Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 1998;98:2738-2743

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mamontova, A.
Right arrow Articles by Tedgui, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mamontova, A.
Right arrow Articles by Tedgui, A.

(Circulation. 1998;98:2738-2743.)
© 1998 American Heart Association, Inc.


Basic Science Reports

Severe Atherosclerosis and Hypoalphalipoproteinemia in the Staggerer Mouse, a Mutant of the Nuclear Receptor ROR{alpha}

Anna Mamontova, PhD; Sandrine Séguret-Macé, PhD; Bruno Esposito, BSc; Colette Chaniale, BSc; Muriel Bouly, BSc; Nicole Delhaye-Bouchaud, PhD; Gérald Luc, MD; Bart Staels, PhD; Nicolas Duverger, PhD; Jean Mariani, MD, PhD; Alain Tedgui, PhD

From INSERM U141 and IFR "Circulation Lariboisière," Paris (A.M., B.E., A.T.); Rhône-Poulenc Rorer, Gencell Division, Atherosclerosis Department, Centre de recherches de Vitry-Alfortville, Vitry sur Seine (S.S.-M., N.D.); Institut Gustave Roussy, Villejuif (C.C.); INSERM U325, Département d'Athérosclérose, Institut Pasteur, Lille (M.B., G.L., B.S.); and Laboratoire de Neurobiologie du Développement, Institut des Neurosciences, CNRS URA1488 and Université P. et M. Curie, Paris (N.D.-B., J.M.), France.

Correspondence to Alain Tedgui, INSERM U141, 41 Blvd de la Chapelle, 75475 Paris Cedex 10, France.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background—Hypoalphalipoproteinemia is the most common lipoprotein abnormality in patients with coronary artery disease, yet its causes are unknown.

Methods and Results—We show that the homozygous staggerer (sg/sg) mutant mouse, which carries a deletion within the nuclear receptor ROR{alpha} gene, develops severe atherosclerosis when maintained on an atherogenic diet. In addition, sg/sg mice display a profound hypoalphalipoproteinemia, which is associated with decreased plasma levels of the major HDL proteins, apolipoprotein (apo) A-I and apoA-II. This decrease in HDL levels in sg/sg mice is due to lowered apoA-I gene expression in the intestine but not in the liver. ApoA-II gene expression is unaffected.

Conclusions—These results suggest that the ROR{alpha} gene contributes to the plasma HDL level and susceptibility to atherosclerosis.


Key Words: hypercholesterolemia • genes • cholesterol • apolipoproteins


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
More than half of patients with angiographically confirmed coronary artery disease (CAD) before 60 years of age have a familial lipoprotein disorder.1 2 Reduced HDL cholesterol and apoA-I, the most abundant protein of HDL, have been found to be major independent risk factors for CAD.3 4 5 Hypoalphalipoproteinemia is the most common lipoprotein abnormality (39% confirmed CAD with lipid disorders),6 and it is frequently familial,7 but the major genetic factors are ill-defined.

The homozygous staggerer (sg/sg) mutant mouse shows cerebellar ataxia and neurodegeneration8 9 10 and exhibits immune abnormalities,11 including hyperproduction of inflammatory cytokines compared with wild-type C57BL/6 +/+ mice.12 Sg/sg mice carry a deletion in the gene of ROR{alpha} (also called RZR{alpha}),13 a member of the nuclear receptor superfamily related to the retinoic acid receptor (retinoic acid receptor–related orphan receptor).14 15 16 ROR{alpha} belongs to the subclass of orphan nuclear receptors that bind as monomers to response elements consisting of a 6-bp AT-rich sequence preceding the half-core PuGGTCA motif.17 The deletion in the ROR{alpha} gene observed in sg/sg mice prevents the translation of the putative ligand-binding domain, thereby presumably disrupting the normal function of this transcription factor.13 Because nuclear hormone receptors affect the transcription of apolipoproteins, enzymes, and receptors implicated in lipid metabolism,18 19 we investigated whether deletion of ROR{alpha} in sg/sg mice predisposes to atherosclerosis. This investigation is facilitated because the staggerer mutation is maintained on a C57BL/6 genetic background, which allows analysis of development of atherosclerotic lesions after exposure to an atherogenic diet.20 We determined the plasma lipoprotein and apolipoprotein profiles in sg/sg mice and measured the extent of fatty streaks in the aorta and the incidence of atherosclerosis in coronary arteries in sg/sg mice maintained on a high-fat atherogenic diet and compared them with those in C57BL/6 +/+ mice. Our results show that sg/sg mice develop enhanced atherosclerosis, which is associated with a marked hypoalphalipoproteinemia due to a decreased expression of apoA-I, the major HDL protein, in the intestine.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Mice
C57BL/6 male and female mice (6 to 8 weeks old) were obtained from Centre d'Elevage R. Janvier (CERJ, Le Genest-St-Isle, France). Staggerer (sg/sg) mutant mice were obtained by crossing known heterozygotes (+/sg) and identifying homozygous offspring by their clinical ataxia. Our colony at the Institut Gustave Roussy was established in 1988 by crossing a +/sg male with a +/+ C57BL/6J female obtained from CERJ. The sg mutation was since bred on a C57BL/6J background. The standard diet A04 contained 3% fat. The atherogenic diet was obtained by addition of 15% cacao butter, 1.25% cholesterol, and 0.5% sodium cholate to the standard A04 diet. All diets were purchased from Usine d'Alimentation Rationelle (UAR, Epinay-sur-Orge, France). Because of their severe ataxia, sg/sg mice were unable to feed conventionally; they were therefore given mashed and moistened food in the cage, and +/+ mice were fed in a similar manner. Mice were housed 2 to 5 per cage and maintained at 25°C in a temperature-controlled room with a 12-hour light-dark cycle. Water and food were given ad libitum. All mice remained healthy for the duration of the study. To characterize circulating immune cells in sg/sg mice, we determined white blood cell, lymphocyte, and neutrophil counts and found no significant differences between sg/sg and C57BL/6 mice.

Morphometric Analysis
After 9 weeks on the atherogenic diet, the mice were killed by ether overdose, and the basal half of the ventricles and the ascending aorta were removed, embedded in OCT compound (Tissue Tek), frozen in isopentane at -80°C, and stored at -70°C. Serial 10-µm sections of the aortic sinus with valves (50 to 70 per mouse) were cut on a cryostat. Ten successive sections were collected on the same slide. Sections were stained with Sudan IV, counterstained with hematoxylin, and examined by light microscopy. A photomicrograph of the section with the largest plaque was taken from each slide containing 10 sections, which yielded 5 to 7 photomicrographs per mouse. All lesions were taken into consideration regardless of their location. Lesion area was calculated by use of computer planimetry after slide scanning on a Nikon scanner. The mean lesion area per section per animal was then calculated. Our method of aortic lesion quantification offers the advantage of allowing quick examination of all sections cut from the aortic sinus. This permitted us to discard the sections that could be unsuitable for analysis for any technical reasons, including uneven sectioning or poor staining. On the other hand, we have estimated that the lesion areas of the 10 serial sections kept on the same slide usually did not differ by >10%. Furthermore, our sampling method for calculation of the mean lesion area per section per animal gives results similar to those obtained by other methods.

The incidence of atherosclerotic plaques in coronary arteries was assessed after examination of the sections collected from the lower portion of the heart. The main coronary arteries and major branches, which were usually around the root of the aorta (near the ostium), were considered to be large arteries and their intramyocardial ramifications small arteries. Each mouse showing lipid accumulation in >=1 large or small coronary artery was noted as positive for atherosclerosis.

Protein and Lipoprotein Analysis
Cholesterol was measured with a commercially available kit (Boehringer-Mannheim). Cholesterol in plasma lipoproteins was assayed after analytical gel filtration chromatography, with a Superose 6 HR 10/30 column (Pharmacia). Plasma levels of apoA-I and apoA-II were determined by immunonephelometric assay.

RNA Analysis
Total RNA was isolated from homogenized liver and intestine by the acid guanidinium thiocyanate–phenol-chloroform method21 and was further purified by an additional precipitation with 1 vol 8 mol/L LiCl. ApoA-I, apoA-II, and GAPDH mRNA contents were quantified by dot-blot hybridization using 8 serial dilutions (2-fold) of RNA starting from an amount of 8 µg/dot. For RNA hybridization, a mouse apoA-I cDNA probe was used.22 A mouse apoA-II cDNA fragment was cloned from mouse liver mRNA by reverse transcription–polymerase chain reaction amplification (sense primer, CTGCAGCACAGAATCGCAGCACTGTTCCTA; antisense primer, GAAGTTTAACTCCTTCCGCATTTATTGGAG). GAPDH cDNA was used as a control probe. All probes were labeled by random priming (Rediprime kit, Amersham). Northern blot analysis was performed to ensure that a single hybridizing mRNA species was detected. mRNA levels were measured after dot-blot hybridization. Filters were hybridized to 106 cpm/mL of each probe, then washed in 0.5xSSC and 0.1% SDS for 10 minutes at room temperature and twice for 30 minutes at 65°C. Filters were analyzed by quantitative electronic densitometry (InstantImager, Packard). All dot-blot experiments were performed twice.

In Vivo Measurement of ApoA-I Fractional Catabolic and Production Rates
Murine (C57BL/6) apoA-I was obtained by fast protein liquid chromatographic separation of total HDL protein isolated by ultracentrifugation. The purity of apoA-I was >95% by SDS-PAGE. ApoA-I was labeled with [125I]iodine by the iodine monochloride method of McFarlane as modified by Bilheimer et al.23 The specific activity of 125I-labeled apoA-I was 100 cpm/ng. Twenty micrograms of mouse labeled apoA-I was injected into mice via the tail vein. The injected apoA-I mass was <5% of the mouse total apoA-I pool. Whole blood (50 µL) was obtained 3, 10, and 90 minutes and 7 and 24 hours after the injection by retro-orbital bleeding under slight ether anesthesia for radioactivity measurements. The fractional catabolic rates (FCRs) were calculated from the area under the plasma decay curves of radioactivity by a 2-exponential computer curve-fitting technique using simulation, analysis, and modeling software (SAAM II, SAAM Institute, Inc). The production rates (PRs) were calculated as apoA-I concentrationxFCRx3.3%, the apoA-I plasma concentration being measured as described above and 3.3% being the plasma volume. Experiments were carried out in 4 +/+ and 4 sg/sg mice.

Statistical Analysis
Atherosclerotic lesion areas were not normally distributed and were logarithmically transformed before statistical analysis. The genotype and sex effects on lesion area and the lipoprotein and apolipoprotein data were determined by 2-way ANOVA. Analysis of atherosclerosis incidence in coronary arteries was done with the {chi}2 test. An unpaired t test was used to compare FCR and PR values in sg/sg and +/+ mice. Data are expressed as mean±SEM. A value of P<0.05 was accepted as statistically significant.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Staggerer mice were smaller than +/+ mice before starting the atherogenic diet, males weighing 15.8±0.9 and 22.6±1.1 g, respectively, and females weighing 12.2±0.8 and 17.6±1.1 g, respectively. However, animals in the 2 groups had comparable relative weight gains throughout the study. Sg/sg and +/+ males weighed 19.9±0.8 and 29.4±0.6 g, respectively, after 9 weeks on the atherogenic diet, and females weighed 17.0±1.1 and 24.7±0.4 g, respectively.

Lipoproteins and Apolipoproteins
For animals maintained on the chow diet, plasma total and HDL cholesterol levels were significantly lower in sg/sg than in +/+ mice (Table 1Down and Figure 1Down). In fact, the HDL cholesterol levels were unusually low in male and female sg/sg mice (2.2- and 4.9-fold reduction, respectively) versus +/+ mice, which had levels comparable to those of most inbred strains of mice.24 Plasma apoA-I and apoA-II concentrations were {approx}2-fold lower in mutant than in control mice fed a normal diet (Table 1Down). After 9 weeks on an atherogenic diet, total plasma cholesterol levels were markedly increased in both sg/sg and +/+ mice (Table 1Down). However, total cholesterol levels were significantly lower in sg/sg than in +/+ mice regardless of the sex (Table 1Down). This was because of lower HDL cholesterol levels in sg/sg than in +/+ mice. VLDL and LDL cholesterol levels showed no sex- or genotype-dependent differences. Interestingly, the levels of HDL cholesterol were substantially lower in females than in males regardless of the genotype, as previously reported in the C57BL/6 strain.25


View this table:
[in this window]
[in a new window]
 
Table 1. Plasma Cholesterol and ApoA-I and ApoA-II Levels in C57BL/6 and sg/sg Mice Fed Normal or Atherogenic Diet



View larger version (22K):
[in this window]
[in a new window]
 
Figure 1. Representative cholesterol distribution of gel filtration chromatography plasma in +/+ and sg/sg mice fed a chow diet. Plasma samples were obtained in fasted state. Size fractions were labeled according to their equivalent density fraction.

Atherosclerotic Lesions in sg/sg Mice
Mice on a normal diet had no detectable atherosclerotic lesions. After 9 weeks on the atherogenic diet, lipid accumulation was found in the aortic sinus in both +/+ and sg/sg mice (Figure 2Down). However, even after such a short period on the atherogenic diet, sg/sg mice developed exaggerated atherosclerotic lesions in the aorta compared with +/+ mice (Figure 3Down). The lesion areas were 6-fold higher in female (37 755±11 176 µm2 versus 6944±1634 µm2) and 7.5-fold higher in male (21 431±9652 µm2 versus 2850±603 µm2) sg/sg than in +/+ mice. As previously reported in the C57BL/6 strain,26 females were more susceptible than males. We looked for correlations between the lesion size and total, VLDL, LDL, or HDL cholesterol concentrations. When males and females, or +/+ and sg/sg mice, were combined, there was no significant relationship between total, VLDL, or LDL cholesterol and aortic lesion size. In contrast, there was a highly significant inverse correlation between HDL cholesterol and lesion area (r=-0.71, P<0.0001, n=43, Figure 4Down). Analysis of the correlation between HDL cholesterol and aortic lesion area within each group did not reach statistical significance because of the small number of points in each of the groups. However, the correlations were statistically significant when we analyzed sg/sg and +/+ mice separately (P<0.01 and P<0.05, respectively), pooling males and females, or when we analyzed males and females separately, pooling sg/sg and +/+ mice (P<0.001 in both cases).



View larger version (105K):
[in this window]
[in a new window]
 
Figure 2. Fatty streak lesions are markedly increased in aortic sinus and coronary arteries of sg/sg mice after high-fat, high-cholesterol diet. Representative cross sections stained with Sudan IV and hematoxylin from a mutant female sg/sg mouse showing significant atherosclerosis with marked lipid accumulation (top) compared with a control female +/+ mouse (bottom). Two branches of coronary artery of sg/sg mouse are partially occluded by atherosclerotic material (arrows). Fatty streak lesions (arrowheads) and valves (V) in aortic sinus. Original magnification x40.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 3. Mean area of atherosclerotic lesions (±SEM) per section per animal for +/+ and sg/sg male and female mice fed atherogenic diet for 9 weeks. n represents number of animals; P<0.0001 for genotype effect; P=0.004 for sex effect. Genotype-sex interaction, P=NS.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 4. HDL cholesterol and logarithmically transformed aortic lesion area for male and female sg/sg and +/+ mice fed atherogenic diet for 9 weeks are highly correlated (r=-0.71, P<0.0001, n=43).

Control +/+ mice maintained on the atherogenic diet for 9 weeks exhibited few or no atherosclerotic lesions in the coronary arteries. In contrast, the incidence of atherosclerotic lesions in large and small coronary arteries was high in sg/sg mice (Figure 2Up, Table 2Down).


View this table:
[in this window]
[in a new window]
 
Table 2. Incidence of Atherosclerotic Lesions in Large and Small CAs in C57BL/6 and sg/sg Mice Fed the High-Fat, High-Cholesterol Diet for 9 Weeks

ApoA-I and ApoA-II mRNA Expression in the Liver and the Intestine
Because ROR{alpha} is a transcription factor with positive transactivation activity, the lowered HDL concentrations in the mutant mice might be due to a defective expression of the apoA-I or apoA-II genes. Therefore, apoA-I and apoA-II gene expression was determined in the liver and the intestine, the major apolipoprotein-producing organs (Figure 5Down). Whereas liver apoA-I mRNA levels were comparable between sg/sg and +/+ mice, a pronounced decrease in apoA-I mRNA levels was observed in the intestine of mutant mice. Liver apoA-II mRNA levels remained unchanged, whereas the apoA-II gene is not expressed in the intestine. These data suggest that decreased expression of the apoA-I gene in the intestine may be the basis of the hypoalphalipoproteinemia observed in sg/sg mice. However, it does not indicate whether the apoA-I gene is a direct target for ROR{alpha} or whether the observed changes are secondary to other (metabolic) effects of ROR{alpha} in these mice.



View larger version (56K):
[in this window]
[in a new window]
 
Figure 5. Intestinal but not liver apoA-I mRNA levels are decreased in homozygous sg/sg mice. Total RNA was isolated from liver and intestine of female homozygous sg/sg mice and control C57BL/6 mice (n=3/group), and apoA-I, apoA-II, and GAPDH mRNAs were analyzed by Northern blot (A). mRNA levels in liver (B) and in intestine (C) were measured after dot-blot hybridization. Values are expressed in relative arbitrary units, taking amount of mRNA measured in control C57BL/6 mice as 100.

ApoA-I Turnover Rates
To further investigate the mechanism behind lowered HDL levels in sg/sg mice, we determined apoA-I turnover rates in vivo. FCRs were not significantly different in sg/sg and +/+ mice (0.123±0.008 pool/h versus 0.133±0.011 pool/h), but PRs were found to be significantly lower in sg/sg than in +/+ mice (68.8±2.0 versus 93.5±4.1 mg · kg-1 · d-1, P<0.005), indicating that low plasma apoA-I concentrations in sg/sg mice were not due to higher catabolic rates.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
Compared with C57BL/6 +/+ mice, sg/sg mice are prone to develop enhanced atherosclerosis, which parallels decreased plasma concentrations of HDL cholesterol, apoA-I, and apoA-II. The role of plasma HDL level in atherogenesis has already been evaluated in transgenic animal models. Overexpression of human apoA-I in mice, leading to a 2-fold increase of plasma HDL level, offers protection against atherosclerosis in mice27 28 29 and rabbits.30 In contrast, apoA-I knockout mice having 4-fold decreased levels of plasma HDL did not show enhanced susceptibility to atherosclerosis when fed an atherogenic diet.31 This puzzling finding may be because the mice used in the latter study were of a mixed genetic background, B6 and 129, the latter being resistant to atherogenic diet.20 Our results obtained in the homozygous staggerer mutant, whose genetic background is identical to that of the wild-type C57BL/6 mice, demonstrate that a decrease of HDL cholesterol enhances susceptibility to atherosclerosis. Few genetic defects or gene variants affecting HDL cholesterol levels have been discovered in humans. Subjects with deletions of the apoA-I gene or mutations that prevent apoA-I synthesis have undetectable plasma apoA-I and low HDL cholesterol concentrations (reviewed in Reference 3232 ). In those patients who develop premature coronary heart disease, plasma apoA-II levels are also reduced,32 indicating that apoA-I is required for normal apoA-II metabolism, in agreement with our results.

Our results reveal a specific reduction of apoA-I gene expression in the intestine of sg/sg mice and decreased plasma apoA-I levels. The study of apoA-I turnover rates in vivo showed that decreased plasma apoA-I concentrations in sg/sg mice were due not to elevated catabolic rates in these animals but rather to reduced production rates, more likely related to their decreased mRNA expression in the intestine. We therefore believe that the decreased basal apoA-I expression in sg/sg mice is associated with the absence of ROR{alpha} expression, contributing to the decreased plasma apoA-I levels and ensuing hypoalphalipoproteinemia in these mutant mice. To further support this conclusion, we have shown that ROR{alpha} is expressed in the intestine of +/+ mice, and we have identified an ROR{alpha}-responsive element in the apoA-I gene promoter, which suggests a direct regulation of apoA-I gene expression by ROR{alpha}.33 Unexpectedly, deficiency of ROR{alpha} expression affects intestinal but not liver apoA-I expression. The absence of a single transcription factor results in a >50% decrease in apoA-I expression in the intestine. To the best of our knowledge, this is the first demonstration of a nuclear receptor regulating intestinal apoA-I gene expression in vivo. Indeed, previous in vitro studies have shown that apoA-I gene expression in the liver but not the intestine is under the control of various activators/ligands of nuclear receptors, such as glucocorticoid and thyroid hormones, estrogens, retinoids, and the hypolipidemic fibrate drugs, which are potent PPAR{alpha} activators.34 35 36 However, ROR{alpha} expression does not appear to be required for normal apoA-I expression in the liver under physiological conditions.

We have previously reported that the inflammatory response is enhanced in sg/sg mice,12 and it has also been shown that an atherogenic diet increases the expression of inflammatory and oxidative stress mediators, such as macrophage colony–stimulating factor, in the circulation, and JE (mouse equivalent of monocyte chemotactic protein-1), serum amyloid A, and heme oxygenase genes in the liver.37 Furthermore, there is a striking correlation between inflammatory gene induction and susceptibility to fatty streak development in several inbred mouse strains.38 Interestingly, ROR{alpha} might play a major role in chronic inflammation.39 A ROR{alpha}-responsive element has been identified in the promoter of the 5-lipoxygenase gene, which may mediate the negative regulation of this important inflammatory gene.40 41 42 In this context, it cannot be ruled out that the enhanced atherosclerotic susceptibility of sg/sg mice is related both to low HDL plasma levels and to exaggerated inflammatory response to the high-fat, high-cholesterol diet. Therefore, our data indicate that HDL could overcome the effects of other atherogenic factors, including inflammation, and provide further evidence for the protective activity of apoA-I against atherosclerosis of different pathogenesis.

In conclusion, we have shown that disruption of the ROR{alpha} gene in mutant sg/sg mice leads to lowered expression of the apoA-I gene only in the intestine. This is the first demonstration of a nuclear receptor that contributes to apoA-I gene expression in vivo and whose deficiency results in hypoalphalipoproteinemia and a higher susceptibility for atherosclerosis. These results indicate that targeting intestinal apoA-I expression, possibly via ROR{alpha}, might be of potential interest in the treatment of atherosclerosis.


*    Acknowledgments
 
This work was supported by grants from Fondation de France and Fondation pour la Recherche Médicale. Dr Mamontova is the recipient of a fellowship from the Fondation pour la Recherche Médicale.

Received March 19, 1998; revision received August 5, 1998; accepted August 12, 1998.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Genest JJ Jr, Martin-Munley SS, McMamara JR, Ordovas JM, Jenner J, Myers RH, Silberman SR, Wilson PW, Salem DN, Schaefer EJ. Familial lipoprotein disorders in patients with premature coronary artery disease. Circulation. 1992;85:2025–2033.[Abstract/Free Full Text]

2. Dammerman M, Breslow JL. Genetic basis of lipoprotein disorders. Circulation. 1995;91:505–512.[Free Full Text]

3. Gordon T, Castelli WP, Hjortland MC, Kannel WB. High density lipoprotein as a protective factor against coronary heart disease: the Framingham Study. Am J Med. 1977;62:707–714.[Medline] [Order article via Infotrieve]

4. Gordon DJ, Probstfield JL, Garrison RJ, Neaton JD, Castelli WP, Knoke JD, Jacobs DR Jr, Bangdiwala S, Tyroler A. High-density lipoprotein cholesterol and cardiovascular disease: four prospective American studies. Circulation. 1989;79:8–15.[Abstract/Free Full Text]

5. Reichl D, Miller NE. Pathophysiology of reverse cholesterol transport: insights from inherited disorders of lipoprotein metabolism. Arteriosclerosis. 1989;9:785–797.[Free Full Text]

6. Breslow JL. Familial disorders of high density lipoprotein metabolism. In: Scriver CR, Beaudet AL, Spy WS, Valle D, ed. The Metabolic Basis of Inherited Disease. 6th ed. New York, NY: McGraw-Hill; 1989;1:1251–1266.

7. Schaefer EJ, McNamara JR, Genest J Jr, Ordovas JM. Genetics and abnormalities in metabolism of lipoproteins. In: Miller NE, ed. High Density Lipoproteins and Atherosclerosis. New York, NY: Elsevier Science Publishing Co Inc; 1989;79–86.

8. Sidman RL, Lane PV, Dickie MM. Staggerer, a new mutation in the mouse affecting the cerebellum. Science. 1962;136:610–612.

9. Herrup K, Mullen RJ. Regional variation and absence of large neurons in the cerebellum of the staggerer mouse. Brain Res. 1979;172:1–12.[Medline] [Order article via Infotrieve]

10. Shojaeian-Zanjani H, Herrup K, Guastavino JM, Delhaye-Bouchaud N, Mariani J. Developmental studies of the inferior olivary nucleus in staggerer mutant mice. Dev Brain Res. 1994;82:18–28.[Medline] [Order article via Infotrieve]

11. Trenkner E, Hoffmann MK. Defective development of the thymus and immunological abnormalities in the neurological mouse mutation staggerer. J Neurosci. 1986;6:1733–1737.[Abstract]

12. Kopmels B, Mariani J, Delhaye-Bouchaud N, Audibert F, Fradelizi D, Wollman EE. Evidence for a hyperexcitability state of staggerer mutant mice macrophages. J Neurochem. 1992;58:192–199.[Medline] [Order article via Infotrieve]

13. Hamilton BA, Frankel WN, Kerrebrock AW, Hawkins TL, FitzHugh W, Kusumi K, Russell LB, Mueller KL, van Berkel V, Birren BW, Kruglyak L, Lander ES. Disruption of the nuclear hormone receptor ROR{alpha} in staggerer mice. Nature. 1996;379:736–739.[Medline] [Order article via Infotrieve]

14. Giguère V, Tini M, Flock G, Ong E, Evans RM, Otulakowski G. Isoform-specific amino-terminal domains dictate DNA-binding properties of ROR{alpha}, a novel family of orphan hormone nuclear receptors. Genes Dev. 1994;8:538–553.[Abstract/Free Full Text]

15. Becker-André M, André E, DeLamarter JF. Identification of nuclear receptor mRNAs by RT-PCR amplification of conserved zinc-finger motif sequences. Biochem Biophys Res Commun. 1993;194:1371–1379.[Medline] [Order article via Infotrieve]

16. Carlberg C, van Huijsduijnen R, Staple JK, DeLamarter JF, Becker-André M. RZRs, a new family of retinoid-related orphan receptors that function as both monomers and homodimers. Mol Endocrinol. 1994;8:757–770.[Abstract/Free Full Text]

17. Mangelsdorf DJ, Evans RM. The RXR heterodimers and orphan receptors. Cell. 1995;83:841–850.[Medline] [Order article via Infotrieve]

18. Schoonjans K, Staels B, Auwerx J. Role of the peroxisome proliferator-activated receptor (PPAR) in mediating the effects of fibrates and fatty acids on gene expression. J Lipid Res. 1996;37:907–925.[Abstract]

19. Tzameli I, Zannis VI. Binding specificity and modulation of the apoA-I promoter activity by homo- and heterodimers of nuclear receptors. J Biol Chem. 1996;271:8402–8415.[Abstract/Free Full Text]

20. Paigen B, Ishida BY, Verstuyft J, Winters RB, Albee D. Atherosclerosis susceptibility differences among progenitors of recombinant inbred strains of mice. Arteriosclerosis. 1990;10:316–323.[Abstract/Free Full Text]

21. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156–159.[Medline] [Order article via Infotrieve]

22. Berthou L, Duverger N, Emmanuel F, Langouet S, Auwerx J, Guillouzo A, Fruchart JC, Rubin E, Denefle P, Staels B, Branellec D. Opposite regulation of human versus mouse apolipoprotein A-I by fibrates in human apolipoprotein A-I transgenic mice. J Clin Invest. 1996;97:2408–2416.[Medline] [Order article via Infotrieve]

23. Bilheimer DW, Eisenberg S, Levy RI. The metabolism of very low density lipoprotein proteins, I: preliminary in vitro and in vivo observations. Biochim Biophys Acta. 1972;260:212–221.[Medline] [Order article via Infotrieve]

24. Nishina PM, Wang J, Toyofuku W, Kuypers FA, Ishida BY. Atherosclerosis and plasma and liver lipids in nine inbred strains of mice. Lipids. 1993;28:599–605.[Medline] [Order article via Infotrieve]

25. Paigen B, Holmes PA, Mitchell D, Albee D. Comparison of atherosclerosis lesions and HDL-lipid levels in male, female, and testosterone-treated female mice from C57BL/6, BALB/c, and CH3. Atherosclerosis. 1987;64:215–221.[Medline] [Order article via Infotrieve]

26. Paigen B, Mitchel D, Reue K, Morrow A, Lusis AJ, LeBoeuf RC. Ath-1, a gene determining atherosclerosis susceptibility and high density lipoprotein level in mice. Proc Natl Acad Sci U S A. 1987;84:3763–3767.[Abstract/Free Full Text]

27. Rubin EM, Krauss RM, Spangler EA, Verstuyft JG, Clift SM. Inhibition of early atherogenesis in transgenic mice by human apolipoprotein AI. Nature. 1991;353:265–267.[Medline] [Order article via Infotrieve]

28. Paszty C, Maeda N, Verstuyft J, Rubin EM. Apolipoprotein Al transgene corrects apolipoprotein E deficiency-induced atherosclerosis in mice. J Clin Invest. 1994;94:899–903.

29. Plump AS, Scott CJ, Breslow JL. Human apolipoprotein A-I gene expression increases high density lipoprotein and suppresses atherosclerosis in the apolipoprotein E-deficient mouse. Proc Natl Acad Sci U S A. 1994;91:9607–9611.[Abstract/Free Full Text]

30. Duverger ND, Kruth H, Emmanuel F, Caillaud JM, Viglietta C, Castro G, Tailleux A, Fievet C, Fruchart JM, Houdebine LM, Denefle P. Inhibition of atherosclerosis development in cholesterol-fed human apolipoprotein A-I transgenic rabbits. Circulation. 1996;94:713–719.[Abstract/Free Full Text]

31. Li H, Reddick RL, Maeda N. Lack of apoA-I is not associated with increased susceptibility to atherosclerosis in mice. Arterioscler Thromb. 1993;13:1814–1821.[Abstract/Free Full Text]

32. Takata K, Saku K, Ohta T, Takata M, Bai H, Jimi S, Liu R, Sato H, Kajiyama G, Arakawa K. A new case of apoA-I deficiency showing codon 8 nonsense mutation of the apoA-I gene without evidence of coronary heart disease. Arterioscler Thromb Vasc Biol. 1995;15:1866–1874.[Abstract/Free Full Text]

33. Vu-Dac N, Gervois P, Grötzinger T, De Vos P, Schoonjans K, Fruchart J-C, Auwerx J, Mariani J, Tedgui A, Staels B. Transcriptional regulation of apolipoprotein A-I gene expression by the nuclear receptor ROR{alpha}. J Biol Chem. 1997;272:22401–22404.[Abstract/Free Full Text]

34. Staels B, Auwerx J, Chan L, van Tol A, Rosseneu M, Verhoeven G. Influence of development, estrogens and food intake on apolipoprotein A-I, A-II and E mRNA in the rat liver and intestine. J Lipid Res. 1989;30:1137–1145.[Abstract]

35. Staels B, Van Tol A, Andreu T, Auwerx J. Fibrates influence the expression of genes involved in lipoprotein metabolism in a tissue-selective manner in the rat. Arterioscler Thromb. 1992;12:286–294.[Abstract/Free Full Text]

36. Berthou L, Staels B, Saldicco I, Berthelot I, Casey J, Fruchart J-C, Denèfle P, Branellec D. Opposite in vitro and in vivo regulation of hepatic apolipoprotein A-I gene expression by retinoic acid: absence of effects on apolipoprotein A-II gene expression. Arterioscler Thromb. 1994;14:1657–1664.[Abstract/Free Full Text]

37. Liao F, Andalibi A, deBeer FC, Fogelman AM, Lusis AJ. Genetic control of inflammatory gene induction and NF-{kappa}B-like transcription factor activation in response to atherogenic diet in mice. J Clin Invest. 1993;91:2572–2579.

38. Liao F, Andalibi A, Qiao JH, Allayee H, Fogelman AM, Lusis AJ. Genetic evidence for a common pathway mediating oxidative stress, inflammatory gene induction, and aortic fatty streak formation in mice. J Clin Invest. 1994;94:877–884.

39. Missbach M, Jagher B, Sigg I, Nayeri S, Carlberg C, Wiesenberg I. Thiazolidine diones, specific ligands of the nuclear receptor retinoid Z receptor/retinoid acid receptor-related orphan receptor {alpha} with potent antiarthritic activity. J Biol Chem. 1996;271:13515–13522.[Abstract/Free Full Text]

40. Becker-André M, Wiesenberg I, Schaeren-Wiemers N, André E, Missbach M, Saurat J-H, Carlberg C. Pineal gland hormone melatonin binds and activates an orphan of the nuclear receptor superfamily. J Biol Chem. 1994;269:28531–28534.[Abstract/Free Full Text]

41. Wiesenberg I, Missbach M, Kahlen J-P, Schräder M, Carlberg C. Transcriptional activation of the nuclear receptor RZR{alpha} by the pineal gland hormone melatonin and identification of CGP 52608 as a synthetic ligand. Nucleic Acids Res. 1995;23:327–333.[Abstract/Free Full Text]

42. Steinhilber D, Brungs M, Werz O, Wiesenberg I, Danielsson C, Kahlen J-P, Nayeri S, Schräder M, Carlberg C. The nuclear receptor for melatonin represses 5-lipoxygenase gene expression in human B lymphocytes. J Biol Chem. 1995;270:7037–7040.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
J. Lipid Res.Home page
T. Juan, M. M. Veniant, J. Helmering, P. Babij, D. M. Baker, M. A. Damore, M. B. Bass, T. Gyuris, M. Chhoa, C.-M. Li, et al.
Identification of three loci affecting HDL-cholesterol levels in a screen for chemically induced recessive mutations in mice
J. Lipid Res., March 1, 2009; 50(3): 534 - 545.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
E.-J. Kim, Y.-G. Yoo, W.-K. Yang, Y.-S. Lim, T.-Y. Na, I.-K. Lee, and M.-O. Lee
Transcriptional Activation of HIF-1 by ROR{alpha} and its Role in Hypoxia Signaling
Arterioscler Thromb Vasc Biol, October 1, 2008; 28(10): 1796 - 1802.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Lau, R. L. Fitzsimmons, S. Raichur, S.-C. M. Wang, A. Lechtken, and G. E. O. Muscat
The Orphan Nuclear Receptor, ROR{alpha}, Regulates Gene Expression That Controls Lipid Metabolism: STAGGERER (SG/SG) MICE ARE RESISTANT TO DIET-INDUCED OBESITY
J. Biol. Chem., June 27, 2008; 283(26): 18411 - 18421.
[Abstract] [Full Text] [PDF]


Home page
Diabetes and Vascular Disease ResearchHome page
H. Duez and B. Staels
The nuclear receptors Rev-erbs and RORs integrate circadian rhythms and metabolism
Diabetes and Vascular Disease Research, June 1, 2008; 5(2): 82 - 88.
[Abstract] [PDF]


Home page
Mol. Pharmacol.Home page
T. Wada, H. S. Kang, M. Angers, H. Gong, S. Bhatia, S. Khadem, S. Ren, E. Ellis, S. C. Strom, A. M. Jetten, et al.
Identification of Oxysterol 7{alpha}-Hydroxylase (Cyp7b1) as a Novel Retinoid-Related Orphan Receptor {alpha} (ROR{alpha}) (NR1F1) Target Gene and a Functional Cross-Talk between ROR{alpha} and Liver X Receptor (NR1H3)
Mol. Pharmacol., March 1, 2008; 73(3): 891 - 899.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
S. Raichur, P. Lau, B. Staels, and G. E O Muscat
Retinoid-related orphan receptor {gamma} regulates several genes that control metabolism in skeletal muscle cells: links to modulation of reactive oxygen species production
J. Mol. Endocrinol., July 1, 2007; 39(1): 29 - 44.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
R. S. Kiss, N. Kavaslar, K.-i. Okuhira, M. W. Freeman, S. Walter, R. W. Milne, R. McPherson, and Y. L. Marcel
Genetic Etiology of Isolated Low HDL Syndrome: Incidence and Heterogeneity of Efflux Defects
Arterioscler Thromb Vasc Biol, May 1, 2007; 27(5): 1139 - 1145.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Wang, L. Yin, and M. A. Lazar
The Orphan Nuclear Receptor Rev-erb{alpha} Regulates Circadian Expression of Plasminogen Activator Inhibitor Type 1
J. Biol. Chem., November 10, 2006; 281(45): 33842 - 33848.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
A. G. Smith and G. E. O. Muscat
Orphan nuclear receptors: therapeutic opportunities in skeletal muscle
Am J Physiol Cell Physiol, August 1, 2006; 291(2): C203 - C217.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C. Chauvet, B. Bois-Joyeux, C. Fontaine, P. Gervois, M.-A. Bernard, B. Staels, and J.-L. Danan
The Gene Encoding Fibrinogen-{beta} Is a Target for Retinoic Acid Receptor-Related Orphan Receptor {alpha}
Mol. Endocrinol., October 1, 2005; 19(10): 2517 - 2526.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
C. M. Stapleton, M. Jaradat, D. Dixon, H. S. Kang, S.-C. Kim, G. Liao, M. A. Carey, J. Cristiano, M. P. Moorman, and A. M. Jetten
Enhanced susceptibility of staggerer (ROR{alpha}sg/sg) mice to lipopolysaccharide-induced lung inflammation
Am J Physiol Lung Cell Mol Physiol, July 1, 2005; 289(1): L144 - L152.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A. Genoux, H. Dehondt, A. Helleboid-Chapman, C. Duhem, D. W. Hum, G. Martin, L. A. Pennacchio, B. Staels, J. Fruchart-Najib, and J.-C. Fruchart
Transcriptional Regulation of Apolipoprotein A5 Gene Expression by the Nuclear Receptor ROR{alpha}
Arterioscler Thromb Vasc Biol, June 1, 2005; 25(6): 1186 - 1192.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
H. Migita and J. Morser
15-Deoxy-{Delta}12,14-Prostaglandin J2 (15d-PGJ2) Signals Through Retinoic Acid Receptor-Related Orphan Receptor-{alpha} but Not Peroxisome Proliferator-Activated Receptor-{gamma} in Human Vascular Endothelial Cells: The Effect of 15d-PGJ2 on Tumor Necrosis Factor-{alpha}-Induced Gene Expression
Arterioscler Thromb Vasc Biol, April 1, 2005; 25(4): 710 - 716.
[Abstract] [Full Text] [PDF]


Home page
Sci Aging Knowl EnvironHome page
K. Pardee, J. Reinking, and H. Krause
Nuclear Hormone Receptors, Metabolism, and Aging: What Goes Around Comes Around
Sci. Aging Knowl. Environ., November 24, 2004; 2004(47): re8 - re8.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
D. S. Ory
Nuclear Receptor Signaling in the Control of Cholesterol Homeostasis: Have the Orphans Found a Home?
Circ. Res., October 1, 2004; 95(7): 660 - 670.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
I. Dzhagalov, V. Giguere, and Y.-W. He
Lymphocyte Development and Function in the Absence of Retinoic Acid-Related Orphan Receptor {alpha}
J. Immunol., September 1, 2004; 173(5): 2952 - 2959.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Lau, S. J. Nixon, R. G. Parton, and G. E. O. Muscat
ROR{alpha} Regulates the Expression of Genes Involved in Lipid Homeostasis in Skeletal Muscle Cells: CAVEOLIN-3 AND CPT-1 ARE DIRECT TARGETS OF ROR
J. Biol. Chem., August 27, 2004; 279(35): 36828 - 36840.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Miki, M. Ikuta, and T. Matsui
Hypoxia-induced Activation of the Retinoic Acid Receptor-related Orphan Receptor {alpha}4 Gene by an Interaction between Hypoxia-inducible Factor-1 and Sp1
J. Biol. Chem., April 9, 2004; 279(15): 15025 - 15031.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
F. Boukhtouche, J. Mariani, and A. Tedgui
The "CholesteROR" Protective Pathway in the Vascular System
Arterioscler Thromb Vasc Biol, April 1, 2004; 24(4): 637 - 643.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Raspe, G. Mautino, C. Duval, C. Fontaine, H. Duez, O. Barbier, D. Monte, J. Fruchart, J.-C. Fruchart, and B. Staels
Transcriptional Regulation of Human Rev-erbalpha Gene Expression by the Orphan Nuclear Receptor Retinoic Acid-related Orphan Receptor alpha
J. Biol. Chem., December 13, 2002; 277(51): 49275 - 49281.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
E. Raspe, H. Duez, A. Mansen, C. Fontaine, C. Fievet, J.-C. Fruchart, B. Vennstrom, and B. Staels
Identification of Rev-erb{alpha} as a physiological repressor of apoC-III gene transcription
J. Lipid Res., December 1, 2002; 43(12): 2172 - 2179.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Delerive, W. W. Chin, and C. S. Suen
Identification of Reverbalpha as a Novel RORalpha Target Gene
J. Biol. Chem., September 13, 2002; 277(38): 35013 - 35018.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
F. M. Faraci
Vascular Biology: Look What We Staggered Into
Circ. Res., April 19, 2002; 90(7): 749 - 750.
[Full Text] [PDF]


Home page
Circ. Res.Home page
S. Besnard, J. Bakouche, Y. Lemaigre-Dubreuil, J. Mariani, A. Tedgui, and D. Henrion
Smooth Muscle Dysfunction in Resistance Arteries of the Staggerer Mouse, a Mutant of the Nuclear Receptor ROR{alpha}
Circ. Res., April 19, 2002; 90(7): 820 - 825.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
E. Ueda, S. Kurebayashi, M. Sakaue, M. Backlund, B. Koller, and A. M. Jetten
High Incidence of T-Cell Lymphomas in Mice Deficient in the Retinoid-related Orphan Receptor ROR{gamma}
Cancer Res., February 1, 2002; 62(3): 901 - 909.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. Meyer, M. Kneissel, J. Mariani, and B. Fournier
In vitro and in vivo evidence for orphan nuclear receptor RORalpha function in bone metabolism
PNAS, July 12, 2000; (2000) 150246097.
[Abstract] [Full Text]


Home page
Hum Mol GenetHome page
C. Mitchell, A. Mignon, J. E. Guidotti, S. Besnard, M. Fabre, N. Duverger, D. Parlier, A. Tedgui, A. Kahn, and H. Gilgenkrantz
Therapeutic liver repopulation in a mouse model of hypercholesterolemia
Hum. Mol. Genet., July 1, 2000; 9(11): 1597 - 1602.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
Z. Mallat, S. Besnard, M. Duriez, V. Deleuze, F. Emmanuel, M. F. Bureau, F. Soubrier, B. Esposito, H. Duez, C. Fievet, et al.
Protective Role of Interleukin-10 in Atherosclerosis
Circ. Res., October 15, 1999; 85 (8): e17 - e24.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
V. Giguère
Orphan Nuclear Receptors: From Gene to Function
Endocr. Rev., October 1, 1999; 20(5): 689 - 725.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
E. Raspe, H. Duez, P. Gervois, C. Fievet, J.-C. Fruchart, S. Besnard, J. Mariani, A. Tedgui, and B. Staels
Transcriptional Regulation of Apolipoprotein C-III Gene Expression by the Orphan Nuclear Receptor RORalpha
J. Biol. Chem., January 19, 2001; 276(4): 2865 - 2871.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. Meyer, M. Kneissel, J. Mariani, and B. Fournier
In vitro and in vivo evidence for orphan nuclear receptor RORalpha function in bone metabolism
PNAS, August 1, 2000; 97(16): 9197 - 9202.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. Besnard, J.-S. Silvestre, M. Duriez, J. Bakouche, Y. Lemaigre-Dubreuil, J. Mariani, B. I. Levy, and A. Tedgui
Increased Ischemia-Induced Angiogenesis in the Staggerer Mouse, a Mutant of the Nuclear Receptor Ror{alpha}
Circ. Res., December 7, 2001; 89(12): 1209 - 1215.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. Besnard, J. Bakouche, Y. Lemaigre-Dubreuil, J. Mariani, A. Tedgui, and D. Henrion
Smooth Muscle Dysfunction in Resistance Arteries of the Staggerer Mouse, a Mutant of the Nuclear Receptor ROR{alpha}
Circ. Res., April 19, 2002; 90(7): 820 - 825.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mamontova, A.
Right arrow Articles by Tedgui, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mamontova, A.
Right arrow Articles by Tedgui, A.