(Circulation. 1998;98:2738-2743.)
© 1998 American Heart Association, Inc.
Basic Science Reports |
From INSERM U141 and IFR "Circulation Lariboisière," Paris (A.M., B.E., A.T.); Rhône-Poulenc Rorer, Gencell Division, Atherosclerosis Department, Centre de recherches de Vitry-Alfortville, Vitry sur Seine (S.S.-M., N.D.); Institut Gustave Roussy, Villejuif (C.C.); INSERM U325, Département d'Athérosclérose, Institut Pasteur, Lille (M.B., G.L., B.S.); and Laboratoire de Neurobiologie du Développement, Institut des Neurosciences, CNRS URA1488 and Université P. et M. Curie, Paris (N.D.-B., J.M.), France.
Correspondence to Alain Tedgui, INSERM U141, 41 Blvd de la Chapelle, 75475 Paris Cedex 10, France.
| Abstract |
|---|
|
|
|---|
Methods and ResultsWe show that the homozygous staggerer
(sg/sg) mutant mouse, which carries a
deletion within the nuclear receptor ROR
gene, develops severe
atherosclerosis when maintained on an atherogenic diet.
In addition, sg/sg mice display a
profound hypoalphalipoproteinemia, which is associated with decreased
plasma levels of the major HDL proteins, apolipoprotein (apo) A-I and
apoA-II. This decrease in HDL levels in
sg/sg mice is due to lowered apoA-I gene
expression in the intestine but not in the liver. ApoA-II gene
expression is unaffected.
ConclusionsThese results suggest that the ROR
gene
contributes to the plasma HDL level and susceptibility to
atherosclerosis.
Key Words: hypercholesterolemia genes cholesterol apolipoproteins
| Introduction |
|---|
|
|
|---|
The homozygous staggerer (sg/sg) mutant mouse
shows cerebellar ataxia and
neurodegeneration8 9 10 and exhibits immune
abnormalities,11 including
hyperproduction of inflammatory cytokines compared with
wild-type C57BL/6 +/+ mice.12
Sg/sg mice carry a deletion in the gene of ROR
(also called RZR
),13 a member of the nuclear
receptor superfamily related to the retinoic acid receptor (retinoic
acid receptorrelated orphan receptor).14 15 16
ROR
belongs to the subclass of orphan nuclear receptors that bind as
monomers to response elements consisting of a 6-bp AT-rich sequence
preceding the half-core PuGGTCA motif.17 The
deletion in the ROR
gene observed in sg/sg
mice prevents the translation of the putative ligand-binding domain,
thereby presumably disrupting the normal function of this transcription
factor.13 Because nuclear hormone receptors
affect the transcription of apolipoproteins, enzymes, and receptors
implicated in lipid metabolism,18 19
we investigated whether deletion of ROR
in
sg/sg mice predisposes to
atherosclerosis. This investigation is facilitated
because the staggerer mutation is maintained on a C57BL/6 genetic
background, which allows analysis of development of
atherosclerotic lesions after exposure to an atherogenic
diet.20 We determined the plasma lipoprotein and
apolipoprotein profiles in sg/sg mice and
measured the extent of fatty streaks in the aorta and the incidence of
atherosclerosis in coronary arteries in
sg/sg mice maintained on a high-fat atherogenic
diet and compared them with those in C57BL/6 +/+ mice. Our results show
that sg/sg mice develop enhanced
atherosclerosis, which is associated with a marked
hypoalphalipoproteinemia due to a decreased expression of apoA-I, the
major HDL protein, in the intestine.
| Methods |
|---|
|
|
|---|
Morphometric Analysis
After 9 weeks on the atherogenic diet, the mice were killed by
ether overdose, and the basal half of the ventricles and the ascending
aorta were removed, embedded in OCT compound (Tissue Tek), frozen in
isopentane at -80°C, and stored at -70°C. Serial 10-µm sections
of the aortic sinus with valves (50 to 70 per mouse) were cut on a
cryostat. Ten successive sections were collected on the same slide.
Sections were stained with Sudan IV, counterstained with hematoxylin,
and examined by light microscopy. A photomicrograph of the section with
the largest plaque was taken from each slide containing 10 sections,
which yielded 5 to 7 photomicrographs per mouse. All lesions were taken
into consideration regardless of their location. Lesion area was
calculated by use of computer planimetry after slide scanning on a
Nikon scanner. The mean lesion area per section per animal was then
calculated. Our method of aortic lesion quantification offers the
advantage of allowing quick examination of all sections cut from the
aortic sinus. This permitted us to discard the sections that could be
unsuitable for analysis for any technical reasons, including
uneven sectioning or poor staining. On the other hand, we have
estimated that the lesion areas of the 10 serial sections kept on the
same slide usually did not differ by >10%. Furthermore, our sampling
method for calculation of the mean lesion area per section per animal
gives results similar to those obtained by other methods.
The incidence of atherosclerotic plaques in coronary arteries
was assessed after examination of the sections collected from the lower
portion of the heart. The main coronary arteries and major
branches, which were usually around the root of the aorta (near the
ostium), were considered to be large arteries and their intramyocardial
ramifications small arteries. Each mouse showing lipid accumulation in
1 large or small coronary artery was noted as positive for
atherosclerosis.
Protein and Lipoprotein Analysis
Cholesterol was measured with a commercially
available kit (Boehringer-Mannheim). Cholesterol in
plasma lipoproteins was assayed after analytical gel filtration
chromatography, with a Superose 6 HR 10/30 column
(Pharmacia). Plasma levels of apoA-I and apoA-II were determined by
immunonephelometric assay.
RNA Analysis
Total RNA was isolated from homogenized liver and
intestine by the acid guanidinium thiocyanatephenol-chloroform
method21 and was further purified by an
additional precipitation with 1 vol 8 mol/L LiCl. ApoA-I, apoA-II, and
GAPDH mRNA contents were quantified by dot-blot hybridization using 8
serial dilutions (2-fold) of RNA starting from an amount of 8 µg/dot.
For RNA hybridization, a mouse apoA-I cDNA probe was
used.22 A mouse apoA-II cDNA fragment was cloned
from mouse liver mRNA by reverse transcriptionpolymerase chain
reaction amplification (sense primer, CTGCAGCACAGAATCGCAGCACTGTTCCTA;
antisense primer, GAAGTTTAACTCCTTCCGCATTTATTGGAG). GAPDH cDNA was used
as a control probe. All probes were labeled by random priming
(Rediprime kit, Amersham). Northern blot analysis was performed
to ensure that a single hybridizing mRNA species was detected. mRNA
levels were measured after dot-blot hybridization. Filters were
hybridized to 106 cpm/mL of each probe, then
washed in 0.5xSSC and 0.1% SDS for 10 minutes at room temperature and
twice for 30 minutes at 65°C. Filters were analyzed by
quantitative electronic densitometry (InstantImager, Packard). All
dot-blot experiments were performed twice.
In Vivo Measurement of ApoA-I Fractional Catabolic and
Production Rates
Murine (C57BL/6) apoA-I was obtained by fast protein liquid
chromatographic separation of total HDL protein isolated by
ultracentrifugation. The purity of apoA-I was >95% by
SDS-PAGE. ApoA-I was labeled with [125I]iodine
by the iodine monochloride method of McFarlane as modified by Bilheimer
et al.23 The specific activity of
125I-labeled apoA-I was 100 cpm/ng. Twenty
micrograms of mouse labeled apoA-I was injected into mice via the tail
vein. The injected apoA-I mass was <5% of the mouse total apoA-I
pool. Whole blood (50 µL) was obtained 3, 10, and 90 minutes and 7
and 24 hours after the injection by retro-orbital bleeding under slight
ether anesthesia for radioactivity measurements. The
fractional catabolic rates (FCRs) were calculated from the area under
the plasma decay curves of radioactivity by a 2-exponential computer
curve-fitting technique using simulation, analysis, and modeling
software (SAAM II, SAAM Institute, Inc). The production
rates (PRs) were calculated as apoA-I concentrationxFCRx3.3%, the
apoA-I plasma concentration being measured as described above and 3.3%
being the plasma volume. Experiments were carried out in 4 +/+ and 4
sg/sg mice.
Statistical Analysis
Atherosclerotic lesion areas were not normally distributed and
were logarithmically transformed before statistical analysis.
The genotype and sex effects on lesion area and the lipoprotein
and apolipoprotein data were determined by 2-way ANOVA.
Analysis of atherosclerosis incidence in
coronary arteries was done with the
2
test. An unpaired t test was used to compare FCR and PR
values in sg/sg and +/+ mice. Data are expressed
as mean±SEM. A value of P<0.05 was accepted as
statistically significant.
| Results |
|---|
|
|
|---|
Lipoproteins and Apolipoproteins
For animals maintained on the chow diet, plasma total and HDL
cholesterol levels were significantly lower in
sg/sg than in +/+ mice (Table 1
and Figure 1
). In fact, the HDL
cholesterol levels were unusually low in male and female
sg/sg mice (2.2- and 4.9-fold reduction,
respectively) versus +/+ mice, which had levels comparable to those of
most inbred strains of mice.24 Plasma apoA-I and
apoA-II concentrations were
2-fold lower in mutant than in control
mice fed a normal diet (Table 1
). After 9 weeks on an atherogenic diet,
total plasma cholesterol levels were markedly increased in
both sg/sg and +/+ mice (Table 1
). However, total
cholesterol levels were significantly lower in
sg/sg than in +/+ mice regardless of the sex
(Table 1
). This was because of lower HDL cholesterol levels
in sg/sg than in +/+ mice. VLDL and LDL
cholesterol levels showed no sex- or
genotype-dependent differences. Interestingly, the levels of
HDL cholesterol were substantially lower in females than in
males regardless of the genotype, as previously reported in the
C57BL/6 strain.25
|
|
Atherosclerotic Lesions in sg/sg
Mice
Mice on a normal diet had no detectable atherosclerotic lesions.
After 9 weeks on the atherogenic diet, lipid accumulation was found in
the aortic sinus in both +/+ and sg/sg mice
(Figure 2
). However, even after such a
short period on the atherogenic diet, sg/sg mice
developed exaggerated atherosclerotic lesions in the aorta compared
with +/+ mice (Figure 3
). The lesion
areas were 6-fold higher in female (37 755±11 176
µm2 versus 6944±1634
µm2) and 7.5-fold higher in male
(21 431±9652 µm2 versus 2850±603
µm2) sg/sg than in +/+
mice. As previously reported in the C57BL/6
strain,26 females were more susceptible than
males. We looked for correlations between the lesion size and total,
VLDL, LDL, or HDL cholesterol concentrations. When males
and females, or +/+ and sg/sg mice, were
combined, there was no significant relationship between total, VLDL, or
LDL cholesterol and aortic lesion size. In contrast, there
was a highly significant inverse correlation between HDL
cholesterol and lesion area (r=-0.71,
P<0.0001, n=43, Figure 4
).
Analysis of the correlation between HDL cholesterol
and aortic lesion area within each group did not reach statistical
significance because of the small number of points in each of the
groups. However, the correlations were statistically significant when
we analyzed sg/sg and +/+ mice separately
(P<0.01 and P<0.05, respectively), pooling
males and females, or when we analyzed males and females
separately, pooling sg/sg and +/+ mice
(P<0.001 in both cases).
|
|
|
Control +/+ mice maintained on the atherogenic diet for 9 weeks
exhibited few or no atherosclerotic lesions in the coronary
arteries. In contrast, the incidence of atherosclerotic lesions in
large and small coronary arteries was high in
sg/sg mice (Figure 2
, Table 2
).
|
ApoA-I and ApoA-II mRNA Expression in the Liver and the
Intestine
Because ROR
is a transcription factor with positive
transactivation activity, the lowered HDL concentrations in the mutant
mice might be due to a defective expression of the apoA-I or apoA-II
genes. Therefore, apoA-I and apoA-II gene expression was determined in
the liver and the intestine, the major apolipoprotein-producing organs
(Figure 5
). Whereas liver apoA-I mRNA
levels were comparable between sg/sg and +/+
mice, a pronounced decrease in apoA-I mRNA levels was observed in the
intestine of mutant mice. Liver apoA-II mRNA levels remained unchanged,
whereas the apoA-II gene is not expressed in the intestine. These data
suggest that decreased expression of the apoA-I gene in the intestine
may be the basis of the hypoalphalipoproteinemia observed in
sg/sg mice. However, it does not indicate whether
the apoA-I gene is a direct target for ROR
or whether the observed
changes are secondary to other (metabolic) effects of
ROR
in these mice.
|
ApoA-I Turnover Rates
To further investigate the mechanism behind lowered HDL levels in
sg/sg mice, we determined apoA-I turnover rates
in vivo. FCRs were not significantly different in
sg/sg and +/+ mice (0.123±0.008 pool/h versus
0.133±0.011 pool/h), but PRs were found to be significantly lower in
sg/sg than in +/+ mice (68.8±2.0 versus
93.5±4.1 mg · kg-1 ·
d-1, P<0.005), indicating that low
plasma apoA-I concentrations in sg/sg mice were
not due to higher catabolic rates.
| Discussion |
|---|
|
|
|---|
Our results reveal a specific reduction of apoA-I gene expression in
the intestine of sg/sg mice and decreased plasma
apoA-I levels. The study of apoA-I turnover rates in vivo showed that
decreased plasma apoA-I concentrations in sg/sg
mice were due not to elevated catabolic rates in these animals but
rather to reduced production rates, more likely related to
their decreased mRNA expression in the intestine. We therefore believe
that the decreased basal apoA-I expression in
sg/sg mice is associated with the absence of
ROR
expression, contributing to the decreased plasma apoA-I levels
and ensuing hypoalphalipoproteinemia in these mutant mice. To further
support this conclusion, we have shown that ROR
is expressed in the
intestine of +/+ mice, and we have identified an ROR
-responsive
element in the apoA-I gene promoter, which suggests a direct regulation
of apoA-I gene expression by ROR
.33
Unexpectedly, deficiency of ROR
expression affects intestinal but
not liver apoA-I expression. The absence of a single transcription
factor results in a >50% decrease in apoA-I expression in the
intestine. To the best of our knowledge, this is the first
demonstration of a nuclear receptor regulating intestinal apoA-I gene
expression in vivo. Indeed, previous in vitro studies have shown that
apoA-I gene expression in the liver but not the intestine is under the
control of various activators/ligands of nuclear receptors,
such as glucocorticoid and thyroid hormones, estrogens, retinoids, and
the hypolipidemic fibrate drugs, which are potent PPAR
activators.34 35 36 However, ROR
expression does not appear to be required for normal apoA-I expression
in the liver under physiological conditions.
We have previously reported that the inflammatory response is enhanced
in sg/sg mice,12 and it has
also been shown that an atherogenic diet increases the expression of
inflammatory and oxidative stress mediators, such as macrophage
colonystimulating factor, in the circulation, and JE (mouse
equivalent of monocyte chemotactic protein-1), serum amyloid A,
and heme oxygenase genes in the
liver.37 Furthermore, there is a striking
correlation between inflammatory gene induction and susceptibility to
fatty streak development in several inbred mouse
strains.38 Interestingly, ROR
might play a
major role in chronic inflammation.39 A
ROR
-responsive element has been identified in the promoter of the
5-lipoxygenase gene, which may mediate the negative
regulation of this important inflammatory
gene.40 41 42 In this context, it cannot be ruled
out that the enhanced atherosclerotic susceptibility of
sg/sg mice is related both to low HDL plasma
levels and to exaggerated inflammatory response to the high-fat,
high-cholesterol diet. Therefore, our data indicate that
HDL could overcome the effects of other atherogenic factors, including
inflammation, and provide further evidence for the protective activity
of apoA-I against atherosclerosis of different
pathogenesis.
In conclusion, we have shown that disruption of the ROR
gene in
mutant sg/sg mice leads to lowered expression of
the apoA-I gene only in the intestine. This is the first demonstration
of a nuclear receptor that contributes to apoA-I gene expression in
vivo and whose deficiency results in hypoalphalipoproteinemia and a
higher susceptibility for atherosclerosis. These
results indicate that targeting intestinal apoA-I expression, possibly
via ROR
, might be of potential interest in the treatment of
atherosclerosis.
| Acknowledgments |
|---|
Received March 19, 1998; revision received August 5, 1998; accepted August 12, 1998.
| References |
|---|
|
|
|---|
2.
Dammerman M, Breslow JL. Genetic basis of lipoprotein
disorders. Circulation. 1995;91:505512.
3. Gordon T, Castelli WP, Hjortland MC, Kannel WB. High density lipoprotein as a protective factor against coronary heart disease: the Framingham Study. Am J Med. 1977;62:707714.[Medline] [Order article via Infotrieve]
4.
Gordon DJ, Probstfield JL, Garrison RJ, Neaton JD,
Castelli WP, Knoke JD, Jacobs DR Jr, Bangdiwala S, Tyroler A.
High-density lipoprotein cholesterol and
cardiovascular disease: four prospective American
studies. Circulation. 1989;79:815.
5.
Reichl D, Miller NE. Pathophysiology of reverse
cholesterol transport: insights from inherited disorders of
lipoprotein metabolism.
Arteriosclerosis. 1989;9:785797.
6. Breslow JL. Familial disorders of high density lipoprotein metabolism. In: Scriver CR, Beaudet AL, Spy WS, Valle D, ed. The Metabolic Basis of Inherited Disease. 6th ed. New York, NY: McGraw-Hill; 1989;1:12511266.
7. Schaefer EJ, McNamara JR, Genest J Jr, Ordovas JM. Genetics and abnormalities in metabolism of lipoproteins. In: Miller NE, ed. High Density Lipoproteins and Atherosclerosis. New York, NY: Elsevier Science Publishing Co Inc; 1989;7986.
8. Sidman RL, Lane PV, Dickie MM. Staggerer, a new mutation in the mouse affecting the cerebellum. Science. 1962;136:610612.
9. Herrup K, Mullen RJ. Regional variation and absence of large neurons in the cerebellum of the staggerer mouse. Brain Res. 1979;172:112.[Medline] [Order article via Infotrieve]
10. Shojaeian-Zanjani H, Herrup K, Guastavino JM, Delhaye-Bouchaud N, Mariani J. Developmental studies of the inferior olivary nucleus in staggerer mutant mice. Dev Brain Res. 1994;82:1828.[Medline] [Order article via Infotrieve]
11. Trenkner E, Hoffmann MK. Defective development of the thymus and immunological abnormalities in the neurological mouse mutation staggerer. J Neurosci. 1986;6:17331737.[Abstract]
12. Kopmels B, Mariani J, Delhaye-Bouchaud N, Audibert F, Fradelizi D, Wollman EE. Evidence for a hyperexcitability state of staggerer mutant mice macrophages. J Neurochem. 1992;58:192199.[Medline] [Order article via Infotrieve]
13.
Hamilton BA, Frankel WN, Kerrebrock AW, Hawkins TL,
FitzHugh W, Kusumi K, Russell LB, Mueller KL, van Berkel V, Birren BW,
Kruglyak L, Lander ES. Disruption of the nuclear hormone receptor
ROR
in staggerer mice. Nature. 1996;379:736739.[Medline]
[Order article via Infotrieve]
14.
Giguère V, Tini M, Flock G, Ong E, Evans RM,
Otulakowski G. Isoform-specific amino-terminal domains dictate
DNA-binding properties of ROR
, a novel family of orphan hormone
nuclear receptors. Genes Dev. 1994;8:538553.
15. Becker-André M, André E, DeLamarter JF. Identification of nuclear receptor mRNAs by RT-PCR amplification of conserved zinc-finger motif sequences. Biochem Biophys Res Commun. 1993;194:13711379.[Medline] [Order article via Infotrieve]
16.
Carlberg C, van Huijsduijnen R, Staple JK, DeLamarter
JF, Becker-André M. RZRs, a new family of retinoid-related orphan
receptors that function as both monomers and homodimers. Mol
Endocrinol. 1994;8:757770.
17. Mangelsdorf DJ, Evans RM. The RXR heterodimers and orphan receptors. Cell. 1995;83:841850.[Medline] [Order article via Infotrieve]
18. Schoonjans K, Staels B, Auwerx J. Role of the peroxisome proliferator-activated receptor (PPAR) in mediating the effects of fibrates and fatty acids on gene expression. J Lipid Res. 1996;37:907925.[Abstract]
19.
Tzameli I, Zannis VI. Binding specificity and
modulation of the apoA-I promoter activity by homo- and heterodimers of
nuclear receptors. J Biol Chem. 1996;271:84028415.
20.
Paigen B, Ishida BY, Verstuyft J, Winters RB, Albee D.
Atherosclerosis susceptibility differences among
progenitors of recombinant inbred strains of mice.
Arteriosclerosis. 1990;10:316323.
21. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156159.[Medline] [Order article via Infotrieve]
22. Berthou L, Duverger N, Emmanuel F, Langouet S, Auwerx J, Guillouzo A, Fruchart JC, Rubin E, Denefle P, Staels B, Branellec D. Opposite regulation of human versus mouse apolipoprotein A-I by fibrates in human apolipoprotein A-I transgenic mice. J Clin Invest. 1996;97:24082416.[Medline] [Order article via Infotrieve]
23. Bilheimer DW, Eisenberg S, Levy RI. The metabolism of very low density lipoprotein proteins, I: preliminary in vitro and in vivo observations. Biochim Biophys Acta. 1972;260:212221.[Medline] [Order article via Infotrieve]
24. Nishina PM, Wang J, Toyofuku W, Kuypers FA, Ishida BY. Atherosclerosis and plasma and liver lipids in nine inbred strains of mice. Lipids. 1993;28:599605.[Medline] [Order article via Infotrieve]
25. Paigen B, Holmes PA, Mitchell D, Albee D. Comparison of atherosclerosis lesions and HDL-lipid levels in male, female, and testosterone-treated female mice from C57BL/6, BALB/c, and CH3. Atherosclerosis. 1987;64:215221.[Medline] [Order article via Infotrieve]
26.
Paigen B, Mitchel D, Reue K, Morrow A, Lusis AJ,
LeBoeuf RC. Ath-1, a gene determining atherosclerosis
susceptibility and high density lipoprotein level in mice. Proc
Natl Acad Sci U S A. 1987;84:37633767.
27. Rubin EM, Krauss RM, Spangler EA, Verstuyft JG, Clift SM. Inhibition of early atherogenesis in transgenic mice by human apolipoprotein AI. Nature. 1991;353:265267.[Medline] [Order article via Infotrieve]
28. Paszty C, Maeda N, Verstuyft J, Rubin EM. Apolipoprotein Al transgene corrects apolipoprotein E deficiency-induced atherosclerosis in mice. J Clin Invest. 1994;94:899903.
29.
Plump AS, Scott CJ, Breslow JL. Human apolipoprotein
A-I gene expression increases high density lipoprotein and suppresses
atherosclerosis in the apolipoprotein E-deficient
mouse. Proc Natl Acad Sci U S A. 1994;91:96079611.
30.
Duverger ND, Kruth H, Emmanuel F, Caillaud JM,
Viglietta C, Castro G, Tailleux A, Fievet C, Fruchart JM, Houdebine LM,
Denefle P. Inhibition of atherosclerosis development in
cholesterol-fed human apolipoprotein A-I transgenic
rabbits. Circulation. 1996;94:713719.
31.
Li H, Reddick RL, Maeda N. Lack of apoA-I is not
associated with increased susceptibility to
atherosclerosis in mice. Arterioscler
Thromb. 1993;13:18141821.
32.
Takata K, Saku K, Ohta T, Takata M, Bai H, Jimi S, Liu
R, Sato H, Kajiyama G, Arakawa K. A new case of apoA-I deficiency
showing codon 8 nonsense mutation of the apoA-I gene without evidence
of coronary heart disease. Arterioscler Thromb Vasc
Biol. 1995;15:18661874.
33.
Vu-Dac N, Gervois P, Grötzinger T, De Vos P,
Schoonjans K, Fruchart J-C, Auwerx J, Mariani J, Tedgui A, Staels B.
Transcriptional regulation of apolipoprotein A-I gene expression by the
nuclear receptor ROR
. J Biol Chem. 1997;272:2240122404.
34. Staels B, Auwerx J, Chan L, van Tol A, Rosseneu M, Verhoeven G. Influence of development, estrogens and food intake on apolipoprotein A-I, A-II and E mRNA in the rat liver and intestine. J Lipid Res. 1989;30:11371145.[Abstract]
35.
Staels B, Van Tol A, Andreu T, Auwerx J. Fibrates
influence the expression of genes involved in lipoprotein
metabolism in a tissue-selective manner in the rat.
Arterioscler Thromb. 1992;12:286294.
36.
Berthou L, Staels B, Saldicco I, Berthelot I, Casey J,
Fruchart J-C, Denèfle P, Branellec D. Opposite in vitro and in
vivo regulation of hepatic apolipoprotein A-I gene expression by
retinoic acid: absence of effects on apolipoprotein A-II gene
expression. Arterioscler Thromb. 1994;14:16571664.
37.
Liao F, Andalibi A, deBeer FC, Fogelman AM, Lusis
AJ. Genetic control of inflammatory gene induction and
NF-
B-like transcription factor activation in response to
atherogenic diet in mice. J Clin Invest. 1993;91:25722579.
38. Liao F, Andalibi A, Qiao JH, Allayee H, Fogelman AM, Lusis AJ. Genetic evidence for a common pathway mediating oxidative stress, inflammatory gene induction, and aortic fatty streak formation in mice. J Clin Invest. 1994;94:877884.
39.
Missbach M, Jagher B, Sigg I, Nayeri S, Carlberg C,
Wiesenberg I. Thiazolidine diones, specific ligands of the nuclear
receptor retinoid Z receptor/retinoid acid receptor-related orphan
receptor
with potent antiarthritic activity. J Biol
Chem. 1996;271:1351513522.
40.
Becker-André M, Wiesenberg I, Schaeren-Wiemers N,
André E, Missbach M, Saurat J-H, Carlberg C. Pineal gland hormone
melatonin binds and activates an orphan of the nuclear receptor
superfamily. J Biol Chem. 1994;269:2853128534.
41.
Wiesenberg I, Missbach M, Kahlen J-P, Schräder M,
Carlberg C. Transcriptional activation of the nuclear receptor
RZR
by the pineal gland hormone melatonin and identification of
CGP 52608 as a synthetic ligand. Nucleic Acids Res. 1995;23:327333.
42.
Steinhilber D, Brungs M, Werz O, Wiesenberg I,
Danielsson C, Kahlen J-P, Nayeri S, Schräder M, Carlberg C. The
nuclear receptor for melatonin represses 5-lipoxygenase
gene expression in human B lymphocytes. J Biol Chem. 1995;270:70377040.
This article has been cited by other articles:
![]() |
T. Juan, M. M. Veniant, J. Helmering, P. Babij, D. M. Baker, M. A. Damore, M. B. Bass, T. Gyuris, M. Chhoa, C.-M. Li, et al. Identification of three loci affecting HDL-cholesterol levels in a screen for chemically induced recessive mutations in mice J. Lipid Res., March 1, 2009; 50(3): 534 - 545. [Abstract] [Full Text] [PDF] |
||||
![]() |
E.-J. Kim, Y.-G. Yoo, W.-K. Yang, Y.-S. Lim, T.-Y. Na, I.-K. Lee, and M.-O. Lee Transcriptional Activation of HIF-1 by ROR{alpha} and its Role in Hypoxia Signaling Arterioscler Thromb Vasc Biol, October 1, 2008; 28(10): 1796 - 1802. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Lau, R. L. Fitzsimmons, S. Raichur, S.-C. M. Wang, A. Lechtken, and G. E. O. Muscat The Orphan Nuclear Receptor, ROR{alpha}, Regulates Gene Expression That Controls Lipid Metabolism: STAGGERER (SG/SG) MICE ARE RESISTANT TO DIET-INDUCED OBESITY J. Biol. Chem., June 27, 2008; 283(26): 18411 - 18421. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Duez and B. Staels The nuclear receptors Rev-erbs and RORs integrate circadian rhythms and metabolism Diabetes and Vascular Disease Research, June 1, 2008; 5(2): 82 - 88. [Abstract] [PDF] |
||||
![]() |
T. Wada, H. S. Kang, M. Angers, H. Gong, S. Bhatia, S. Khadem, S. Ren, E. Ellis, S. C. Strom, A. M. Jetten, et al. Identification of Oxysterol 7{alpha}-Hydroxylase (Cyp7b1) as a Novel Retinoid-Related Orphan Receptor {alpha} (ROR{alpha}) (NR1F1) Target Gene and a Functional Cross-Talk between ROR{alpha} and Liver X Receptor (NR1H3) Mol. Pharmacol., March 1, 2008; 73(3): 891 - 899. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Raichur, P. Lau, B. Staels, and G. E O Muscat Retinoid-related orphan receptor {gamma} regulates several genes that control metabolism in skeletal muscle cells: links to modulation of reactive oxygen species production J. Mol. Endocrinol., July 1, 2007; 39(1): 29 - 44. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Kiss, N. Kavaslar, K.-i. Okuhira, M. W. Freeman, S. Walter, R. W. Milne, R. McPherson, and Y. L. Marcel Genetic Etiology of Isolated Low HDL Syndrome: Incidence and Heterogeneity of Efflux Defects Arterioscler Thromb Vasc Biol, May 1, 2007; 27(5): 1139 - 1145. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wang, L. Yin, and M. A. Lazar The Orphan Nuclear Receptor Rev-erb{alpha} Regulates Circadian Expression of Plasminogen Activator Inhibitor Type 1 J. Biol. Chem., November 10, 2006; 281(45): 33842 - 33848. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. G. Smith and G. E. O. Muscat Orphan nuclear receptors: therapeutic opportunities in skeletal muscle Am J Physiol Cell Physiol, August 1, 2006; 291(2): C203 - C217. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Chauvet, B. Bois-Joyeux, C. Fontaine, P. Gervois, M.-A. Bernard, B. Staels, and J.-L. Danan The Gene Encoding Fibrinogen-{beta} Is a Target for Retinoic Acid Receptor-Related Orphan Receptor {alpha} Mol. Endocrinol., October 1, 2005; 19(10): 2517 - 2526. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Stapleton, M. Jaradat, D. Dixon, H. S. Kang, S.-C. Kim, G. Liao, M. A. Carey, J. Cristiano, M. P. Moorman, and A. M. Jetten Enhanced susceptibility of staggerer (ROR{alpha}sg/sg) mice to lipopolysaccharide-induced lung inflammation Am J Physiol Lung Cell Mol Physiol, July 1, 2005; 289(1): L144 - L152. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Genoux, H. Dehondt, A. Helleboid-Chapman, C. Duhem, D. W. Hum, G. Martin, L. A. Pennacchio, B. Staels, J. Fruchart-Najib, and J.-C. Fruchart Transcriptional Regulation of Apolipoprotein A5 Gene Expression by the Nuclear Receptor ROR{alpha} Arterioscler Thromb Vasc Biol, June 1, 2005; 25(6): 1186 - 1192. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Migita and J. Morser 15-Deoxy-{Delta}12,14-Prostaglandin J2 (15d-PGJ2) Signals Through Retinoic Acid Receptor-Related Orphan Receptor-{alpha} but Not Peroxisome Proliferator-Activated Receptor-{gamma} in Human Vascular Endothelial Cells: The Effect of 15d-PGJ2 on Tumor Necrosis Factor-{alpha}-Induced Gene Expression Arterioscler Thromb Vasc Biol, April 1, 2005; 25(4): 710 - 716. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Pardee, J. Reinking, and H. Krause Nuclear Hormone Receptors, Metabolism, and Aging: What Goes Around Comes Around Sci. Aging Knowl. Environ., November 24, 2004; 2004(47): re8 - re8. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. S. Ory Nuclear Receptor Signaling in the Control of Cholesterol Homeostasis: Have the Orphans Found a Home? Circ. Res., October 1, 2004; 95(7): 660 - 670. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Dzhagalov, V. Giguere, and Y.-W. He Lymphocyte Development and Function in the Absence of Retinoic Acid-Related Orphan Receptor {alpha} J. Immunol., September 1, 2004; 173(5): 2952 - 2959. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Lau, S. J. Nixon, R. G. Parton, and G. E. O. Muscat ROR{alpha} Regulates the Expression of Genes Involved in Lipid Homeostasis in Skeletal Muscle Cells: CAVEOLIN-3 AND CPT-1 ARE DIRECT TARGETS OF ROR J. Biol. Chem., August 27, 2004; 279(35): 36828 - 36840. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Miki, M. Ikuta, and T. Matsui Hypoxia-induced Activation of the Retinoic Acid Receptor-related Orphan Receptor {alpha}4 Gene by an Interaction between Hypoxia-inducible Factor-1 and Sp1 J. Biol. Chem., April 9, 2004; 279(15): 15025 - 15031. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Boukhtouche, J. Mariani, and A. Tedgui The "CholesteROR" Protective Pathway in the Vascular System Arterioscler Thromb Vasc Biol, April 1, 2004; 24(4): 637 - 643. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Raspe, G. Mautino, C. Duval, C. Fontaine, H. Duez, O. Barbier, D. Monte, J. Fruchart, J.-C. Fruchart, and B. Staels Transcriptional Regulation of Human Rev-erbalpha Gene Expression by the Orphan Nuclear Receptor Retinoic Acid-related Orphan Receptor alpha J. Biol. Chem., December 13, 2002; 277(51): 49275 - 49281. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Raspe, H. Duez, A. Mansen, C. Fontaine, C. Fievet, J.-C. Fruchart, B. Vennstrom, and B. Staels Identification of Rev-erb{alpha} as a physiological repressor of apoC-III gene transcription J. Lipid Res., December 1, 2002; 43(12): 2172 - 2179. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Delerive, W. W. Chin, and C. S. Suen Identification of Reverbalpha as a Novel RORalpha Target Gene J. Biol. Chem., September 13, 2002; 277(38): 35013 - 35018. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. M. Faraci Vascular Biology: Look What We Staggered Into Circ. Res., April 19, 2002; 90(7): 749 - 750. [Full Text] [PDF] |
||||
![]() |
S. Besnard, J. Bakouche, Y. Lemaigre-Dubreuil, J. Mariani, A. Tedgui, and D. Henrion Smooth Muscle Dysfunction in Resistance Arteries of the Staggerer Mouse, a Mutant of the Nuclear Receptor ROR{alpha} Circ. Res., April 19, 2002; 90(7): 820 - 825. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Ueda, S. Kurebayashi, M. Sakaue, M. Backlund, B. Koller, and A. M. Jetten High Incidence of T-Cell Lymphomas in Mice Deficient in the Retinoid-related Orphan Receptor ROR{gamma} Cancer Res., February 1, 2002; 62(3): 901 - 909. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Meyer, M. Kneissel, J. Mariani, and B. Fournier In vitro and in vivo evidence for orphan nuclear receptor RORalpha function in bone metabolism PNAS, July 12, 2000; (2000) 150246097. [Abstract] [Full Text] |
||||
![]() |
C. Mitchell, A. Mignon, J. E. Guidotti, S. Besnard, M. Fabre, N. Duverger, D. Parlier, A. Tedgui, A. Kahn, and H. Gilgenkrantz Therapeutic liver repopulation in a mouse model of hypercholesterolemia Hum. Mol. Genet., July 1, 2000; 9(11): 1597 - 1602. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Mallat, S. Besnard, M. Duriez, V. Deleuze, F. Emmanuel, M. F. Bureau, F. Soubrier, B. Esposito, H. Duez, C. Fievet, et al. Protective Role of Interleukin-10 in Atherosclerosis Circ. Res., October 15, 1999; 85 (8): e17 - e24. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Giguère Orphan Nuclear Receptors: From Gene to Function Endocr. Rev., October 1, 1999; 20(5): 689 - 725. [Abstract] [Full Text] |
||||
![]() |
E. Raspe, H. Duez, P. Gervois, C. Fievet, J.-C. Fruchart, S. Besnard, J. Mariani, A. Tedgui, and B. Staels Transcriptional Regulation of Apolipoprotein C-III Gene Expression by the Orphan Nuclear Receptor RORalpha J. Biol. Chem., January 19, 2001; 276(4): 2865 - 2871. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Meyer, M. Kneissel, J. Mariani, and B. Fournier In vitro and in vivo evidence for orphan nuclear receptor RORalpha function in bone metabolism PNAS, August 1, 2000; 97(16): 9197 - 9202. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Besnard, J.-S. Silvestre, M. Duriez, J. Bakouche, Y. Lemaigre-Dubreuil, J. Mariani, B. I. Levy, and A. Tedgui Increased Ischemia-Induced Angiogenesis in the Staggerer Mouse, a Mutant of the Nuclear Receptor Ror{alpha} Circ. Res., December 7, 2001; 89(12): 1209 - 1215. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Besnard, J. Bakouche, Y. Lemaigre-Dubreuil, J. Mariani, A. Tedgui, and D. Henrion Smooth Muscle Dysfunction in Resistance Arteries of the Staggerer Mouse, a Mutant of the Nuclear Receptor ROR{alpha} Circ. Res., April 19, 2002; 90(7): 820 - 825. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1998 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |