From Lillie Frank Abercrombie Section of Cardiology, Department of
Pediatrics (H.L, Q.C., V.G., S.W.D., Q.W., J.A.T.), and Department of
Molecular and Human Genetics (J.A.T.), Baylor College of Medicine, Houston,
Tex; Children's Hospital and Health Center, San Diego, Calif (J.C.P.);
Department of Medicine, University of Rochester Medical Center, Rochester, NY
(A.J.M., J.R.); Department of Medicine, LDS Hospital and University of Utah
School of Medicine, Salt Lake City (G.M.V.); Department of Cardiology,
University of Pavia and Policlinico S. Matteo, IFCCS, Pavia, Italy (S.G.P.,
P.J.S.); Arrhythmia Center, Sinai Hospital, Wayne State University School of
Medicine, Detroit, Mich (M.H.L.); Pediatric Cardiology, Our Lady's
Hospital for Sick Children, Dublin, Ireland (D.D.); Pediatric Cardiology,
Children's Mercy Hospital, Kansas City, Mo (S.K.); and National
Cardiovascular Center, Osaka, Japan (W.S.).
Correspondence to Jeffrey A. Towbin, MD, Pediatrics (Cardiology), Baylor College of Medicine, One Baylor Plaza, Room 333E, Houston, TX 77030. E-mail jtowbin{at}bcm.tmc.edu
Methods and ResultsAfter studying 115 families with LQTS, we
used single-strand conformation polymorphism (SSCP) and DNA
sequence analysis to identify mutations in the cardiac
potassium channel gene, KVLQT1. Affected members of
seven LQTS families were found to have new, previously unidentified
mutations, including two identical missense mutations, four identical
splicing mutations, and one 3-bp deletion. An identical splicing
mutation was identified in affected members of four unrelated families
(one Italian, one Irish, and two American), leading to an alternatively
spliced form of KVLQT1. The 3-bp deletion arose de novo
and occurs at an exon-intron boundary. This results in a single base
deletion in the KVLQT1 cDNA sequence and alters
splicing, leading to the truncation of KVLQT1
protein.
ConclusionsWe have identified LQTS-causing mutations of
KVLQT1 in seven families. Five KVLQT1
mutations cause the truncation of KVLQT1 protein. These
data further confirm that KVLQT1 mutations cause LQTS.
The location and character of these mutations expand the types of
mutation, confirm a mutational hot spot, and suggest that they act
through a loss-of-function mechanism or a dominant-negative mechanism.
Inherited LQTS can result from at least five different genes. Four
genes were mapped to chromosome 11p15.5
(LQT1),12 13 7q3536
(LQT2),14 3p2124
(LQT3),14 and 4q2527
(LQT4).15 Several other families with
autosomal dominant LQTS are not linked to any known LQTS loci
(unpublished data), indicating that additional LQTS locus
heterogeneity exists. Three LQTS genes
(LQT1, LQT2, and LQT3) were identified
either by the candidate gene approach or positional cloning. These
include the cardiac potassium channel genes KVLQT1
(LQT1),16 HERG
(LQT2),17 and the cardiac sodium
channel gene SCN5A
(LQT3).18 19 In addition, mutations in
KVLQT1 were shown to result in both Romano-Ward syndrome
(heterozygous mutations) and Jervell and Lange-Nielsen syndrome
(homozygous mutations).16 20 Wang et
al16 identified 11 different types of
KVLQT1 mutations (one 3-bp deletion and 10 missense
mutations) in 16 LQTS families with Romano-Ward syndrome and, more
recently, Neyroud et al20 identified a homozygous
insertion-deletion mutation in Jervell and Lange-Nielsen
syndrome.16 Here, we report identification of new
KVLQT1 mutations in affected members of seven families with
Romano-Ward syndrome. We identified two identical missense mutations
(one in a white kindred and the other in a Japanese family), four
identical splicing mutations, and a 3-bp deletion that truncates the
KVLQT1 channel; the latter mutation arose de novo.
Genomic DNA Samples and Linkage Analysis
Genotypic analysis for paternity evaluation was performed with
15 short-tandem-repeat polymorphisms that were previously mapped to
15 different chromosomes (Genome Data Base). Amplification of each
short tandem repeat was carried out as previously
described.14 16
SSCP Analysis
Amplified samples were diluted fivefold with 50 µL of formamide
buffer (95% formamide, 10 mmol/L EDTA, 0.1% bromphenol blue,
0.1% xylene cyanol) and 50 µL of 0.1% SDS/10 mmol/L EDTA. The
mixture was denatured at 94°C for 5 minutes, then cooled rapidly on
ice and held for 5 minutes. For each sample, 3 to 5 µL was loaded
onto 10% nondenaturing polyacrylamide gels
(acrylamide to bisacrylamide ratio=50:1) and
run at 8 W overnight at room temperature. Gels were dried on Schleicher
and Schuell filter paper and exposed to x-ray film.
DNA Sequencing
KVLQT1 Missense Mutations Associated With LQTS in
Two Families
De Novo Intragenic Deletion of KVLQT1 in a Sporadic Case of
LQTS
Phenotype-Genotype Correlation
An identical splicing mutation was identified in affected members of
four unrelated families (one Italian, one Irish, and two American); no
unaffected individuals from these families or from more than 150 normal
control subjects demonstrate the splicing mutation. In addition, the
mutation occurs in a highly conserved region of the gene. Together,
these data strongly suggest that the splicing change we identified is
the disease-causing mutation. We also identified a 3-bp deletion that
arose de novo. The 3-bp deletion, spanning an exon-intron boundary in
the pore region, not only alters splicing but also leads to a 1-bp
deletion in the coding region, causing a frame shift and truncation of
the KVLQT1 protein. These data strongly support the notion
that mutations in KVLQT1 cause the chromosome 11linked
LQTS.
Since the original identification of genes for chromosome 3linked
LQTS (SCN5A) and chromosome 7linked LQTS
(HERG), electrophysiological
studies have established that the molecular mechanism for chromosome
3linked LQTS is the presence of a late phase of
inactivation-resistant sodium current in the plateau phase of
the action potential (a gain-of-function
mechanism),26 27 whereas HERG
mutations cause the loss of IKr potassium
current28 29 through dominant-negative mechanisms
or loss-of-function mechanisms.30 Molecular
mechanisms of KVLQT1 mutations are currently unknown.
Analysis of the predicted amino acid sequence of
KVLQT1 suggests that it encodes a potassium channel
subunit.16 Recent
electrophysiological characterization of
the KVLQT1 protein in various heterologous systems has
confirmed that KVLQT1 is a voltage-gated potassium channel
protein.31 32 When coexpressed with
minK, KVLQTI forms the slowly activating
potassium current (IKs) in cardiac
myocytes.31 32 A combination of normal and mutant
KVLQT1 subunits could therefore form abnormal
IKs channels. Thus, LQTS-associated
mutations of KVLQT1 could act through a dominant-negative
mechanism. The type and location of KVLQT1 mutations
described here are consistent with this hypothesis. The
missense mutation, A246V, was identified in two families and affects
the S6 domain. Two mutations lead to premature termination and
truncated proteins (one splicing mutation identified in four unrelated
families and one 3-bp deletion that arose de novo). In the first case,
the S6 domain and the carboxyl end of the protein are truncated,
leaving intact the amino end of the protein and S1 domain to the pore.
In the second case, a frame shift and altered splicing cause truncation
of the protein in the pore. Alternatively, the latter two mutations
could act through a loss-of-function mechanism. In general, these
patients had moderate symptomatology, with relatively frequent episodes
of syncope and long QTc intervals (>0.500
second). It is unclear whether mutations in certain regions of the
KVLQT1 gene will cause more malignant disease than mutations
in other regions of the gene. Electrophysiological
characterization of KVLQT1 mutations will shed light on the
molecular mechanisms of these mutations and possibly allow for
predictions of clinical outcome.
Neyroud et al20 demonstrated a homozygous
insertion-deletion mutation in the 3' end of KVLQT1 leading
to Jervell and Lange-Nielsen syndrome, which includes LQT and deafness.
They show that the hearing abnormality occurs in three individuals
because of the loss of function of the channel, which is the result of
mutation on both alleles (ie, homozygous mutation). When a
heterozygous mutation occurs, no matter at which end of the gene, it
appears that Romano-Ward syndrome (ie, no deafness) results. Despite
the possibility that heterozygous mutations in KVLQT1 act in
a dominant-negative mechanism, some functional KVLQT1
potassium channels exist in the stria vascularis of the inner ear.
Therefore, deafness is averted.
Identification of SCN5A and HERG as LQTS genes
has led to potential new rational gene-specific therapy to prevent
life-threatening arrhythmias. Mexiletine, a sodium channel
blocking agent, has been shown to markedly shorten the
QTc of chromosome 3linked LQTS patients and to
have only a modest effect on chromosomes 7and 11linked LQTS
patients.33 By contrast, raising the serum
potassium concentration was shown to be effective in shortening the
QTc interval for patients with chromosome
7linked LQTS; however, no corresponding data have yet been reported
for chromosomes 3and 11linked patients.34 No
effective treatment for patients with chromosome 11linked LQTS is
currently known. Studies with various interventions, for example,
potassium channel opening agents,35 are needed to
identify therapeutic strategies aimed at reducing the risk of
life-threatening arrhythmias in patients with KVLQT1
mutations.
Received June 5, 1997;
revision received December 4, 1997;
accepted December 5, 1997.
2.
Willich SN, Levy D, Rocco MB, Tofler GH, Stone PH,
Muller JOE. Circadian variation in the incidence of sudden cardiac
death in the Framingham heart study population. Am J
Cardiol. 1987;60:801806.[Medline]
[Order article via Infotrieve]
3.
Ward OC. A new familial cardiac syndrome in children.
J Ir Med Assoc. 1964;54:103106.[Medline]
[Order article via Infotrieve]
4.
Romano C. Congenital cardiac arrhythmia.
Lancet. 1965;1:658659.[Medline]
[Order article via Infotrieve]
5.
Schwartz PJ, Periti M, Malliani A. The long QT
syndrome. Am Heart J. 1975;109:378390.
6.
Moss AJ, McDonald J. Unilateral cervicothoracic
sympathetic ganglionectomy for the treatment of long QT interval
syndrome. N Engl J Med. 1970;285:903904.
7.
Schwartz PJ, Locati EN, Napolitano C, Priori SG. The
long QT syndrome. In: Zipes DP, Jalife J, eds. Cardiac
Electrophysiology: From Cell to Bedside. Philadelphia, Pa: WB
Saunders Co; 1995:788811.
8.
Moss AJ, Schwartz PJ, Crampton KS, Tzlvoni D, Locati
EH, MacCluer J, Hall WJ, Weitkamp I, Vincent GM, Garson A Jr, Robinson
JL, Benhorin J, Choi S. The long QT syndrome: prospective longitudinal
study of 328 families. Circulation. 1991;84:11361144.
9.
Roden DM, Lazzara R, Rosen M, Schwartz PJ, Towbin J,
Vincent GM. Multiple mechanisms in the long-QT syndrome: current
knowledge, gaps, and future directions. Circulation. 1996;94:19962012.
10.
Vincent GM, Timothy KW, Leppert MF, Keating MT. The
spectrum of symptoms and QT intervals in carriers of the gene for the
long QT syndrome. N Engl J Med. 1992;327:846852.[Abstract]
11.
Jervell A, Lange-Nielsen F. Congenital deaf mutism,
functional heart disease with prolongation of the QT interval, and
sudden death. Am Heart J. 1957;54:5978.[Medline]
[Order article via Infotrieve]
12.
Keating MT, Atkinson D, Dunn C, Timothy K, Vincent GM,
Leppert M. Linkage of a cardiac arrhythmia, the long QT
syndrome, and the Harvey ras-1 gene. Science. 1991;252:704706.
13.
Keating MT, Atkinson D, Dunn C, Timothy K, Vincent GM,
Leppert M. Consistent linkage of the long QT syndrome to the
Harvey ras-1 locus on chromosome 11. Am J Hum
Genet. 1991;49:13351339.[Medline]
[Order article via Infotrieve]
14.
Jiang C, Atkinson D, Towbin JA, Splawski I, Lehmann MH,
Li H, Timothy K, Taggart RT, Schwartz PJ, Vincent GM, Moss AJ, Keating
MT. Two long QT syndrome loci map to chromosomes 3 and 7 with evidence
for further heterogeneity. Nat Genet. 1994;8:141147.[Medline]
[Order article via Infotrieve]
15.
Schott J, Charpentier F, Peltier S, Foley P, Drouin E,
Bouhour J, Donnelly P, Vergnaud G, Bachner L, Moisan J, Marec HL,
Pascal O. Mapping of a gene for long QT syndrome to chromosome
4q2527. Am J Hum Genet. 1995;57:11141122.[Medline]
[Order article via Infotrieve]
16.
Wang Q, Curran ME, Splawski I, Connors TD, Burn TC,
Millholland JM, VanRaay TJ, Shen J, de Jager T, Schwartz PJ, Towbin JA,
Moss AJ, Atkinson DL, Timothy KW, Vincent GM, Landes GM, Connors TD,
Keating MT. Positional cloning of a novel potassium channel gene:
KVLQT1 mutations cause cardiac arrhythmias.
Nat Genet. 1996;12:1723.[Medline]
[Order article via Infotrieve]
17.
Curran ME, Splawski I, Timothy KW, Vincent GM, Geen ED,
Keating MT. A molecular basis for cardiac arrhythmia:
HERG mutations cause long QT syndrome. Cell. 1995;80:795803.[Medline]
[Order article via Infotrieve]
18.
Wang Q, Shen J, Splawski I, Atkinson D, Li Z, Robinson
JL, Moss AJ, Towbin JA, Keating MT. SCN5A mutations
associated with an inherited cardiac arrhythmia, long QT
syndrome. Cell. 1995;80:805811.[Medline]
[Order article via Infotrieve]
19.
Wang Q, Shen J, Li Z, Timothy K, Vincent GM, Priori S,
Schwartz PJ, Keating MT. Cardiac sodium channel mutations in patients
with long QT syndrome, an inherited cardiac arrhythmia.
Hum Mol Genet. 1995;4:16031607.
20.
Neyroud N, Tesson F, Denjoy I, Leibovici M, Donger C,
Barhanin J, Faure S, Gary F, Coumel P, Petti C, Schwartz K, Guicheney
P. A novel mutation on the potassium channel gene KVLQT1
causes the Jervell and Lange-Nielsen cardioauditory syndrome. Nat
Genet. 1997;15:186189.[Medline]
[Order article via Infotrieve]
21.
Bazett HC. An analysis of the time-relationship
of electrocardiograms. Heart. 1920;7:353370.
22.
Anderson MA, Gusella JK. Use of cyclosporin A in
establishing Epstein-Barr virus-transformed human lymphoblastoid cell
lines. In Vitro. 1984;20:856858.[Medline]
[Order article via Infotrieve]
23.
Marchuk D, Drumm M, Saulino A, Collins FS. Construction
of T-vectors, a rapid and general system for direct cloning of
unmodified PCR products. Nucleic Acids Res. 1990;19:1154.
24.
Tanaka T, Nagai R, Tomoike H, Takata S, Yano K, Yabuta
K, Haned N, Nakano O, Shibata A, Sawayama T, Kasai H, Yazaki Y,
Nakamura Y. Four novel KVLQT1 and four novel HERG
mutations in familial long-QT syndrome. Circulation. 1997;95:565567.
25.
Russell MW, Dick M II, Collins FS, Brody LC.
KVLQT1 mutations in three familial or sporadic long QT
syndrome. Hum Mol Genet. 1996;9:13191324.
26.
Dumaine R, Wang Q, Keating MT, Hartmann HA, Schwartz
PJ, Brown AM, Kirsch GE. Multiple mechanisms of sodium channel-linked
long QT syndrome. Circ Res. 1996;78:916924.
27.
Bennett PB, Patton DE, Scheuer T, Wang Y, Goldin AL,
Catterall WA. Molecular mechanism for an inherited cardiac
arrhythmia. Nature. 1995;376:683685.[Medline]
[Order article via Infotrieve]
28.
Sanguinetti MC, Jiang C, Curran ME, Keating MT. A
mechanistic link between an inherited and an acquired cardiac
arrhythmia: HERG encodes the
IKr potassium channel. Cell. 1995;81:299307.[Medline]
[Order article via Infotrieve]
29.
Trudeau MC, Warmke J, Ganetzky B, Robertson G.
HERG, a human inward rectifier in the voltage-gated
potassium channel family. Science. 1995;269:9295.
30.
Sanguinetti MC, Curran ME, Spector PS, Keating MT.
Spectrum of HERG K+-channel
dysfunction in an inherited cardiac arrhythmia. Proc Natl
Acad Sci U S A. 1996;93:22082212.
31.
Barhanin J, Lesage F, Guillemare E, Finc M, Lazdunski
M, Romey G. KVLQT1 and IsK (minK)
proteins associate to form the IKs cardiac
potassium current. Nature. 1996;384:7880.[Medline]
[Order article via Infotrieve]
32.
Sanguinetti MC, Curran ME, Zou A, Shen J, Spector PS,
Atkinson DL, Keating MT. Coassembly of KVLQT1 and
minK (IsK) proteins to form cardiac
IKs potassium channel. Nature. 1996;384:8083.[Medline]
[Order article via Infotrieve]
33.
Schwartz PJ, Priori SG, Locati E, Napolitano C, Cantu
F, Towbin JA, Keating MT, Hammoude H, Brown AM, Chen L, Colatsky TJ.
Long QT syndrome patients with mutations of the SCN5A and
HERG genes have differential responses to
Na+ channel blockade and to increases in heart
rate: implications for gene-specific therapy. Circulation. 1995;92:33813386.
34.
Compton SJ, Lux RL, Ramsey MR, Strelich KR, Sanguinetti
MC, Green LS, Keating MT, Mason JW. Genetically defined therapy of
inherited long-QT syndrome. Circulation. 1996;94:10181022.
35.
Carlsson L, Abrahamsson C, Drews L, Ducker G.
Antiarrhythmic effects of potassium channel openers in rhythm
abnormalities related to delayed repolarization.
Circulation. 1991;85:14911500.
© 1998 American Heart Association, Inc.
Clinical Investigation and Reports
New Mutations in the KVLQT1 Potassium Channel That Cause Long-QT Syndrome
![]()
Abstract
Top
Abstract
Introduction
Methods
Results
Discussion
References
BackgroundLong-QT syndrome (LQTS)
is an inherited cardiac arrhythmia that causes sudden death in
young, otherwise healthy people. Four genes for LQTS have been mapped
to chromosome 11p15.5 (LQT1), 7q3536
(LQT2), 3p2124 (LQT3), and 4q2527
(LQT4). Genes responsible for LQT1,
LQT2, and LQT3 have been identified as
cardiac potassium channel genes (KVLQT1,
HERG) and the cardiac sodium channel gene
(SCN5A).
Key Words: arrhythmias long-QT syndrome potassium death, sudden KVLQT1
![]()
Introduction
Top
Abstract
Introduction
Methods
Results
Discussion
References
Sudden death from
cardiac arrhythmias is thought to account for 11% of all
natural deaths.1 2 LQTS is an inherited cardiac
disorder that causes syncope, seizures, and sudden death, usually in
young and otherwise healthy individuals.3 4 5 6 7 8 In
many cases, the first symptom is sudden death. Individuals with LQTS
usually have prolongation of the QT interval on
electrocardiograms, an indication of abnormal
repolarization.5 9 10 The clinical features of
LQTS result from episodic ventricular
tachyarrhythmias, specifically torsade de pointes and
ventricular fibrillation.9 10 11
![]()
Methods
Top
Abstract
Introduction
Methods
Results
Discussion
References
Identification of LQTS Patients
LQTS patients were identified throughout North America, Europe,
and Asia, with the majority of patients being identified from the
International LQTS Registry established by the National Institutes of
Health at the University of Rochester, NY. Informed consent was
obtained from participants in 115 families in accordance with standards
established by local institutional review boards. For each individual,
historical data (the presence of syncope, the number of syncopal
episodes, the presence of seizures, the age of onset of symptoms, and
the occurrence of sudden death) and the length of the
QTc21 were obtained. Phenotypic
criteria used were as follows: (1) Individuals without any symptoms and
with a QTc of
0.41 second were classified as
unaffected, (2) symptomatic individuals with a
QTc of
0.45 second and asymptomatic
individuals with a QTc of
0.47 seconds were
considered affected, and (3) symptomatic individuals with a
QTc of
0.44 second and asymptomatic
individuals with a QTc between 0.41 and 0.47
second were classified as
uncertain.12 14 16 18
Genomic DNA was prepared from peripheral blood
lymphocytes or cell lines derived from Epstein-Barr virustransformed
lymphocytes by standard procedures.22
SSCP and DNA sequence analyses were used to screen for
KVLQT1 mutations with DNA samples from 115 LQTS families.
The partial genomic structure of KVLQT1 was previously
determined.16 Primers (intronic sequences) that
can PCR-amplify exons encoding transmembrane domains S2-S6 were defined
previously from the partial genomic structure and used in this study
for SSCP analysis.16 PCR was carried out
in a 10-µL volume containing 50 ng genomic DNA, 0.52 µmol/L of
each primer, 75 µmol/L of each dNTP, 1 µCi
[
-32P]dCTP, 0.24 mmol/L spermidine,
1.5 mmol/L MgCl2, 10 mmol/L Tris (pH
8.3), 50 mmol/L KCl, and 1 U Taq DNA polymerase
(Promega and Gibco-BRL). PCR amplification was carried out in a
Perkin-Elmer System 9600 thermocycler using the following profile: 1
cycle of denaturation at 94°C for 5 minutes; 5 cycles at 94°C for
20 seconds, 64°C for 20 seconds, 72°C for 30 seconds; and 25 cycles
of 94°C for 20 seconds, 62°C for 20 seconds, 72°C for 30 seconds;
followed by a 5-minute extension at 72°C.
Both normal and aberrant SSCP bands were cut out of the gel and
rehydrated in 100 µL water for 30 minutes at 65°C. Ten microliters
of the eluted DNA was reamplified with the original PCR primers in a
total volume of 100 µL. Amplified products were purified through
2% low-melting agarose. These products were sequenced directly
with an ABI Sequencer or subcloned into
PBluescript-SK(+) (Stratagene) by use of the
T-vector method as described,23 and several
colonies were sequenced by the dideoxy chain termination method with
Sequenase Version 2.0 (United States Biochemicals, Inc).
![]()
Results
Top
Abstract
Introduction
Methods
Results
Discussion
References
KVLQT1 Splicing Mutations Associated With LQTS in
Four Families
Aberrant SSCP conformers were identified in affected members of
four families (F1002, F1003, F1004, and F1005; Fig 1
); these SSCP anomalies were not
observed in DNA samples from unaffected members of these families (Fig 1
) or from more than 150 control subjects (data not shown). The pattern
of aberrant banding appeared to be similar in all four LQTS families
(Fig 1
). Sequence analysis of the aberrant bands revealed the
presence of an identical splicing mutation, a G-to-A substitution, in
all four families. This substitution occurs at the third position of
codon A249 (SP/A249/g-a) and disrupts the splice-donor sequence within
the S6 transmembrane domain. The fact that the same substitution
cosegregated with the disease status in four unrelated LQTS families
(one Italian, one Irish, and two American) strongly suggests this
variant to be a mutation.

View larger version (30K):
[in a new window]
Figure 1. KVLQT1 splicing mutation
cosegregating with LQT in families F1002, F1003, F1004, and F1005.
Pedigree structures are shown. Individuals with characteristic features
of LQT, including prolongation of QT interval on ECG and history of
syncope or aborted sudden death are indicated by solid circles
(females) or squares (males). Unaffected individuals are indicated by
open symbols, and individuals with an equivocal phenotype by
hatched symbols. Deceased individuals are indicated by a slash. Results
of SSCP analyses are shown below each pedigree. Aberrant SSCP
conformers are indicated by arrows. Sequence analyses of normal
(left) and aberrant (right) conformers revealed that all four families
had an identical change, a G to A substitution (SP/A249/g-a). This
mutation occurs in splice-donor sequence of exon in S6 domain. PCR
primers 9 and 10 in Wang et al16 were used: 9,
CCCCAGGACCCCAGCTGTCCAA; and 10, AGGCTGACCACTGTCCCTCT.
SSCP analysis with a pair of primers in the S6 domain
revealed aberrant bands in affected members of families F1006 and F1007
(Fig 2
). These abnormal SSCP bands were
not seen in DNA samples from unaffected members of these families (Fig 2
) or from more than 150 control individuals (data not shown). DNA
sequence analysis of the normal and aberrant conformers
revealed that both F1006 and F1007 had an identical missense
mutation, a single base substitution (C to T) (Fig 2
). This
mutation results in substitution of an alanine by a valine at position
246 (A246V) within transmembrane domain S6 (Fig 2C
).

View larger version (20K):
[in a new window]
Figure 2. KVLQT1 missense mutation identified
in F1006 and F1007. Results of SSCP analyses are shown below
each pedigree, with aberrant SSCP conformer indicated by arrow.
Sequence analyses of normal (left) and aberrant (right)
conformers reveal a C to T substitution at codon 246. This mutation
causes substitution of an alanine residue by a valine (A246V). F1006 is
a Japanese family and F1007 a white family. Same mutation was
previously reported in six other families.16 25 PCR primers
9 and 10 in Wang et al16 were used (see Fig 1
).
SSCP analysis with a pair of primers within the pore
region of KVLQT1 identified an aberrant conformer in an
affected individual in F1008 (Fig 3
).
This SSCP anomaly was not observed in DNA samples from either parent,
from the patient's unaffected brother (Fig 3
), or from more than 150
control subjects (data not shown). Direct sequencing of the abnormal
SSCP band identified a 3-bp deletion (SP/V212/
GGT) spanning an
exon-intron boundary in the pore region. This deletion results in a
frame shift and alters splicing, leading to the truncation of the
KVLQT1 protein. Genotypic analysis of this family
using more than 15 polymorphic markers confirmed paternity.

View larger version (21K):
[in a new window]
Figure 3. De novo mutation of KVLQT1
identified in sporadic case of LQT. Pedigree structure of F1008 is
shown. Results of SSCP analyses are shown below pedigree.
Aberrant conformer is indicated by arrow. DNA sequence analysis
identified a 3-bp deletion (SP/V212/
ggt) spanning an exon-intron
boundary in pore region. This mutation results in a frame shift in
KVLQT1 cDNA sequence, leading to a nonfunctional
protein. Genotypic analysis of this kindred using more than 15
polymorphic markers confirmed maternity and paternity.
QTc intervals for proband, proband's father, and
proband's mother are 0.50, 0.39, and 0.36 second, respectively. PCR
primers 7 and 8 in Wang et al16 were used: 7,
TCCTGGAGCCCGAACTGTGTGT; and 8, AGGCTGACCACTGTCCCTCT.
Despite the genotypic differences found in these seven families,
the phenotype was fairly similar in all affected individuals
(Table 1
). In six of seven families, the
QTc was >0.500 second; the seventh family had
QTc measured in the range of 0.490 to 0.493. In
addition, six of seven families were symptomatic, with
episodes of syncope. Only the family in which the
QTc was <0.500 second was without symptoms
(Table 1
). T-wave alternans, ventricular
tachycardia, and torsade de pointes were uncommon; only one
family had evidence of T-wave alternans, and two families were noted to
have episodes of torsade de pointes (Table 1
).
View this table:
[in a new window]
Table 1. Phenotype-Genotype Correlation
![]()
Discussion
Top
Abstract
Introduction
Methods
Results
Discussion
References
The potassium channel gene KVLQT1 was initially
identified by positional cloning,16 and 11
different types of missense mutations of KVLQT1 were
identified in 16 LQTS families16 in the original
report (Table 2
). Later, Tanaka et
al24 reported four missense mutations, and
Russell et al25 reported two additional missense
mutations in three LQTS families, including a previously reported
mutation, A246V (previously named A212V) (Table 2
). In this report, we
found the same A246V mutation in affected members of two more LQTS
families, including one Japanese family (Table 2
and Fig 4
). To date, of 30 families with
KVLQT1 mutations, alanine at position 246 was mutated 10
times (33%) (Table 2
). The frequent occurrence of A246 mutations and
its presence in both white and Japanese populations indicate that the
alanine residue at position 246 is a mutational hot spot in
KVLQT1.
View this table:
[in a new window]
Table 2. Summary of KVLQT1 Mutations

View larger version (26K):
[in a new window]
Figure 4. Model for KVLQT1 potassium channel
and location of LQT mutations. Channel consists of six putative
membrane-embedded homologous domains (S1 to S6).
![]()
Selected Abbreviations and Acronyms
LQTS
=
long-QT syndrome
PCR
=
polymerase chain reaction
QTc
=
QT interval on ECG corrected for heart rate
SSCP
=
single-strand conformation polymorphism
![]()
Acknowledgments
This work was supported by the Abercrombie
Cardiology Fund, Texas Children's Hospital (Dr Wang),
NIH grants R01-HL-33843 and R01-HL-51618 (Dr Moss), and The Texas
Children's Hospital Foundation Endowed Chair in Pediatric Cardiac
Research (Dr Towbin). Dr Wang is also a Visiting Professor of the China
National Rice Research Institute.
![]()
Footnotes
Guest editor for this article was D. Woodrow Benson, MD, Seidman Laboratory, Boston, Mass.
![]()
References
Top
Abstract
Introduction
Methods
Results
Discussion
References
1.
Kannel WB, Cupples A, D'Agostino RB. Sudden death
risk in overt coronary heart diseases: the Framingham study.
Am Heart J. 1987;113:799804.[Medline]
[Order article via Infotrieve]
This article has been cited by other articles:
![]() |
D. M. Roden Long-QT Syndrome N. Engl. J. Med., January 10, 2008; 358(2): 169 - 176. [Full Text] [PDF] |
||||
![]() |
A. Anastasakis, C.-M. Kotta, S. Kyriakogonas, B. Wollnik, A. Theopistou, and C. Stefanadis Phenotype reveals genotype in a Greek long QT syndrome family. Europace, April 1, 2006; 8(4): 241 - 244. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Tian, Y. Fu, D. H. Wang, and D. M. Cohen Regulation of TRPV1 by a novel renally expressed rat TRPV1 splice variant Am J Physiol Renal Physiol, January 1, 2006; 290(1): F117 - F126. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-H. Park, J. Piron, S. Dahimene, J. Merot, I. Baro, D. Escande, and G. Loussouarn Impaired KCNQ1-KCNE1 and Phosphatidylinositol-4,5-Bisphosphate Interaction Underlies the Long QT Syndrome Circ. Res., April 15, 2005; 96(7): 730 - 739. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Seebohm, M. Pusch, J. Chen, and M. C. Sanguinetti Pharmacological Activation of Normal and Arrhythmia-Associated Mutant KCNQ1 Potassium Channels Circ. Res., November 14, 2003; 93(10): 941 - 947. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Vatta, R. Dumaine, G. Varghese, T. A. Richard, W. Shimizu, N. Aihara, K. Nademanee, R. Brugada, J. Brugada, G. Veerakul, et al. Genetic and biophysical basis of sudden unexplained nocturnal death syndrome (SUNDS), a disease allelic to Brugada syndrome Hum. Mol. Genet., February 1, 2002; 11(3): 337 - 345. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Huang, M. Bitner-Glindzicz, L. Tranebjaerg, and A. Tinker A spectrum of functional effects for disease causing mutations in the Jervell and Lange-Nielsen syndrome Cardiovasc Res, September 1, 2001; 51(4): 670 - 680. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Towbin, Z. Wang, and H. Li Genotype and Severity of Long QT Syndrome Drug Metab. Dispos., April 1, 2001; 29(4): 574 - 579. [Abstract] [Full Text] |
||||
![]() |
F. Ichida, S. Tsubata, K. R. Bowles, N. Haneda, K. Uese, T. Miyawaki, W. J. Dreyer, J. Messina, H. Li, N. E. Bowles, et al. Novel Gene Mutations in Patients With Left Ventricular Noncompaction or Barth Syndrome Circulation, March 6, 2001; 103(9): 1256 - 1263. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Lande, F. Kyndt, I. Baro, D. Chabannes, P. Boisseau, J.-C. Pony, D. Escande, and H. Le Marec Dynamic analysis of the QT interval in long QT1 syndrome patients with a normal phenotype Eur. Heart J., March 1, 2001; 22(5): 410 - 422. [Abstract] [PDF] |
||||
![]() |
C.-C. Shieh, M. Coghlan, J. P. Sullivan, and M. Gopalakrishnan Potassium Channels: Molecular Defects, Diseases, and Therapeutic Opportunities Pharmacol. Rev., December 1, 2000; 52(4): 557 - 594. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Bianchi, S. G. Priori, C. Napolitano, K. A. Surewicz, A. T. Dennis, M. Memmi, P. J. Schwartz, and A. M. Brown Mechanisms of IKs suppression in LQT1 mutants Am J Physiol Heart Circ Physiol, December 1, 2000; 279(6): H3003 - H3011. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Splawski, J. Shen, K. W. Timothy, M. H. Lehmann, S. Priori, J. L. Robinson, A. J. Moss, P. J. Schwartz, J. A. Towbin, G. M. Vincent, et al. Spectrum of Mutations in Long-QT Syndrome Genes : KVLQT1, HERG, SCN5A, KCNE1, and KCNE2 Circulation, September 5, 2000; 102(10): 1178 - 1185. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-E. Chiang and D. M. Roden The long QT syndromes: genetic basis and clinical implications J. Am. Coll. Cardiol., July 1, 2000; 36(1): 1 - 12. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Lehmann-Horn and K. Jurkat-Rott Voltage-Gated Ion Channels and Hereditary Disease Physiol Rev, October 1, 1999; 79(4): 1317 - 1372. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Murray, C. Donger, C. Fenske, I. Spillman, P. Richard, Y. B. Dong, N. Neyroud, P. Chevalier, I. Denjoy, N. Carter, et al. Splicing Mutations in KCNQ1 : A Mutation Hot Spot at Codon 344 That Produces In Frame Transcripts Circulation, September 7, 1999; 100(10): 1077 - 1084. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Tyson, S. Malcolm, and M. Bitner-Glindzicz Splice Mutations in KVLQT1? Circulation, May 11, 1999; 99 (18): 2476 - 2479. [Full Text] [PDF] |
||||
![]() |
D. M. Roden and S. Kupershmidt From genes to channels: normal mechanisms Cardiovasc Res, May 1, 1999; 42(2): 318 - 326. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Berthet, I. Denjoy, C. Donger, L. Demay, H. Hammoude, D. Klug, E. Schulze-Bahr, P. Richard, H. Funke, K. Schwartz, et al. C-terminal HERG Mutations : The Role of Hypokalemia and a KCNQ1-Associated Mutation in Cardiac Event Occurrence Circulation, March 23, 1999; 99(11): 1464 - 1470. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Neyroud, P. Richard, N. Vignier, C. Donger, I. Denjoy, L. Demay, M. Shkolnikova, R. Pesce, P. Chevalier, B. Hainque, et al. Genomic Organization of the KCNQ1 K+ Channel Gene and Identification of C-Terminal Mutations in the Long-QT Syndrome Circ. Res., February 19, 1999; 84(3): 290 - 297. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1998 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |