(Circulation. 1997;96:1733-1736.)
© 1997 American Heart Association, Inc.
Articles |
From the Department of Cardiovascular Drug Discovery, Bristol-Myers Squibb Pharmaceutical Research Institute, Princeton, NJ.
Correspondence to Dr Michael A. Blanar, Department of Cardiovascular Drug Discovery, Mail Code K14-01, Room K.4125A, Bristol-Myers Squibb Pharmaceutical Research Institute, Route 206 and Provinceline Road, Princeton, NJ 08543-4000. E-mail blanar{at}bms.com
| Abstract |
|---|
|
|
|---|
Methods and Results We expressed LQTS-associated KvLQT1 mutants in Xenopus oocytes either individually or in combination with wild-type KvLQT1 or in combination with both wild-type KvLQT1 and minK. Substitutions of alanine with proline in the S2-S3 cytoplasmic loop (A177P) or threonine with isoleucine in the highly conserved signature sequence of the pore (T311I) yield inactive channels when expressed individually, whereas substitution of leucine with phenylalanine in the S5 transmembrane domain (L272F) yields a functional channel with reduced macroscopic conductance. However, all these mutants inhibit wild-type KvLQT1 currents in a dominant-negative fashion.
Conclusions In LQTS-affected individuals these mutations would be predicted to result in a diminution of the cardiac IKs current, subsequent prolongation of cardiac repolarization, and an increased risk of arrhythmias.
Key Words: arrhythmia potassium channels long QT syndrome
| Introduction |
|---|
|
|
|---|
| Methods |
|---|
|
|
|---|
1.8-kb cDNA clone in pBSII KS+ comprising the 5' part of
the human KvLQT1 cDNA5 was used to generate the
three mutants described in the present study. Point
mutations6 were introduced by the Transformer
site-directed mutagenesis kit (Clontech), which is based on the unique
site elimination method. Plasmid DNA was hybridized to both a selection
oligonucleotide and a mutagenic
oligonucleotide. The selection primer sequence was
GCGGCCGCTCTTGAACTAGTGGAT. The underlined point mutation
eliminates the unique Xba I restriction enzyme recognition site in pBSII KS+. The mutagenic oligonucleotide primers encoding the appropriate amino acid substitution are A177P, GTCCGCCTCTGGTCCCCCGGCTGCCGCAGCAAGTAC; L272F, CGGCTTCCTGGGCTTCATCTTCTCCTCGTAC; T311I, GGTGGTCACAGTCACCATCATCGGCTATGG. The underlined residues are those that encode the amino acid substitution mutations. Clones containing the desired mutations were identified, among transfected mismatch repair-defective bacteria, by DNA sequence analysis. A 0.8-kb Xho I Bgl II fragment, harboring the KvLQT1 mutation, was used to replace the corresponding fragment in an expression vector containing the full-length wild-type KvLQT1 cDNA.5
Electrophysiological Analysis
Capped cRNAs encoding wild-type and mutant KvLQT1 and minK
proteins were prepared by in vitro transcription using SP6 RNA
polymerase (mMessage mMachine kit, Ambion). Production and
purification of full-length cRNA was verified by denaturing agarose gel
electrophoresis. These cRNAs were injected into
collagenase-treated defolliculated stages V and VI
Xenopus laevis oocytes as described
previously.7 Experiments comparing wild-type and mutant
channels were performed using the same batch of oocytes injected with
cRNAs on the same day. Currents were recorded at room temperature
using the two-microelectrode voltage clamp (Dagan TEV-200) technique 3
to 4 days after injection. Microelectrodes (0.8 to 1.5 M
) were
filled with 3 mol/L KCl. Bath solution contained (in
mmol/L): 96 NaCl, 2 KCl, 0.5 CaCl2, 1.5
MgCl2, and 5 HEPES (pH 7.5). Axoclamp (Axon Instruments)
was used to generate voltage clamp commands and for acquiring data.
Data were sampled at rates at least two times the low-pass filter
rate.
Comparisons of wild-type KvLQT1 currents, mutant KvLQT1 currents, and currents generated by coinjections were based on results from the same batch of oocytes injected on the same day. Before assaying for functional activity of mutant cRNAs and potential dominant-negative effects, a series of titrations were made to identify a concentration of wild-type KvLQT1 cRNA that would result in a doubling of the amplitude of expressed current when the amount of injected cRNA was doubled. Wild-type KvLQT1 current amplitudes measured in oocytes injected with 5 ng of cRNA were consistently 1.5- to 2.0-fold lower than in oocytes injected with 10 ng of cRNA. There was considerably less than a 2-fold difference in current amplitudes between groups injected with much higher concentrations of wild-type KvLQT1 cRNA. Thus, all wild-type or mutant KvLQT1 cRNAs were injected at 5 ng per oocyte (10 ng total for wild-type+mutant coinjections).
The potassium selectivity of expressed currents was examined by investigation of tail current reversal potentials in bath solutions containing 2, 10, 40, and 98 mmol/L K+. Currents were activated maximally by stepping to +20 mV for 1 second (wild-type and mutants alone) or 2 seconds (wild-type+mutants+minK) and then back to a series of test potentials ranging from -120 to +10 mV. This tail current protocol was repeated in each oocyte while switching from low to high external potassium concentrations.
The voltage dependence of current activation was estimated by fitting normalized tail current versus voltage curves with a Boltzmann function (Clampfit, Pclamp 6.03). Tail currents were recorded at -70 mV after 1-second (KvLQT1) or 3-second (minK+KvLQT1) depolarizing voltage steps from a holding potential of -80 mV to potentials ranging from -70 to +40 mV. Tail current amplitudes were determined by extrapolating deactivating currents to the end of the depolarizing test pulse. Tail currents were normalized to the maximal tail current in each experiment.
| Results |
|---|
|
|
|---|
Fig 1A
shows a typical family of wild-type KvLQT1
currents. As described
recently,3 4 5 KvLQT1 potassium currents activate
rapidly and show little rectification at positive voltages. In
contrast, only small currents, identical to those recorded in
water-injected control oocytes (not shown), were detectable in oocytes
injected with either A177P or T311I mutants (Fig 1
, B and D). The L272F
mutant formed functional channels that resulted in a macroscopic
current significantly smaller in amplitude than wild-type KvLQT1 (Fig 1C
). Current amplitudes recorded at the end of 1-second test pulses
to +20 mV are shown in the
Table
. Current-voltage
relations of wild-type, A177P, T311I, and L272F currents are shown in
Fig 1E
. The voltage dependence of activation is the same for wild-type
KvLQT1 and the L272F mutant. However, L272F current slowly
inactivated during steps to positive voltages. The altered
inactivation of the L272F mutant may suggest that the S5 region may
play a role in inactivation of KvLQT1.
|
|
Dominant-Negative KvLQT1 Mutations
Since KvLQT1 most likely functions as a tetramer,9 it
was of interest to determine whether the mutant KvLQT1 could exert
a dominant-negative effect on wild-type channel activity. To test this,
membrane currents were recorded from oocytes either injected with
wild-type KvLQT1 cRNA alone or coinjected with equimolar amounts of
mutant and wild-type KvLQT1 cRNAs. The A177P and T311I mutants reduced
wild-type current by
75% (Fig 1
, G and I, and Table
). Neither
mutant affected the potassium selectivity of the channel or the voltage
dependence of activation (Table
). The V1/2 of wild-type
KvLQT1 is close to the previously reported value.4
Although currents were not detected in oocytes injected with higher
(2.5-fold) concentrations of A117P or T311I (Fig 1
, B and D), the
dramatic reduction of wild-type KvLQT1 current by coinjection with
either mutant indicates that mutant channel proteins are probably
competent to coassemble with wild-type KvLQT1 subunits, resulting
in the dominant-negative suppression of wild-type current.
A family of currents recorded from an oocyte injected with
both L272F and wild-type cRNA is shown in Fig 1H
. The L272F mutant
altered wild-type KvLQT1 function by introducing pronounced
inactivation at positive voltages similar to that observed with the
L272F alone (Fig 1C
). Although L272F did not affect potassium ion
selectivity, it caused a -10-mV shift in the voltage dependence of
wild-type KvLQT1 activation (Table
). The magnitude of the current
observed in oocytes coinjected with 5 ng L272F+5 ng wild-type KvLQT1
cRNAs was less than the sum of currents recorded in oocytes
injected with 5 ng wild-type KvLQT1 alone and with 5 ng L272F alone
(data not shown). In addition, the magnitude of the current observed in
oocytes coinjected with 5 ng L272F+5 ng wild-type KvLQT1 cRNAs was even
less than the magnitude of the current elicted by 5 ng wild-type KvLQT1
cRNA alone (Table
). Thus, the data suggest that the L272F mutant
subunits coassemble with the wild-type subunits, alter normal KvLQT1
function, and suppress wild-type KvLQT1 activity in a dominant-negative
manner. The effects of L272F on wild-type KvLQT1 current suggest that
the S5 region affects the voltage dependence of KvLQT1 channel
activation.10
Coexpression of Mutant and Wild-Type KvLQT1 With minK
Consistent with the previous observations,3 4 5
coexpression of wild-type KvLQT1 and minK cRNAs in oocytes results in a
current more similar to native IKs; the current
activates more slowly and the activation threshold is shifted
to the right by
20 mV (Fig 2
, A and
E). Wild-type KvLQT1+minK
currents have a much larger amplitude than KvLQT1 currents alone
(Table
). The half-maximal voltage of wild-type KvLQT1+minK current was
estimated to be 9.2±1.8 mV (Table
), which is nearly identical to that
of human cardiac IKs.11
|
Coexpression of either the A177P or T311I mutants reduced
KvLQT1+minK current amplitude by
75% (Fig 2
, B and D). Neither
mutant significantly altered the potassium ion selectivity of
KvLQT1+minK current (Table
). Both mutants shifted the half-maximal
voltage of KvLQT1+minK current activation by >10 mV (Table
). These
mutations, which did not affect the voltage dependence of KvLQT1
current activation, may alter the ability of minK to affect the voltage
dependence of KvLQT1 activation. A family of currents recorded from
an oocyte coinjected with wild-type KvLQT1+minK+L272F cRNAs is shown in
Fig 2C
. L272F reduced KvLQT1+minK current recorded at +20 mV by
31% (Table
). As with the other mutants, the magnitude of the effect
of L272F on KvLQT1 and KvLQT1+minK current was very similar.
Interestingly, the pronounced inactivation observed with both L272F
alone (Fig 1C
) and wild-type+L272F (Fig 1H
) was not detected in the
presence of minK (Fig 2
, C and E). L272F did not alter the potassium
ion selectivity but did produce a small positive shift in the
V1/2 of KvLQT1+minK current (Table
). As reported
previously,5 KvLQT1 currents are less sensitive to
inhibition by clofilium in the presence of minK; this was not affected
by any of the mutations described (Table
).
| Discussion |
|---|
|
|
|---|
94%. If these assumptions are correct, our results would
suggest that some heterotetramers containing A177P or T311I mutant
subunits may be functional, since coexpression of either mutant with
wild-type KvLQT1 yielded currents that were reduced only by
75%
(Fig 1If KvLQT1+minK does, in fact, constitute the endogenous human cardiac IKs current, the suppressive effects of these mutant KvLQT1 subunits would be physiologically relevant to the origin of LQTS. In a patient carrying one of these KvLQT1 mutant alleles, diminution of the repolarizing IKs current would be expected to result in the prolongation of the cardiac action potential duration and a subsequent increased risk of cardiac arrhythmias. Mutations in the HERG gene cause similar effects by reducing the IKr-type current.10 It will be of interest to correlate the effects of the various KvLQT1 mutations to the severity of disease in patients with chromosome 11-linked LQTS.12
| Acknowledgments |
|---|
Received May 13, 1997; revision received June 23, 1997; accepted July 1, 1997.
| References |
|---|
|
|
|---|
2. Sanguinetti MC, Jiang C, Curran ME, Keating MT. A mechanistic link between an inherited and an acquired cardiac arrhythmia: HERG encodes the IKr potassium channel. Cell. 1995;81:299-307.[Medline] [Order article via Infotrieve]
3. Barhanin J, Lesage F, Guillemare E, Fink M, Lazdunski M, Romey G. KvLQT1 and IsK (minK) proteins associate to form the IKs cardiac potassium current. Nature. 1996;384:78-80.[Medline] [Order article via Infotrieve]
4. Sanguinetti MC, Curran ME, Zou A, Shen J, Spector PS, Atkinson DL, Keating MT. Co-assembly of KVLQT1 and minK (IsK) proteins to form cardiac IKs potassium channel. Nature. 1996;384:80-83.[Medline] [Order article via Infotrieve]
5.
Yang W-P, Levesque PC, Little WA, Conder ML, Shalaby
FY, Blanar MA. KVLQT1, a voltage gated potassium channel
responsible for human cardiac arrhythmias. Proc
Natl Acad Sci U S A. 1997;94:4017-4021.
6. Wang Q, Curran ME, Splawski I, Burn TC, Millholand JM, VanRaay TJ, Shen J, Timothy KW, Vincent GM, de Jager T, Schwartz PJ, Towbin JA, Moss AJ, Atkinson DL, Landes GM, Connors TD, Keating MT. Positional cloning of a novel potassium channel gene: KVLQT1 mutations cause cardiac arrhythmias. Nat Genet. 1996;12:17-23.[Medline] [Order article via Infotrieve]
7.
Levesque PC, Hart PJ, Hume JR, Kenyon JL, Horowitz
B. Expression of cystic fibrosis transmembrane regulator
Cl- channel in the heart. Circ Res. 1992;71:1002-1007.
8. Heginbotham L, Lu Z, Abramson T, MacKinnon R. Mutations in the potassium channel signature sequence. Biophys J. 1994;66:1061-1067.[Medline] [Order article via Infotrieve]
9. MacKinnon R. Determination of the subunit stoichiometry of a voltage-activated potassium channel. Nature. 1991;350:232-235.[Medline] [Order article via Infotrieve]
10.
Sanguinetti MC, Curran ME, Spector PS, Keating
MT. Spectrum of HERG K+ channel dysfunction in an inherited
cardiac arrhythmia. Proc Natl Acad Sci
U S A. 1996;93:2208-2212.
11.
Li G-R, Feng J, Yue L, Carrier M, Nattel S.
Evidence for two components of delayed rectifier K+ current
in ventricular myocytes. Circ Res. 1996;78:689-696.
12. Vincent MG, Timothy KW, Leppert M, Keating M. The spectrum of the symptoms and QT intervals in carriers of the gene for the long-QT syndrome. N Engl J Med. 1992;327:846-852.[Abstract]
This article has been cited by other articles:
![]() |
A. J. Moss and I. Goldenberg Importance of Knowing the Genotype and the Specific Mutation When Managing Patients With Long-QT Syndrome Circ Arrhythm Electrophysiol, August 1, 2008; 1(3): 219 - 226. [Full Text] [PDF] |
||||
![]() |
S. E. Lehnart, M. J. Ackerman, D. W. Benson Jr, R. Brugada, C. E. Clancy, J. K. Donahue, A. L. George Jr, A. O. Grant, S. C. Groft, C. T. January, et al. Inherited Arrhythmias: A National Heart, Lung, and Blood Institute and Office of Rare Diseases Workshop Consensus Report About the Diagnosis, Phenotyping, Molecular Mechanisms, and Therapeutic Approaches for Primary Cardiomyopathies of Gene Mutations Affecting Ion Channel Function Circulation, November 13, 2007; 116(20): 2325 - 2345. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Moss, W. Shimizu, A. A.M. Wilde, J. A. Towbin, W. Zareba, J. L. Robinson, M. Qi, G. M. Vincent, M. J. Ackerman, E. S. Kaufman, et al. Clinical Aspects of Type-1 Long-QT Syndrome by Location, Coding Type, and Biophysical Function of Mutations Involving the KCNQ1 Gene Circulation, May 15, 2007; 115(19): 2481 - 2489. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. R. Boulet, A. L. Raes, N. Ottschytsch, and D. J. Snyders Functional effects of a KCNQ1 mutation associated with the long QT syndrome Cardiovasc Res, June 1, 2006; 70(3): 466 - 474. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Wilson, K. V. Quinn, F. M. Graves, M. Bitner-Glindzicz, and A. Tinker Abnormal KCNQ1 trafficking influences disease pathogenesis in hereditary long QT syndromes (LQT1) Cardiovasc Res, August 15, 2005; 67(3): 476 - 486. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-H. Park, J. Piron, S. Dahimene, J. Merot, I. Baro, D. Escande, and G. Loussouarn Impaired KCNQ1-KCNE1 and Phosphatidylinositol-4,5-Bisphosphate Interaction Underlies the Long QT Syndrome Circ. Res., April 15, 2005; 96(7): 730 - 739. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Seebohm, P. Westenskow, F. Lang, and M. C Sanguinetti Mutation of colocalized residues of the pore helix and transmembrane segments S5 and S6 disrupt deactivation and modify inactivation of KCNQ1 K+ channels J. Physiol., March 1, 2005; 563(2): 359 - 368. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E. Clancy and R. S. Kass Inherited and Acquired Vulnerability to Ventricular Arrhythmias: Cardiac Na+ and K+ Channels Physiol Rev, January 1, 2005; 85(1): 33 - 47. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.R. K. Bhagavatula, C. Fan, G.-Q. Shen, J. Cassano, E. F. Plow, E. J. Topol, and Q. Wang Transcription factor MEF2A mutations in patients with coronary artery disease Hum. Mol. Genet., December 15, 2004; 13(24): 3181 - 3188. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Wu, J. C. Shryock, Y. Song, Y. Li, C. Antzelevitch, and L. Belardinelli Antiarrhythmic Effects of Ranolazine in a Guinea Pig in Vitro Model of Long-QT Syndrome J. Pharmacol. Exp. Ther., August 1, 2004; 310(2): 599 - 605. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Shimizu, M. Horie, S. Ohno, K. Takenaka, M. Yamaguchi, M. Shimizu, T. Washizuka, Y. Aizawa, K. Nakamura, T. Ohe, et al. Mutation site-specific differences in arrhythmic risk and sensitivity to sympathetic stimulation in the LQT1 form of congenital long QT syndrome: Multicenter study in Japan J. Am. Coll. Cardiol., July 7, 2004; 44(1): 117 - 125. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. D. Millar, J. A. Hartley, C. Haigh, A. A. Grace, S. J. White, J. D. Kibble, and L. Robson Volume regulation is defective in renal proximal tubule cells isolated from KCNE1 knockout mice Exp Physiol, March 1, 2004; 89(2): 173 - 180. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Seebohm, M. Pusch, J. Chen, and M. C. Sanguinetti Pharmacological Activation of Normal and Arrhythmia-Associated Mutant KCNQ1 Potassium Channels Circ. Res., November 14, 2003; 93(10): 941 - 947. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Seebohm, M. C Sanguinetti, and M. Pusch Tight coupling of rubidium conductance and inactivation in human KCNQ1 potassium channels J. Physiol., October 15, 2003; 552(2): 369 - 378. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Gamper, J. D. Stockand, and M. S. Shapiro Subunit-Specific Modulation of KCNQ Potassium Channels by Src Tyrosine Kinase J. Neurosci., January 1, 2003; 23(1): 84 - 95. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Peretz, H. Schottelndreier, L. B. Aharon-Shamgar, and B. Attali Modulation of homomeric and heteromeric KCNQ1 channels by external acidification J. Physiol., December 15, 2002; 545(3): 751 - 766. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A.M. Wilde and D. Escande LQT genotype-phenotype relationships: patients and patches Cardiovasc Res, September 1, 2001; 51(4): 627 - 629. [Full Text] [PDF] |
||||
![]() |
C.-C. Shieh, M. Coghlan, J. P. Sullivan, and M. Gopalakrishnan Potassium Channels: Molecular Defects, Diseases, and Therapeutic Opportunities Pharmacol. Rev., December 1, 2000; 52(4): 557 - 594. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Bianchi, S. G. Priori, C. Napolitano, K. A. Surewicz, A. T. Dennis, M. Memmi, P. J. Schwartz, and A. M. Brown Mechanisms of IKs suppression in LQT1 mutants Am J Physiol Heart Circ Physiol, December 1, 2000; 279(6): H3003 - H3011. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Splawski, J. Shen, K. W. Timothy, M. H. Lehmann, S. Priori, J. L. Robinson, A. J. Moss, P. J. Schwartz, J. A. Towbin, G. M. Vincent, et al. Spectrum of Mutations in Long-QT Syndrome Genes : KVLQT1, HERG, SCN5A, KCNE1, and KCNE2 Circulation, September 5, 2000; 102(10): 1178 - 1185. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. R. Tapper and A. L. George Jr. Mink Subdomains That Mediate Modulation of and Association with Kvlqt1 J. Gen. Physiol., September 1, 2000; 116(3): 379 - 390. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-E. Chiang and D. M. Roden The long QT syndromes: genetic basis and clinical implications J. Am. Coll. Cardiol., July 1, 2000; 36(1): 1 - 12. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Chouabe, N. Neyroud, P. Richard, I. Denjoy, B. Hainque, G. Romey, M.-D. Drici, P. Guicheney, and J. Barhanin Novel mutations in KvLQT1 that affect Iks activation through interactions with Isk Cardiovasc Res, March 1, 2000; 45(4): 971 - 980. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Weinshenker, A. Wei, L. Salkoff, and J. H. Thomas Block of an ether-a-go-go-Like K+ Channel by Imipramine Rescues egl-2 Excitation Defects in Caenorhabditis elegans J. Neurosci., November 15, 1999; 19(22): 9831 - 9840. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Lehmann-Horn and K. Jurkat-Rott Voltage-Gated Ion Channels and Hereditary Disease Physiol Rev, October 1, 1999; 79(4): 1317 - 1372. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Franqueza, M. Lin, I. Splawski, M. T. Keating, and M. C. Sanguinetti Long QT Syndrome-associated Mutations in the S4-S5 Linker of KvLQT1 Potassium Channels Modify Gating and Interaction with minK Subunits J. Biol. Chem., July 23, 1999; 274(30): 21063 - 21070. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Neyroud, P. Richard, N. Vignier, C. Donger, I. Denjoy, L. Demay, M. Shkolnikova, R. Pesce, P. Chevalier, B. Hainque, et al. Genomic Organization of the KCNQ1 K+ Channel Gene and Identification of C-Terminal Mutations in the Long-QT Syndrome Circ. Res., February 19, 1999; 84(3): 290 - 297. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yang and F. J. Sigworth Single-Channel Properties of IKs Potassium Channels J. Gen. Physiol., December 1, 1998; 112(6): 665 - 678. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-P. Yang, P. C. Levesque, W. A. Little, M. L. Conder, P. Ramakrishnan, M. G. Neubauer, and M. A. Blanar Functional Expression of Two KvLQT1-related Potassium Channels Responsible for an Inherited Idiopathic Epilepsy J. Biol. Chem., July 31, 1998; 273(31): 19419 - 19423. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-D. Drici, I. Arrighi, C. Chouabe, J. R. Mann, M. Lazdunski, G. Romey, and J. Barhanin Involvement of IsK-Associated K+ Channel in Heart Rate Control of Repolarization in a Murine Engineered Model of Jervell and Lange-Nielsen Syndrome Circ. Res., July 13, 1998; 83(1): 95 - 102. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Seebohm, C. R. Scherer, A. E. Busch, and C. Lerche Identification of Specific Pore Residues Mediating KCNQ1 Inactivation. A NOVEL MECHANISM FOR LONG QT SYNDROME J. Biol. Chem., April 20, 2001; 276(17): 13600 - 13605. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1997 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |