Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 1997;96:1733-1736

This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shalaby, F. Y.
Right arrow Articles by Blanar, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shalaby, F. Y.
Right arrow Articles by Blanar, M. A.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*OMIM
*Protein*UniGene
*Substance via MeSH

(Circulation. 1997;96:1733-1736.)
© 1997 American Heart Association, Inc.


Articles

Dominant-Negative KvLQT1 Mutations Underlie the LQT1 Form of Long QT Syndrome

Fouad Y. Shalaby, PhD; Paul C. Levesque, PhD; Wen-Pin Yang, PhD; Wayne A. Little, MS; Mary Lee Conder, BS; Tonya Jenkins-West, BS; ; Michael A. Blanar, PhD

From the Department of Cardiovascular Drug Discovery, Bristol-Myers Squibb Pharmaceutical Research Institute, Princeton, NJ.

Correspondence to Dr Michael A. Blanar, Department of Cardiovascular Drug Discovery, Mail Code K14-01, Room K.4125A, Bristol-Myers Squibb Pharmaceutical Research Institute, Route 206 and Provinceline Road, Princeton, NJ 08543-4000. E-mail blanar{at}bms.com


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background Mutations that map to the KvLQT1 gene on human chromosome 11 account for more than 50% of inherited long QT syndrome (LQTS). It has been discovered recently that the KvLQT1 and minK proteins functionally interact to generate a current with biophysical properties similar to IKs, the slowly activating delayed-rectifier cardiac potassium current. Since IKs modulates the repolarization of cardiac action potentials it is reasonable to hypothesize that mutations in KvLQT1 reduce IKs, resulting in the prolongation of cardiac action potential duration.

Methods and Results We expressed LQTS-associated KvLQT1 mutants in Xenopus oocytes either individually or in combination with wild-type KvLQT1 or in combination with both wild-type KvLQT1 and minK. Substitutions of alanine with proline in the S2-S3 cytoplasmic loop (A177P) or threonine with isoleucine in the highly conserved signature sequence of the pore (T311I) yield inactive channels when expressed individually, whereas substitution of leucine with phenylalanine in the S5 transmembrane domain (L272F) yields a functional channel with reduced macroscopic conductance. However, all these mutants inhibit wild-type KvLQT1 currents in a dominant-negative fashion.

Conclusions In LQTS-affected individuals these mutations would be predicted to result in a diminution of the cardiac IKs current, subsequent prolongation of cardiac repolarization, and an increased risk of arrhythmias.


Key Words: arrhythmia • potassium channels • long QT syndrome


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Prolongation of the QT interval of the ECG of patients with congenital long QT syndrome (LQTS) reflects delayed repolarization of the action potential, a function performed mainly by delayed rectifier potassium currents, IK.1 The genes mutated at two of the four LQTS-linked loci, LQT1 and LQT2, encode voltage-regulated potassium ion channels of the delayed-rectifier type, KvLQT1 and HERG, respectively. HERG is responsible for the rapidly activating component of IK (IKr).2 Here, we describe the functional characterization of three LQTS-associated mutations in KvLQT1, which has been suggested recently to comprise the slowly activating (IKs) component of IK.3 4 5


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
In Vitro Mutagenesis
An {approx}1.8-kb cDNA clone in pBSII KS+ comprising the 5' part of the human KvLQT1 cDNA5 was used to generate the three mutants described in the present study. Point mutations6 were introduced by the Transformer site-directed mutagenesis kit (Clontech), which is based on the unique site elimination method. Plasmid DNA was hybridized to both a selection oligonucleotide and a mutagenic oligonucleotide. The selection primer sequence was GCGGCCGCTCTTGAACTAGTGGAT. The underlined point mutation eliminates the unique

Xba I restriction enzyme recognition site in pBSII KS+. The mutagenic oligonucleotide primers encoding the appropriate amino acid substitution are A177P, GTCCGCCTCTGGTCCCCCGGCTGCCGCAGCAAGTAC; L272F, CGGCTTCCTGGGCTTCATCTTCTCCTCGTAC; T311I, GGTGGTCACAGTCACCATCATCGGCTATGG. The underlined residues are those that encode the amino acid substitution mutations. Clones containing the desired mutations were identified, among transfected mismatch repair-defective bacteria, by DNA sequence analysis. A 0.8-kb Xho I Bgl II fragment, harboring the KvLQT1 mutation, was used to replace the corresponding fragment in an expression vector containing the full-length wild-type KvLQT1 cDNA.5

Electrophysiological Analysis
Capped cRNAs encoding wild-type and mutant KvLQT1 and minK proteins were prepared by in vitro transcription using SP6 RNA polymerase (mMessage mMachine kit, Ambion). Production and purification of full-length cRNA was verified by denaturing agarose gel electrophoresis. These cRNAs were injected into collagenase-treated defolliculated stages V and VI Xenopus laevis oocytes as described previously.7 Experiments comparing wild-type and mutant channels were performed using the same batch of oocytes injected with cRNAs on the same day. Currents were recorded at room temperature using the two-microelectrode voltage clamp (Dagan TEV-200) technique 3 to 4 days after injection. Microelectrodes (0.8 to 1.5 M{Omega}) were filled with 3 mol/L KCl. Bath solution contained (in mmol/L): 96 NaCl, 2 KCl, 0.5 CaCl2, 1.5 MgCl2, and 5 HEPES (pH 7.5). Axoclamp (Axon Instruments) was used to generate voltage clamp commands and for acquiring data. Data were sampled at rates at least two times the low-pass filter rate.

Comparisons of wild-type KvLQT1 currents, mutant KvLQT1 currents, and currents generated by coinjections were based on results from the same batch of oocytes injected on the same day. Before assaying for functional activity of mutant cRNAs and potential dominant-negative effects, a series of titrations were made to identify a concentration of wild-type KvLQT1 cRNA that would result in a doubling of the amplitude of expressed current when the amount of injected cRNA was doubled. Wild-type KvLQT1 current amplitudes measured in oocytes injected with 5 ng of cRNA were consistently 1.5- to 2.0-fold lower than in oocytes injected with 10 ng of cRNA. There was considerably less than a 2-fold difference in current amplitudes between groups injected with much higher concentrations of wild-type KvLQT1 cRNA. Thus, all wild-type or mutant KvLQT1 cRNAs were injected at 5 ng per oocyte (10 ng total for wild-type+mutant coinjections).

The potassium selectivity of expressed currents was examined by investigation of tail current reversal potentials in bath solutions containing 2, 10, 40, and 98 mmol/L K+. Currents were activated maximally by stepping to +20 mV for 1 second (wild-type and mutants alone) or 2 seconds (wild-type+mutants+minK) and then back to a series of test potentials ranging from -120 to +10 mV. This tail current protocol was repeated in each oocyte while switching from low to high external potassium concentrations.

The voltage dependence of current activation was estimated by fitting normalized tail current versus voltage curves with a Boltzmann function (Clampfit, Pclamp 6.03). Tail currents were recorded at -70 mV after 1-second (KvLQT1) or 3-second (minK+KvLQT1) depolarizing voltage steps from a holding potential of -80 mV to potentials ranging from -70 to +40 mV. Tail current amplitudes were determined by extrapolating deactivating currents to the end of the depolarizing test pulse. Tail currents were normalized to the maximal tail current in each experiment.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
LQTS Mutations Alter KvLQT1 Activity
The three point mutations characterized in the present study were described originally on a partial clone of KvLQT1,6 which is 129 amino acids shorter than the KvLQT1 clone used here.5 The missense mutation, A177P (kindred K131196 ), occurs in the putative cytoplasmic loop between S2 and S3. The L272F mutation (kindred K17776 ) replaces a leucine residue with phenylalanine in S5. The third missense mutation, T311I (kindred K209256 ), replaces a threonine residue with an isoleucine in the highly conserved pore signature sequence.8

Fig 1ADown shows a typical family of wild-type KvLQT1 currents. As described recently,3 4 5 KvLQT1 potassium currents activate rapidly and show little rectification at positive voltages. In contrast, only small currents, identical to those recorded in water-injected control oocytes (not shown), were detectable in oocytes injected with either A177P or T311I mutants (Fig 1Down, B and D). The L272F mutant formed functional channels that resulted in a macroscopic current significantly smaller in amplitude than wild-type KvLQT1 (Fig 1CDown). Current amplitudes recorded at the end of 1-second test pulses to +20 mV are shown in the TableDown. Current-voltage relations of wild-type, A177P, T311I, and L272F currents are shown in Fig 1EDown. The voltage dependence of activation is the same for wild-type KvLQT1 and the L272F mutant. However, L272F current slowly inactivated during steps to positive voltages. The altered inactivation of the L272F mutant may suggest that the S5 region may play a role in inactivation of KvLQT1.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 1. Dominant-negative effects of KvLQT1 mutations on wild-type currents. Families of currents recorded in an oocyte injected with 12.5 ng of A, wild-type (WT) KvLQT1 cRNA; B, A177P cRNA; C, L272F cRNA; or D, T311I cRNA. E, Current-voltage relation for currents shown in A (n=6), B (n=5), C (n=5), and D (n=5). Families of currents recorded from oocytes injected with 5 ng each of F, WT KvLQT1 cRNA; G, WT KvLQT1 and A177P cRNAs; H, WT KvLQT1 and L272F cRNAs; or I, WT KvLQT1 and T311I cRNAs. J, Current-voltage relation for currents shown in F (n=6), G (n=5), H (n=6), and I (n=5). All currents were elicited by 1-second voltage steps from a holding potential of -80 mV to test potentials ranging from -60 to +40 mV (20-mV increments). Recordings were made 4 days after injection.


View this table:
[in this window]
[in a new window]
 
Table 1. Comparison of KvLQT1 Currents in Oocytes Injected With Wild-Type and Mutant KvLQT1 cRNAs in the Absence and Presence of minK

Dominant-Negative KvLQT1 Mutations
Since KvLQT1 most likely functions as a tetramer,9 it was of interest to determine whether the mutant KvLQT1 could exert a dominant-negative effect on wild-type channel activity. To test this, membrane currents were recorded from oocytes either injected with wild-type KvLQT1 cRNA alone or coinjected with equimolar amounts of mutant and wild-type KvLQT1 cRNAs. The A177P and T311I mutants reduced wild-type current by {approx}75% (Fig 1Up, G and I, and TableUp). Neither mutant affected the potassium selectivity of the channel or the voltage dependence of activation (TableUp). The V1/2 of wild-type KvLQT1 is close to the previously reported value.4 Although currents were not detected in oocytes injected with higher (2.5-fold) concentrations of A117P or T311I (Fig 1Up, B and D), the dramatic reduction of wild-type KvLQT1 current by coinjection with either mutant indicates that mutant channel proteins are probably competent to coassemble with wild-type KvLQT1 subunits, resulting in the dominant-negative suppression of wild-type current.

A family of currents recorded from an oocyte injected with both L272F and wild-type cRNA is shown in Fig 1HUp. The L272F mutant altered wild-type KvLQT1 function by introducing pronounced inactivation at positive voltages similar to that observed with the L272F alone (Fig 1CUp). Although L272F did not affect potassium ion selectivity, it caused a -10-mV shift in the voltage dependence of wild-type KvLQT1 activation (TableUp). The magnitude of the current observed in oocytes coinjected with 5 ng L272F+5 ng wild-type KvLQT1 cRNAs was less than the sum of currents recorded in oocytes injected with 5 ng wild-type KvLQT1 alone and with 5 ng L272F alone (data not shown). In addition, the magnitude of the current observed in oocytes coinjected with 5 ng L272F+5 ng wild-type KvLQT1 cRNAs was even less than the magnitude of the current elicted by 5 ng wild-type KvLQT1 cRNA alone (TableUp). Thus, the data suggest that the L272F mutant subunits coassemble with the wild-type subunits, alter normal KvLQT1 function, and suppress wild-type KvLQT1 activity in a dominant-negative manner. The effects of L272F on wild-type KvLQT1 current suggest that the S5 region affects the voltage dependence of KvLQT1 channel activation.10

Coexpression of Mutant and Wild-Type KvLQT1 With minK
Consistent with the previous observations,3 4 5 coexpression of wild-type KvLQT1 and minK cRNAs in oocytes results in a current more similar to native IKs; the current activates more slowly and the activation threshold is shifted to the right by {approx}20 mV (Fig 2Down, A and E). Wild-type KvLQT1+minK currents have a much larger amplitude than KvLQT1 currents alone (TableUp). The half-maximal voltage of wild-type KvLQT1+minK current was estimated to be 9.2±1.8 mV (TableUp), which is nearly identical to that of human cardiac IKs.11



View larger version (18K):
[in this window]
[in a new window]
 
Figure 2. Dominant-negative effects of KvLQT1 mutations on wild-type KvLQT1+minK current. Families of currents from oocytes injected with A, 5 ng WT KvLQT1+1.6 ng minK cRNAs; B, 5 ng WT KvLQT1+5 ng A177P+1.6 ng minK cRNAs; C, 5 ng WT KvLQT1+5 ng L272F+1.6 ng minK cRNAs; or D, 5 ng WT KvLQT1+5 ng T311I+1.6 ng minK cRNAs. E, Current-voltage relation for WT+minK (n=5), WT+A177P+minK (n=5), WT+L272F+minK (n=5), and WT+T311I+minK (n=5) channels. All currents were elicited by 3-second voltage steps from a holding potential of -80 mV to test potentials ranging from -60 to +40 mV in 20-mV increments. Recordings were made 4 days after injection.

Coexpression of either the A177P or T311I mutants reduced KvLQT1+minK current amplitude by {approx}75% (Fig 2Up, B and D). Neither mutant significantly altered the potassium ion selectivity of KvLQT1+minK current (TableUp). Both mutants shifted the half-maximal voltage of KvLQT1+minK current activation by >10 mV (TableUp). These mutations, which did not affect the voltage dependence of KvLQT1 current activation, may alter the ability of minK to affect the voltage dependence of KvLQT1 activation. A family of currents recorded from an oocyte coinjected with wild-type KvLQT1+minK+L272F cRNAs is shown in Fig 2CUp. L272F reduced KvLQT1+minK current recorded at +20 mV by {approx}31% (TableUp). As with the other mutants, the magnitude of the effect of L272F on KvLQT1 and KvLQT1+minK current was very similar. Interestingly, the pronounced inactivation observed with both L272F alone (Fig 1CUp) and wild-type+L272F (Fig 1HUp) was not detected in the presence of minK (Fig 2Up, C and E). L272F did not alter the potassium ion selectivity but did produce a small positive shift in the V1/2 of KvLQT1+minK current (TableUp). As reported previously,5 KvLQT1 currents are less sensitive to inhibition by clofilium in the presence of minK; this was not affected by any of the mutations described (TableUp).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
The KvLQT1 mutations studied here all exert a dominant-negative effect on the wild-type KvLQT1 current both in the absence and in the presence of minK. The mechanism underlying these dominant-negative effects is not known. However, assuming that coassembly of the tetrameric KvLQT1 channel is random, producing all possible stoichiometric combinations of wild-type and mutant subunits, and that only wild-type homotetramers are functional, equimolar coexpression of either the A177P or T311I mutant subunits should inhibit the wild-type current by {approx}94%. If these assumptions are correct, our results would suggest that some heterotetramers containing A177P or T311I mutant subunits may be functional, since coexpression of either mutant with wild-type KvLQT1 yielded currents that were reduced only by {approx}75% (Fig 1Up, G and I).

If KvLQT1+minK does, in fact, constitute the endogenous human cardiac IKs current, the suppressive effects of these mutant KvLQT1 subunits would be physiologically relevant to the origin of LQTS. In a patient carrying one of these KvLQT1 mutant alleles, diminution of the repolarizing IKs current would be expected to result in the prolongation of the cardiac action potential duration and a subsequent increased risk of cardiac arrhythmias. Mutations in the HERG gene cause similar effects by reducing the IKr-type current.10 It will be of interest to correlate the effects of the various KvLQT1 mutations to the severity of disease in patients with chromosome 11-linked LQTS.12


*    Acknowledgments
 
We thank B. Kienzel for sequencing. This work was supported by the Bristol-Myers Squibb Pharmaceutical Research Institute.

Received May 13, 1997; revision received June 23, 1997; accepted July 1, 1997.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Attali B. A new wave for heart rhythm. Nature. 1996;384:24-25.[Medline] [Order article via Infotrieve]

2. Sanguinetti MC, Jiang C, Curran ME, Keating MT. A mechanistic link between an inherited and an acquired cardiac arrhythmia: HERG encodes the IKr potassium channel. Cell. 1995;81:299-307.[Medline] [Order article via Infotrieve]

3. Barhanin J, Lesage F, Guillemare E, Fink M, Lazdunski M, Romey G. KvLQT1 and IsK (minK) proteins associate to form the IKs cardiac potassium current. Nature. 1996;384:78-80.[Medline] [Order article via Infotrieve]

4. Sanguinetti MC, Curran ME, Zou A, Shen J, Spector PS, Atkinson DL, Keating MT. Co-assembly of KVLQT1 and minK (IsK) proteins to form cardiac IKs potassium channel. Nature. 1996;384:80-83.[Medline] [Order article via Infotrieve]

5. Yang W-P, Levesque PC, Little WA, Conder ML, Shalaby FY, Blanar MA. KVLQT1, a voltage gated potassium channel responsible for human cardiac arrhythmias. Proc Natl Acad Sci U S A. 1997;94:4017-4021.[Abstract/Free Full Text]

6. Wang Q, Curran ME, Splawski I, Burn TC, Millholand JM, VanRaay TJ, Shen J, Timothy KW, Vincent GM, de Jager T, Schwartz PJ, Towbin JA, Moss AJ, Atkinson DL, Landes GM, Connors TD, Keating MT. Positional cloning of a novel potassium channel gene: KVLQT1 mutations cause cardiac arrhythmias. Nat Genet. 1996;12:17-23.[Medline] [Order article via Infotrieve]

7. Levesque PC, Hart PJ, Hume JR, Kenyon JL, Horowitz B. Expression of cystic fibrosis transmembrane regulator Cl- channel in the heart. Circ Res. 1992;71:1002-1007.[Abstract/Free Full Text]

8. Heginbotham L, Lu Z, Abramson T, MacKinnon R. Mutations in the potassium channel signature sequence. Biophys J. 1994;66:1061-1067.[Medline] [Order article via Infotrieve]

9. MacKinnon R. Determination of the subunit stoichiometry of a voltage-activated potassium channel. Nature. 1991;350:232-235.[Medline] [Order article via Infotrieve]

10. Sanguinetti MC, Curran ME, Spector PS, Keating MT. Spectrum of HERG K+ channel dysfunction in an inherited cardiac arrhythmia. Proc Natl Acad Sci U S A. 1996;93:2208-2212.[Abstract/Free Full Text]

11. Li G-R, Feng J, Yue L, Carrier M, Nattel S. Evidence for two components of delayed rectifier K+ current in ventricular myocytes. Circ Res. 1996;78:689-696.[Abstract/Free Full Text]

12. Vincent MG, Timothy KW, Leppert M, Keating M. The spectrum of the symptoms and QT intervals in carriers of the gene for the long-QT syndrome. N Engl J Med. 1992;327:846-852.[Abstract]




This article has been cited by other articles:


Home page
Circ Arrhythm ElectrophysiolHome page
A. J. Moss and I. Goldenberg
Importance of Knowing the Genotype and the Specific Mutation When Managing Patients With Long-QT Syndrome
Circ Arrhythm Electrophysiol, August 1, 2008; 1(3): 219 - 226.
[Full Text] [PDF]


Home page
CirculationHome page
S. E. Lehnart, M. J. Ackerman, D. W. Benson Jr, R. Brugada, C. E. Clancy, J. K. Donahue, A. L. George Jr, A. O. Grant, S. C. Groft, C. T. January, et al.
Inherited Arrhythmias: A National Heart, Lung, and Blood Institute and Office of Rare Diseases Workshop Consensus Report About the Diagnosis, Phenotyping, Molecular Mechanisms, and Therapeutic Approaches for Primary Cardiomyopathies of Gene Mutations Affecting Ion Channel Function
Circulation, November 13, 2007; 116(20): 2325 - 2345.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
A. J. Moss, W. Shimizu, A. A.M. Wilde, J. A. Towbin, W. Zareba, J. L. Robinson, M. Qi, G. M. Vincent, M. J. Ackerman, E. S. Kaufman, et al.
Clinical Aspects of Type-1 Long-QT Syndrome by Location, Coding Type, and Biophysical Function of Mutations Involving the KCNQ1 Gene
Circulation, May 15, 2007; 115(19): 2481 - 2489.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
I. R. Boulet, A. L. Raes, N. Ottschytsch, and D. J. Snyders
Functional effects of a KCNQ1 mutation associated with the long QT syndrome
Cardiovasc Res, June 1, 2006; 70(3): 466 - 474.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
A. J. Wilson, K. V. Quinn, F. M. Graves, M. Bitner-Glindzicz, and A. Tinker
Abnormal KCNQ1 trafficking influences disease pathogenesis in hereditary long QT syndromes (LQT1)
Cardiovasc Res, August 15, 2005; 67(3): 476 - 486.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
K.-H. Park, J. Piron, S. Dahimene, J. Merot, I. Baro, D. Escande, and G. Loussouarn
Impaired KCNQ1-KCNE1 and Phosphatidylinositol-4,5-Bisphosphate Interaction Underlies the Long QT Syndrome
Circ. Res., April 15, 2005; 96(7): 730 - 739.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
G. Seebohm, P. Westenskow, F. Lang, and M. C Sanguinetti
Mutation of colocalized residues of the pore helix and transmembrane segments S5 and S6 disrupt deactivation and modify inactivation of KCNQ1 K+ channels
J. Physiol., March 1, 2005; 563(2): 359 - 368.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
C. E. Clancy and R. S. Kass
Inherited and Acquired Vulnerability to Ventricular Arrhythmias: Cardiac Na+ and K+ Channels
Physiol Rev, January 1, 2005; 85(1): 33 - 47.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
M.R. K. Bhagavatula, C. Fan, G.-Q. Shen, J. Cassano, E. F. Plow, E. J. Topol, and Q. Wang
Transcription factor MEF2A mutations in patients with coronary artery disease
Hum. Mol. Genet., December 15, 2004; 13(24): 3181 - 3188.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
L. Wu, J. C. Shryock, Y. Song, Y. Li, C. Antzelevitch, and L. Belardinelli
Antiarrhythmic Effects of Ranolazine in a Guinea Pig in Vitro Model of Long-QT Syndrome
J. Pharmacol. Exp. Ther., August 1, 2004; 310(2): 599 - 605.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
W. Shimizu, M. Horie, S. Ohno, K. Takenaka, M. Yamaguchi, M. Shimizu, T. Washizuka, Y. Aizawa, K. Nakamura, T. Ohe, et al.
Mutation site-specific differences in arrhythmic risk and sensitivity to sympathetic stimulation in the LQT1 form of congenital long QT syndrome: Multicenter study in Japan
J. Am. Coll. Cardiol., July 7, 2004; 44(1): 117 - 125.
[Abstract] [Full Text] [PDF]


Home page
Exp PhysiolHome page
I. D. Millar, J. A. Hartley, C. Haigh, A. A. Grace, S. J. White, J. D. Kibble, and L. Robson
Volume regulation is defective in renal proximal tubule cells isolated from KCNE1 knockout mice
Exp Physiol, March 1, 2004; 89(2): 173 - 180.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
G. Seebohm, M. Pusch, J. Chen, and M. C. Sanguinetti
Pharmacological Activation of Normal and Arrhythmia-Associated Mutant KCNQ1 Potassium Channels
Circ. Res., November 14, 2003; 93(10): 941 - 947.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
G. Seebohm, M. C Sanguinetti, and M. Pusch
Tight coupling of rubidium conductance and inactivation in human KCNQ1 potassium channels
J. Physiol., October 15, 2003; 552(2): 369 - 378.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
N. Gamper, J. D. Stockand, and M. S. Shapiro
Subunit-Specific Modulation of KCNQ Potassium Channels by Src Tyrosine Kinase
J. Neurosci., January 1, 2003; 23(1): 84 - 95.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
A. Peretz, H. Schottelndreier, L. B. Aharon-Shamgar, and B. Attali
Modulation of homomeric and heteromeric KCNQ1 channels by external acidification
J. Physiol., December 15, 2002; 545(3): 751 - 766.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
A. A.M. Wilde and D. Escande
LQT genotype-phenotype relationships: patients and patches
Cardiovasc Res, September 1, 2001; 51(4): 627 - 629.
[Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
C.-C. Shieh, M. Coghlan, J. P. Sullivan, and M. Gopalakrishnan
Potassium Channels: Molecular Defects, Diseases, and Therapeutic Opportunities
Pharmacol. Rev., December 1, 2000; 52(4): 557 - 594.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
L. Bianchi, S. G. Priori, C. Napolitano, K. A. Surewicz, A. T. Dennis, M. Memmi, P. J. Schwartz, and A. M. Brown
Mechanisms of IKs suppression in LQT1 mutants
Am J Physiol Heart Circ Physiol, December 1, 2000; 279(6): H3003 - H3011.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
I. Splawski, J. Shen, K. W. Timothy, M. H. Lehmann, S. Priori, J. L. Robinson, A. J. Moss, P. J. Schwartz, J. A. Towbin, G. M. Vincent, et al.
Spectrum of Mutations in Long-QT Syndrome Genes : KVLQT1, HERG, SCN5A, KCNE1, and KCNE2
Circulation, September 5, 2000; 102(10): 1178 - 1185.
[Abstract] [Full Text] [PDF]


Home page
JGPHome page
A. R. Tapper and A. L. George Jr.
Mink Subdomains That Mediate Modulation of and Association with Kvlqt1
J. Gen. Physiol., September 1, 2000; 116(3): 379 - 390.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
C.-E. Chiang and D. M. Roden
The long QT syndromes: genetic basis and clinical implications
J. Am. Coll. Cardiol., July 1, 2000; 36(1): 1 - 12.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
C. Chouabe, N. Neyroud, P. Richard, I. Denjoy, B. Hainque, G. Romey, M.-D. Drici, P. Guicheney, and J. Barhanin
Novel mutations in KvLQT1 that affect Iks activation through interactions with Isk
Cardiovasc Res, March 1, 2000; 45(4): 971 - 980.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
D. Weinshenker, A. Wei, L. Salkoff, and J. H. Thomas
Block of an ether-a-go-go-Like K+ Channel by Imipramine Rescues egl-2 Excitation Defects in Caenorhabditis elegans
J. Neurosci., November 15, 1999; 19(22): 9831 - 9840.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
F. Lehmann-Horn and K. Jurkat-Rott
Voltage-Gated Ion Channels and Hereditary Disease
Physiol Rev, October 1, 1999; 79(4): 1317 - 1372.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Franqueza, M. Lin, I. Splawski, M. T. Keating, and M. C. Sanguinetti
Long QT Syndrome-associated Mutations in the S4-S5 Linker of KvLQT1 Potassium Channels Modify Gating and Interaction with minK Subunits
J. Biol. Chem., July 23, 1999; 274(30): 21063 - 21070.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
N. Neyroud, P. Richard, N. Vignier, C. Donger, I. Denjoy, L. Demay, M. Shkolnikova, R. Pesce, P. Chevalier, B. Hainque, et al.
Genomic Organization of the KCNQ1 K+ Channel Gene and Identification of C-Terminal Mutations in the Long-QT Syndrome
Circ. Res., February 19, 1999; 84(3): 290 - 297.
[Abstract] [Full Text] [PDF]


Home page
JGPHome page
Y. Yang and F. J. Sigworth
Single-Channel Properties of IKs Potassium Channels
J. Gen. Physiol., December 1, 1998; 112(6): 665 - 678.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W.-P. Yang, P. C. Levesque, W. A. Little, M. L. Conder, P. Ramakrishnan, M. G. Neubauer, and M. A. Blanar
Functional Expression of Two KvLQT1-related Potassium Channels Responsible for an Inherited Idiopathic Epilepsy
J. Biol. Chem., July 31, 1998; 273(31): 19419 - 19423.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M.-D. Drici, I. Arrighi, C. Chouabe, J. R. Mann, M. Lazdunski, G. Romey, and J. Barhanin
Involvement of IsK-Associated K+ Channel in Heart Rate Control of Repolarization in a Murine Engineered Model of Jervell and Lange-Nielsen Syndrome
Circ. Res., July 13, 1998; 83(1): 95 - 102.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Seebohm, C. R. Scherer, A. E. Busch, and C. Lerche
Identification of Specific Pore Residues Mediating KCNQ1 Inactivation. A NOVEL MECHANISM FOR LONG QT SYNDROME
J. Biol. Chem., April 20, 2001; 276(17): 13600 - 13605.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shalaby, F. Y.
Right arrow Articles by Blanar, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shalaby, F. Y.
Right arrow Articles by Blanar, M. A.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*OMIM
*Protein*UniGene
*Substance via MeSH