lower
than observed after 8 hours of hypoxia (Fig 6C
). Although the
AS-treated cells had the lowest live-to-dead ratio (59.5±3.8%), this
was not significantly different from the other groups after 12 hours of
hypoxia.
HSP 72 levels were assayed in myocytes subjected to the same protocol
(Fig 7
). In untreated cardiac myocytes, the HSP 72
levels were 1.28±0.08 U/µg protein, whereas in cells treated with AS
but not exposed to hypoxia, levels were 1.08±0.10 U/µg protein.
After 12 hours of hypoxia and reoxygenation, HSP 72 levels were
2.58±0.08 and 1.60±0.19 U/µg protein in control and AS-treated
cells (P<.05).
|
To determine whether treatment with higher concentrations of AS
resulted in a greater decrease in HSP 72, a dose-response experiment
was done (Fig 8
). Cells were pretreated with AS and then
subjected to 8 hours of hypoxia followed by 4 hours of reoxygenation.
The HSP 72 levels were 2.45±0.23 (2.27 µmol/L AS), 2.65±0.24
(4.54 µmol/L), and 2.49±0.23 (11.35 µmol/L) U/µg
protein (P=NS). This compares with levels of 4.33±0.54
U/µg protein seen in cells treated with diluent only. These results
are consistent with the findings with the uptake of labeled
oligonucleotide, as shown in Fig 2
. The effect of lower doses was
analyzed in a separate experiment using 1 and 5 µg AS, or 0.23 and
1.13 µmol/L, respectively. As shown in the lower panel of Fig 8
,
1.13 µmol/L AS significantly reduced HSP 72 in hypoxia-treated
cells (8 hours), 2.17±0.34 versus 3.70±0.49 U/µg protein in cells
receiving diluent (P<.05). In contrast, although 0.23
µmol/L AS treatment was accompanied by lower HSP 72 levels, the
difference was not significant (2.66±0.14) compared with control
cells.
|
The effects of AS treatment after 8 hours were compared with the effects of 8 and 12 hours of hypoxia. With AS treatment and 8 hours of hypoxia, LDH was increased to 1.77±0.12 U/µg protein, similar to that seen with 12 hours of hypoxia (1.78±0.11, P=NS); MTT uptake was depressed to levels similar to those seen with severe hypoxia (77.1±1.3% versus 73.0±1.9%, P=NS); and the percentage of live cells was decreased to 72.3±3.2%, indistinguishable from the low value seen with severe hypoxia (67.3±4.8%).
HSP 60, HSP 72, and HSC 70 levels were assessed by Western blotting to
demonstrate that the AS for HSP 72 was specific and did not affect
another HSP. As shown in Fig 9
, AS to HSP 72 had no
effect on HSP 60 or HSC 70 levels after hypoxia, but AS for HSP 72
blocked the increase in HSP 72 levels with hypoxia, similar to the
findings by ELISA.
|
To further demonstrate that synthesis of new HSP 72 was reduced by AS
treatment, cells were labeled with [35S]methionine for 4
hours after hypoxia. Immunoprecipitation was done on cell lysates with
antiHSP 72 antibody. As shown in Fig 10
, control
cells and cells treated with hypoxia plus AS for HSP 72 did not have
significant synthesis of HSP 72 over a period of 4 hours, whereas cells
treated with diluent only plus hypoxia had clear evidence of newly
synthesized HSP 72. A repeat immunoprecipitation was performed on the
same cell lysates to confirm that all the HSP 72 had been
immunoprecipitated, and the autoradiograph for these samples showed no
bands (data not shown), demonstrating that immunoprecipitation had been
exhaustive.
|
Northern blot analysis was performed to determine whether mRNA levels
were affected by the AS treatment or whether the AS effect was from
inhibition of translation alone. As shown in Fig 11
,
after hypoxia, mRNA levels for HSP72 were increased in control cells
but not in AS-treated cells.
|
| Discussion |
|---|
|
|
|---|
Previous studies have focused on the effects of overexpression of HSP 72 on cell viability and myocardial function after heat or hypoxic injury.17 18 19 20 These important studies have demonstrated that greatly overexpressing HSP 72 in excess of physiological levels is protective both to different cell culture lines and to the myocardium. In contrast to these earlier studies, which used overexpression of HSP 72 to study its protective effect against heat injury or hypoxia, we demonstrate that reduction of the physiological increase in HSP 72 in response to cellular stress makes mature cardiac myocytes more susceptible to injury. Whereas in experiments involving overexpression, the superabundant levels of the protein may have additional unexpected effects, or where there was only limited transfection efficiency,17 18 19 20 39 our study uses AS technology to selectively reduce expression of HSP 72 for the first time in mature cardiocytes. The unique significance of these studies is that we were able to demonstrate the importance of HSP 72 in the endogenous stress response of cardiac myocytes after hypoxia under physiological conditions.
To study the specific effects of the AS oligonucleotide to HSP 72, we examined several indices of myocardial injury and viability. LDH release after 8 hours of hypoxia was not significantly changed compared with control cell groups in cells treated with diluent, AS-MHCI, or S. In contrast, AS treatment resulted in a significant increase in LDH release. Similarly, MTT uptake, an index of mitochondrial function, was significantly depressed in the AS-treated group compared with both diluent-treated and S-treated cells, which were only mildly depressed, as well as in normoxic cells undergoing the same treatments. Live-to-dead ratios demonstrated a mild reduction in the percentage of live cells after hypoxia; a significantly greater reduction in numbers of live cells was observed for cardiocytes treated with AS. These results correlated with reduced HSP 72 levels, which were measured on myocytes undergoing the same treatment.
To further extend these observations, more severe hypoxia was examined. After 12 hours of hypoxia, LDH was increased in all groups; although LDH levels were greater for AS-treated cells, this difference was not significant. Reoxygenation for 4 hours after 12 hours of hypoxia showed no further release of LDH over baseline. MTT uptake studies demonstrated a marked depression of MTT uptake in myocytes treated with AS and a smaller depression in the control groups. Live-to-dead ratios were further decreased after 12 hours of hypoxia, but although the ratio was lowest for AS-treated cells, this was not significant compared with other hypoxic groups. Thus, with severe injury, the benefit of HSP 72 induction in the control cells was less apparent than with mild injury.
HSP 72 levels were decreased 40% in cells treated with AS compared with controls after hypoxia. Levels of HSP 72 in AS-treated cells were unchanged from baseline levels observed in untreated control cells. Increasing the dose of AS did not increase the reduction in HSP 72 baseline levels. The half-life of HSP 72 is unknown. AS treatment will block only new synthesis; the 2.27-µmol/L dose may have been sufficient to inhibit any new synthesis of HSP 72 but would not eliminate preexisting protein. Exhaustive immunoprecipitation of 35S-labeled HSP 72 clearly showed new synthesis of HSP 72 in the control cells (diluent-treated) but not in the AS-treated cells. Some variation was seen in baseline HSP 72 levels; this reflects variation among feline hearts and variation from one cell isolation preparation to the next. All comparisons were done between cardiocytes isolated from the same heart. Northern blot analysis showed reduced levels of HSP72 mRNA compared with control cells treated with hypoxia. These findings are consistent with destruction of HSP 72 mRNA (by RNase H) or decreased transcription.
The possibility existed that the observed increase in hypoxia/reoxygenation injury with AS treatment was the result of general activation of RNase H as a response to the formation of RNA-DNA dimers (AS oligo plus mRNA for HSP 72) and that activation of this system rather than the specific AS then resulted in much more severe cellular damage when hypoxia was added. To test this, a second AS, AS-MHCI, was used as a control. Myocytes treated with this AS oligonucleotide had no evidence of increased injury either with normoxia or with hypoxia and reoxygenation.
The studies used phosphorothioate oligonucleotides, a modified form of phosphodiester in which a sulfur is substituted for one of the oxygen atoms in the phosphodiester backbone of the molecule. The resulting compound is resistant to nucleases, crosses the cell membrane, and hybridizes well with RNA. The phosphorothioate-RNA dimer activates RNase H, resulting in the destruction of the associated mRNA. These properties make these compounds suitable for both in vitro and in vivo application. There have been a number of excellent reviews of phosphorothioate compounds and AS technology.40 41 42 43 44 45 46 Cardiovascular application of AS technology has focused on smooth muscle cells and the vessel cell wall.40 41 42 Recently, several studies have described systemic effects of AS phosphorothioate compounds administered by intraperitoneal or tail-vein injection in mice.47 48
AS oligonucleotides readily entered the cardiac myocyte, as evidenced by the uptake of the 32P-labeled oligonucleotide. It was unnecessary to use any transfection agent to achieve uptake, and the concentration that was effective, 2.27 µmol/L, is similar to that observed for other cell types.41 42 Recently, Burgess et al49 reported that phosphorothioate oligonucleotides containing three or four sequential guanosine residues nonselectively inhibit smooth muscle cell growth, raising questions about some of the reported effects of AS constructs to c-myb and c-myc; however, there were significant differences between our work and some of the previous work in the AS area.41 For our own observations, we used a far lower concentration of AS than used by Burgess et al (2.27 µmol/L versus 30 µmol/L for the reported experiments and 10 to 60 µmol/L for unshown results), and our construct does not contain an unusual repeat as found in the early coding region of c-myc. Furthermore, we verified the effect of our AS by measuring the level of HSP 72, by showing suppression of new HSP 72 synthesis, and by demonstrating a decrease in mRNA for HSP 72. We demonstrated specificity by showing that expression of HSP 60 and HSC 70 were unaffected by AS to HSP 72. Last, we used a second AS oligonucleotide with very similar pyrimidine/purine content to our HSP 72 AS to demonstrate that the effect of HSP 72 AS was specific and not due to activation of RNase H.
In summary, these studies constitute the initial demonstration that blocking the endogenous HSP 72 stress response increases the vulnerability of adult cardiocytes to hypoxia and reoxygenation. Thus, these studies underscore the potential importance of the endogenous stress response in the heart and raise the interesting possibility that the reduction in the heat shock response, such as occurs in aging,50 51 52 53 may be maladaptive, because the loss of the endogenous stress response may render the heart more vulnerable to environmental stress. Although these comments are speculative, the results of the present study do suggest a fundamentally important role for the endogenous stress response in maintaining normal tissue homeostasis in the heart.
| Selected Abbreviations and Acronyms |
|---|
|
| Acknowledgments |
|---|
Received August 12, 1996; revision received October 24, 1996; accepted November 8, 1996.
| References |
|---|
|
|
|---|
2. Parsell DA, Taulien J, Lindquist S. The role of heat-shock proteins in thermotolerance. Philos Trans R Soc Lond B Biol Sci. 1993;339:279-284. [Medline] [Order article via Infotrieve]
3. Knowlton AA. The role of heat shock proteins in the heart. J Mol Cell Cardiol. 1995;27:121-131. [Medline] [Order article via Infotrieve]
4.
Cohen DM, Wasserman JC, Gullans SR. Immediate
early gene and HSP 70 expression in hyperosmotic stress in MDCK
cells. Am J Physiol. 1991;261:C594-C601.
5.
Emami A, Schwartz JH, Borkan SC. Transient
ischemia or heat stress induces a cytoprotectant protein in rat
kidney. Am J Physiol. 1991;260:F479-F485.
6.
Blake MJ, Udelsman R, Feulner GJ, Norton DD, Holbrook
NJ. Stress-induced heat shock protein 70 expression in adrenal
cortex: an adrenocorticotropic hormone-sensitive, age-dependent
response. Proc Natl Acad Sci U S A. 1991;88:9873-9877.
7. Knowlton AA, Brecher P, Apstein CS. Rapid expression of heat shock protein in the rabbit after brief cardiac ischemia. J Clin Invest. 1991;87:139-147.
8.
Dillmann WH, Mehta HB, Barrieux A, Guth BD, Neeley WE,
Ross J Jr. Ischemia of the dog heart induces the appearance of a
cardiac mRNA coding for a protein with migration characteristics
similar to heat-shock/stress protein 71. Circ Res. 1986;59:110-114.
9.
Mehta HB, Popovich BK, Dillmann WH. Ischemia
induces changes in the level of mRNAs coding for stress protein 71 and
creatine kinase M. Circ Res. 1988;63:512-517.
10. Currie RW. Effects of ischemia and perfusion temperature on the synthesis of stress-induced (heat shock) proteins in isolated and perfused rat hearts. J Mol Cell Cardiol. 1987;19:795-808. [Medline] [Order article via Infotrieve]
11. Benjamin IJ, Horie S, Greenberg ML, Alpern RJ, Williams RS. Induction of stress proteins in cultured myogenic cells: molecular signals for the activation of heat shock transcription factor during ischemia. J Clin Invest. 1992;89:1685-1689.
12.
Iwaki K, Chi S, Dillmann WH, Mestril R.
Induction of HSP 70 in cultured rat neonatal cardiomyocytes by hypoxia
and metabolic stress. Circulation. 1993;87:2023-2032.
13.
Donnelly TJ, Sievers RE, Vissern FLJ, Welch WJ,
Wolfe CL. Heat shock protein induction in rat hearts: a role for
improved myocardial salvage after ischemia and
reperfusion? Circulation. 1992;85:769-778.
14.
Hutter M, Sievers RE, Barbosa V, Wolfe CL.
Heat-shock protein induction in rat hearts.
Circulation. 1994;89:355-360.
15.
Currie RW, Tanguay RM, Kingma JG. Heat-shock
response and limitation of tissue necrosis during occlusion/reperfusion
in rabbit hearts. Circulation. 1993;87:963-971.
16.
Walker DM, Pasini E, Kucukoglu S, Marber MS,
Iliodromitis E, Ferrari R, Yellon DM. Heat stress limits infarct
size in the isolated perfused rabbit heart. Cardiovasc
Res. 1993;27:962-967.
17. Mestril R, Chi S, Sayen R, O'Reilly K, Dillmann WH. Expression of inducible stress protein 70 in rat heart myogenic cells confers protection against simulated ischemia-induced injury. J Clin Invest. 1994;93:759-767.
18. Heads RJ, Latchman DS, Yellon DM. Stable high level expression of a transfected human HSP 70 gene protects a heart-derived muscle cell line against thermal stress. J Mol Cell Cardiol. 1994;26:695-699. [Medline] [Order article via Infotrieve]
19. Plumier J-CL, Ross BM, Currie RW, Angelidis CE, Kazlaris H, Kollias G, Pagoulatos GN. Transgenic mice expressing the human heat shock protein 70 have improved post-ischemic myocardial recovery. J Clin Invest. 1995;95:1854-1860.
20. Marber MS, Mestril R, Chi S-H, Sayen MR, Yellon DM, Dillmann WH. Overexpression of the rat inducible 70-kD heat stress protein in a transgenic mouse increases the resistance of the heart to ischemic injury. J Clin Invest. 1995;95:1854-1860.
21.
Mann DL, Kent RL, Cooper G IV. Load regulation
of the properties of adult feline cardiocytes: growth induction by
cellular deformation. Circ Res. 1989;64:1079-1090.
22.
Mann DL, Urabe Y, Kent RL, Vinciguerra S, Cooper G
IV. Cellular versus myocardial basis for the contractile
dysfunction of hypertrophied myocardium. Circ Res. 1991;68:402-415.
23. Yokoyama T, Vaca L, Rossen RD, Durante W, Hazarika P, Mann DL. Cellular basis for the negative inotropic effects of tumor necrosis factor-I in the adult mammalian heart. J Clin Invest. 1993;92:2303-2312.
24.
Wu B, Hunt C, Morimoto RI. Structure and
expression of the human gene encoding major heat shock protein HSP
70. Mol Cell Biol. 1985;5:330-341.
25.
Dworniczak N, Mirault M-E. Structure and
expression of a human gene coding for a 71 kd heat shock `cognate'
protein. Nucleic Acid Res. 1987;15:5181-5197.
26. Yuhki N, Heidecker GF, O'Brien SJ. Characterization of MHC cDNA clones in the domestic cat: diversity and evolution of class I genes. J Immunol. 1989;142:3676-3682. [Abstract]
27.
Ma TS, Brink PA, Perryman B, Roberts R. Improved
quantification with validation of multiple mRNA species by polymerase
chain reaction: application to human myocardial creatine kinase M and
B. Cardiovasc Res. 1994;28:464-471.
28. Musser DA, Oseroff A. The use of tetrazolium salts to determine sites of damage to the mitochondrial electron transport chain in intact cells following in vitro photodynamic therapy with photofrin II. Photochem Photobiol. 1994;59:321-326.
29.
Kirshenbaum LA, Schneider MD. Adenovirus E1A
represses cardiac gene transcription and reactivates DNA synthesis in
ventricular myocytes, via alternative pocket protein- and p300-binding
domains. J Biol Chem. 1995;270:7791-7794.
30.
Nakano M, Knowlton AA, Yokoyama T, Lesslauer W,
Mann DL. Tumor necrosis factor-I-induced expression of heat
shock protein 72 in adult feline cardiac myocytes.
Am J Physiol. 1996;270:H1231-H1239.
31.
Knowlton AA, Burrier RE, Brecher P. Rabbit heart
fatty acid binding protein: isolation, characterization, and
application of a monoclonal antibody. Circ Res. 1989;65:981-988.
32. Gutierrez JA, Guerriero V Jr. Quantitation of HSP 70 in tissues using a competitive enzyme-linked immunosorbent assay. J Immunol Methods. 1991;143:81-88. [Medline] [Order article via Infotrieve]
33.
Welch WJ, Suhan JP. Cellular and biochemical
events in mammalian cells during and after recovery from physiological
stress. J Cell Biol. 1986;103:2035-2052.
34.
Welch WJ, Mizzen LA. Characterization of the
thermotolerant cell, II: effects on the intracellular distribution of
heat-shock protein 70, intermediate filaments, and small nuclear
ribonucleoprotein complexes. J Cell Biol. 1988;106:1117-1130.
35.
Li GC, Li L, Liu Y, Mak JY, Chen L, Lee WMF.
Thermal response of rat fibroblasts stably transfected with the human
70-kDa heat shock protein-encoding gene. Proc Natl Acad
Sci U S A. 1991;88:1681-1685.
36.
Milarski KL, Morimoto RI. Expression of human
HSP70 during the synthetic phase of the cell cycle. Proc
Natl Acad Sci U S A. 1986;83:9517-9521.
37.
Riabowol KT, Mizzen LA, Welch WJ. Heat shock is
lethal to fibroblasts microinjected with antibodies against HSP
70. Science. 1988;242:433-436.
38. Knowlton AA, Eberli FR, Brecher P, Romo GM, Owen A, Apstein CS. A single myocardial stretch or decreased systolic fiber shortening stimulates the expression of heat shock protein 70 in the isolated, erythrocyte-perfused rabbit heart. J Clin Invest. 1991;88:2018-2025.
39. Williams RS, Thomas JA, Fina M, German Z, Benjamin IJ. Human heat shock protein 70 (HSP 70) protects murine cells from injury during metabolic stress. J Clin Invest. 1993;92:503-508.
40. Simons M, Edelman ER, DeKeyser J, Langer R, Rosenberg RD. Antisense c-myb oligonucleotides inhibit intimal arterial smooth muscle cell accumulation in vivo. Nature. 1992;359:67-70. [Medline] [Order article via Infotrieve]
41.
Shi Y, Hutchinson HG, Hall DJ, Zalewski A.
Downregulation of c-myc expression by antisense
oligonucleotides inhibits proliferation of human smooth muscle
cells. Circulation. 1993;88:1190-1195.
42. Bennett MR, Anglin S, McEwan JR, Jagoe R, Newby AC, Evan GI. Inhibition of vascular smooth muscle cell proliferation in vitro and in vivo by c-myc antisense oligonucleotides. J Clin Invest. 1994;93:820-828.
43. Leonetti JP, Degols G, Clarenc JP, Mechti N, Lebleu B. Cell delivery and mechanisms of action of antisense oligonucleotides. Prog Nucleic Acid Res. 1993;44:143-166. [Medline] [Order article via Infotrieve]
44.
Whitesell L, Neckers L. Antisense technology:
biological utility and practical considerations. Am
J Physiol. 1993;265:L1-L12.
45. Cazenave C, Hélène C. Antisense oligonucleotides. In: Mol JNM, van der Krol AR, eds. Antisense Nucleic Acids and Proteins: Fundamentals and Applications. New York, NY: Marcel Dekker Inc; 1991:47-93.
46. Marcus-Sekura CJ. Techniques for using antisense oligodeoxyribonucleotides to study gene expression. Anal Biochem. 1988;172:289-295. [Medline] [Order article via Infotrieve]
47.
Dean NM, McKay R. Inhibition of protein kinase
C-I expression in mice after systemic administration of
phosphorothioate antisense oligonucleotides. Proc Natl
Acad Sci U S A. 1994;91:11762-11766.
48.
Cossum PA, Sasmor H, Dellinger D, Truong L, Cummins L,
Owens SR, Markham PM, Shea JP, Crooke S. Disposition of the
14C-labeled phosphorothioate oligonucleotide ISIS 2105 after
intravenous administration in rats. J Pharmacol Exp
Ther. 1993;267:1181-1190.
49.
Burgess TL, Fisher EF, Ross SL, Bready JV, Qian Y-X,
Bayewitch LA, Cohen AM, Herrera CJ, Hu SS-F, Kramer TB, Lott FD, Martin
FH, Pierce GF, Simonet L, Farrell C. The antiproliferative
activity of c-myb and c-myc antisense oligonucleotides in smooth muscle
cells is caused by a nonantisense method. Proc Natl Acad
Sci U S A. 1995;92:4051-4055.
50.
Liu AY, Lin Z, Choi H, Sorhage F, Li B.
Attenuated induction of heat shock gene expression in aging diploid
fibroblasts. J Biol Chem. 1989;264:12037-12045.
51. Luce MC, Cristofalo VJ. Reduction in heat shock gene expression correlates with increased thermosensitivity in senescent human fibroblasts. Exp Cell Res. 1992;202:9-16. [Medline] [Order article via Infotrieve]
52. Udelsman R, Blake MJ, Stagg CA, Li D, Putney DJ, Holbrook NJ. Vascular heat shock protein expression in response to stress: endocrine and autonomic regulation of this age-dependent response. J Clin Invest. 1993;91:465-473.
53.
Nitta Y, Abe K, Aoki M, Ohno I, Isoyama S.
Diminished heat shock protein 70 mRNA induction in aged rat hearts
after ischemia. Am J Physiol. 1994;267:H1795-H1803.
54.
Milarski KL, Morimoto RI. Mutational analysis of
the human HSP70 protein: distinct domains for nucleolar localization
and adenosine triphosphate binding. J Cell Biol. 1989;109:1947-1962.
This article has been cited by other articles:
![]() |
N. Kupper, Y. Gidron, J. Winter, and J. Denollet Association Between Type D Personality, Depression, and Oxidative Stress in Patients With Chronic Heart Failure Psychosom Med, November 1, 2009; 71(9): 973 - 980. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sakabe, A. Shiroshita-Takeshita, A. Maguy, B. J.J.M. Brundel, A. Fujiki, H. Inoue, and S. Nattel Effects of a heat shock protein inducer on the atrial fibrillation substrate caused by acute atrial ischaemia Cardiovasc Res, April 1, 2008; 78(1): 63 - 70. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Lin, S. C. Kim, Y. Wang, S. Gupta, B. Davis, S. I. Simon, G. Torre-Amione, and A. A. Knowlton HSP60 in heart failure: abnormal distribution and role in cardiac myocyte apoptosis Am J Physiol Heart Circ Physiol, October 1, 2007; 293(4): H2238 - H2247. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Gupta and A. A. Knowlton HSP60 trafficking in adult cardiac myocytes: role of the exosomal pathway Am J Physiol Heart Circ Physiol, June 1, 2007; 292(6): H3052 - H3056. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Bahi, J. Zhang, M. Llovera, M. Ballester, J. X. Comella, and D. Sanchis Switch from Caspase-dependent to Caspase-independent Death during Heart Development: ESSENTIAL ROLE OF ENDONUCLEASE G IN ISCHEMIA-INDUCED DNA PROCESSING OF DIFFERENTIATED CARDIOMYOCYTES J. Biol. Chem., August 11, 2006; 281(32): 22943 - 22952. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-K. Kim, J. Suarez, Y. Hu, P. M. McDonough, C. Boer, D. J. Dix, and W. H. Dillmann Deletion of the Inducible 70-kDa Heat Shock Protein Genes in Mice Impairs Cardiac Contractile Function and Calcium Handling Associated With Hypertrophy Circulation, June 6, 2006; 113(22): 2589 - 2597. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Szalay, T. Shimizu, T. Suzuki, H.-P. Yu, M. A. Choudhry, M. G. Schwacha, L. W. Rue III, K. I. Bland, and I. H. Chaudry Estradiol improves cardiac and hepatic function after trauma-hemorrhage: role of enhanced heat shock protein expression Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2006; 290(3): R812 - R818. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Voss, S. Gupta, J. P. Stice, G. Baumgarten, L. Lu, J. M. Tristan, and A. A. Knowlton Effect of mutation of amino acids 246-251 (KRKHKK) in HSP72 on protein synthesis and recovery from hypoxic injury Am J Physiol Heart Circ Physiol, December 1, 2005; 289(6): H2519 - H2525. [Abstract] [Full Text] [PDF] |
||||
![]() |
G.-C. Fan, X. Ren, J. Qian, Q. Yuan, P. Nicolaou, Y. Wang, W. K. Jones, G. Chu, and E. G. Kranias Novel Cardioprotective Role of a Small Heat-Shock Protein, Hsp20, Against Ischemia/Reperfusion Injury Circulation, April 12, 2005; 111(14): 1792 - 1799. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zhang Prenatal Hypoxia and Cardiac Programming Reproductive Sciences, January 1, 2005; 12(1): 2 - 13. [Abstract] [PDF] |
||||
![]() |
V. Ramaglia and L. T. Buck Time-dependent expression of heat shock proteins 70 and 90 in tissues of the anoxic western painted turtle J. Exp. Biol., October 1, 2004; 207(21): 3775 - 3784. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Hamilton, F.N. Mbai, S. Gupta, and A.A. Knowlton Estrogen, Heat Shock Proteins, and NF{kappa}B in Human Vascular Endothelium Arterioscler Thromb Vasc Biol, September 1, 2004; 24(9): 1628 - 1633. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Trial, R. D. Rossen, J. Rubio, and A. A. Knowlton Inflammation and Ischemia: Macrophages Activated by Fibronectin Fragments Enhance the Survival of Injured Cardiac Myocytes Experimental Biology and Medicine, June 1, 2004; 229(6): 538 - 545. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Li, S. Bae, and L. Zhang Effect of prenatal hypoxia on heat stress-mediated cardioprotection in adult rat heart Am J Physiol Heart Circ Physiol, May 1, 2004; 286(5): H1712 - H1719. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Radisic, L. Yang, J. Boublik, R. J. Cohen, R. Langer, L. E. Freed, and G. Vunjak-Novakovic Medium perfusion enables engineering of compact and contractile cardiac tissue Am J Physiol Heart Circ Physiol, February 1, 2004; 286(2): H507 - H516. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bae, Y. Xiao, G. Li, C. A. Casiano, and L. Zhang Effect of maternal chronic hypoxic exposure during gestation on apoptosis in fetal rat heart Am J Physiol Heart Circ Physiol, August 7, 2003; 285(3): H983 - H990. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Voss, J. N. Stallone, M. Li, R. N. M. Cornelussen, P. Knuefermann, and A. A. Knowlton Gender differences in the expression of heat shock proteins: the effect of estrogen Am J Physiol Heart Circ Physiol, July 11, 2003; 285(2): H687 - H692. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Li, Y. Xiao, J. L. Estrella, C. A. Ducsay, R. D. Gilbert, and L. Zhang Effect of Fetal Hypoxia on Heart Susceptibility to Ischemia and Reperfusion Injury in the Adult Rat Reproductive Sciences, July 1, 2003; 10(5): 265 - 274. [Abstract] [PDF] |
||||
![]() |
M. A. Scott, M. Locke, and L. T. Buck Tissue-specific expression of inducible and constitutive Hsp70 isoforms in the western painted turtle J. Exp. Biol., March 2, 2003; 206(2): 303 - 311. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Campisi, T. H. Leem, B. N. Greenwood, M. K. Hansen, A. Moraska, K. Higgins, T. P. Smith, and M. Fleshner Habitual physical activity facilitates stress-induced HSP72 induction in brain, peripheral, and immune tissues Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2003; 284(2): R520 - R530. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Gupta and A.A. Knowlton Cytosolic Heat Shock Protein 60, Hypoxia, and Apoptosis Circulation, November 19, 2002; 106(21): 2727 - 2733. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.R. Kirchhoff, S. Gupta, and A.A. Knowlton Cytosolic Heat Shock Protein 60, Apoptosis, and Myocardial Injury Circulation, June 18, 2002; 105(24): 2899 - 2904. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. J. Benjamin and E. Christians Exercise, Estrogen, and Ischemic Cardioprotection by Heat Shock Protein 70 Circ. Res., May 3, 2002; 90(8): 833 - 835. [Full Text] [PDF] |
||||
![]() |
C. Li and R. M. Jackson Reactive species mechanisms of cellular hypoxia-reoxygenation injury Am J Physiol Cell Physiol, February 1, 2002; 282(2): C227 - C241. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. N.M. Cornelussen, F. A. van Nieuwenhoven, L. H.E.H. Snoeckx, A. A. Knowlton, J. P. Leger, F. M. Smith, and R. W. Currie Presence of Heat Shock Protein 72 in Cardiomyocytes After Heat Stress Response Circulation, November 27, 2001; 104 (22): e123 - e123. [Full Text] [PDF] |
||||
![]() |
L. H. E. H. Snoeckx, R. N. Cornelussen, F. A. Van Nieuwenhoven, R. S. Reneman, and G. J. Van der Vusse Heat Shock Proteins and Cardiovascular Pathophysiology Physiol Rev, October 1, 2001; 81(4): 1461 - 1497. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Luo, X. Sun, E. Hungness, and P.-O. Hasselgren Heat shock protects L6 myotubes from catabolic effects of dexamethasone and prevents downregulation of NF-kappa B Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2001; 281(4): R1193 - R1200. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Wang, Y. Seta, G. Baumgarten, D. J. Engel, N. Sivasubramanian, and D. L. Mann Functional Significance of Hemodynamic Overload-Induced Expression of Leukemia-Inhibitory Factor in the Adult Mammalian Heart Circulation, March 6, 2001; 103(9): 1296 - 1302. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. H. Patel, A. Hsu, and G. J. Gross Cardioprotection is strain dependent in rat in response to whole body hyperthermia Am J Physiol Heart Circ Physiol, March 1, 2001; 280(3): H1208 - H1214. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chang, A. A. Knowlton, F. Xu, and J. S. Wasser Activation of the heat shock response: relationship to energy metabolites. A 31P NMR study in rat hearts Am J Physiol Heart Circ Physiol, January 1, 2001; 280(1): H426 - H433. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Knowlton and L. Sun Heat-shock factor-1, steroid hormones, and regulation of heat-shock protein expression in the heart Am J Physiol Heart Circ Physiol, January 1, 2001; 280(1): H455 - H464. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Knowlton, M. Grenier, S. R. Kirchhoff, and M. Salfity Phosphorylation at tyrosine-524 influences nuclear accumulation of HSP72 with heat stress Am J Physiol Heart Circ Physiol, June 1, 2000; 278(6): H2143 - H2149. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Sun, J. Chang, S. R. Kirchhoff, and A. A. Knowlton Activation of HSF and selective increase in heat-shock proteins by acute dexamethasone treatment Am J Physiol Heart Circ Physiol, April 1, 2000; 278(4): H1091 - H1097. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Mizushima, P. Wang, D. Jarrar, W. G. Cioffi, K. I. Bland, and I. H. Chaudry Preinduction of heat shock proteins protects cardiac and hepatic functions following trauma and hemorrhage Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2000; 278(2): R352 - R359. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chang, A. A. Knowlton, and J. S. Wasser Expression of heat shock proteins in turtle and mammal hearts: relationship to anoxia tolerance Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2000; 278(1): R209 - R214. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Nakano, A. A. Knowlton, Z. Dibbs, and D. L. Mann Tumor Necrosis Factor-{alpha} Confers Resistance to Hypoxic Injury in the Adult Mammalian Cardiac Myocyte Circulation, April 14, 1998; 97(14): 1392 - 1400. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. R. Meldrum Tumor necrosis factor in the heart Am J Physiol Regulatory Integrative Comp Physiol, March 1, 1998; 274(3): R577 - R595. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. H. Patel, A. Hsu, and G. J. Gross Attenuation of heat shock-induced cardioprotection by treatment with the opiate receptor antagonist naloxone Am J Physiol Heart Circ Physiol, June 1, 2002; 282(6): H2011 - H2017. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1997 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |