(Circulation. 1999;99:292-298.)
© 1999 American Heart Association, Inc.
Basic Science Reports |
1-Adrenergic-Stimulated Hypertrophy in Cultured Neonatal Rat Cardiac Myocytes
From the Department of Cardiovascular Medicine, Graduate School of Medicine, Kyoto University, Kyoto, Japan; and the Department of Bioscience, National Cardiovascular Research Center, Osaka, Japan (T.S., T. Masaki).
Correspondence to Koji Hasegawa, MD, PhD, Department of Cardiovascular Medicine, Graduate School of Medicine, Kyoto University, 54 Kawara-cho, Shogoin Sakyo-ku, Kyoto, 606-8507 Japan. E-mail koj{at}kuhp.kyoto-u.ac.jp
| Abstract |
|---|
|
|
|---|
1-adrenergicstimulated hypertrophy in
cultured neonatal rat cardiac myocytes. Methods and ResultsPhenylephrine (PE) induced the expression of ET-1 in rat cardiac myocytes and accelerated the conversion of big ET-1 to ET-1. The ECE-1 mRNA levels were markedly increased 3 hours after PE stimulation (3.6-fold compared with saline stimulation, P<0.005). A specific ECE-1 antagonist, FR901533, inhibited the PE-stimulated increase in protein synthesis rate by 45% (P<0.05). As genetic markers for the hypertrophic response, FR901533 inhibited the PE-stimulated transcriptional activities of the 3.5-kb ß-myosin heavy chain promoter by 79% (P<0.01) but did not affect that of the 3.4-kb atrial natriuretic factor (ANF) promoter. In Bio14.6 Syrian cardiomyopathic hamsters, ventricular ET-1 and ANF mRNA levels did not correlate at 2 different stages.
ConclusionsET-1-independent pathways may mediate activation of
the ANF gene program in ventricular myocytes
both in vitro and in vivo. These results also indicate that the
conversion of big ET-1 to ET-1 in rat cardiac myocytes is required for
the development of
1-adrenergic-stimulated
hypertrophy and ß-myosin heavy chain gene
transcription.
Key Words: endothelin cardiac hypertrophy gene expression
| Introduction |
|---|
|
|
|---|
1-adrenergicstimulated
hypertrophy in cultured neonatal cardiac myocytes. | Methods |
|---|
|
|
|---|
Immunocytochemistry
The cells were fixed with 3% formaldehyde in PBS for 15 minutes
at room temperature. Immunocytochemical staining for ET-1 was performed
by use of the indirect immunoperoxidase method, as previously
described.1 As the primary antibody, we used
anti-ET-1 polyclonal antibody (Peptide Institute) at a dilution
of 1:20. The cross-reactivity of this antibody with big ET-1 was <1%.
To examine whether ET-1-expressing cells are derived from myocytes,
double staining was performed by use of an anti-ET-1 antibody as
described above and a monoclonal antibody against muscle-specific
-actin (HHF35) at a dilution of 1:100. Signals of
-actin were
detected by the use of an alkaline phosphatase-conjugated Fab fragment
of the secondary antibody (a dilution of 1:600, Jackson ImmunoResearch
Laboratories) and nitroblue tetrazolium dye as the substrate.
Measurement of ET-1 and Big ET-1 Levels in Culture Media
We measured the immunoreactive ET-1 level in the culture media
with an ELISA (Wako Chemical Co) as previously
described.3 12 This ELISA is a 2-step sandwich
method by use of a monoclonal antibody that recognizes the
N-terminal of ET-1 and a peroxidase-conjugated polyclonal
antibody that recognizes the C-terminal of ET-1. In this
system, the cross-reactivity with ET-3 or big ET-1 is <0.4%.
The immunoreactive big ET-1 level in the culture media was measured by an ELISA (Iwai Chemical Co), according to the manufacturer's instructions as described.3 This ELISA is a 2-step sandwich method by use of a polyclonal antibody that recognizes the C-terminal of big ET-1 and a peroxidase-conjugated polyclonal antibody against ET-1. In this system, the cross-reactivity with ET-1 is <0.1%.
Quantitative Reverse Transcriptase-Polymerase Chain
Reaction
Total RNA was isolated by the acid guanidinium
thiocyanate-phenol-chloroform procedure. A quantitative reverse
transcription-polymerase chain reaction (RT-PCR) was carried out as
described previously.13 The PCR primers were
designed on the basis of published rat cDNA sequences for
ECE-12 14 and
glyceraldehyde 3-phosphate dehydrogenase
(GAPDH)15 as follows; sense for
ECE-1: CGTAGCGATAGTCTTAGCAC, antisense for ECE-1:
GTGCCACACCAAAACTACAG, sense for GAPDH: TTGCCATCAACGACCCCTTC
and antisense for GAPDH: TTGTCATGGATGACCTTGGC. To define the
optimal amplification conditions, a series of pilot studies were
performed by the use of various amounts of RT products from 10 to
550 ng RNA and 20 to 45 cycles of PCR amplification in the presence of
32P-
-dCTP as described
previously.13 A set of the
representative data showing the amplification of
ECE-1 and GAPDH is illustrated in Figure 1
. On the basis of these initial
experiments, the linear portion of the amplification was determined for
both genes. The following conditions were therefore chosen as standard
for the PCR reactions in a volume of 50 µL: RT products from 300
ng RNA for ECE-1 or 150 ng RNA for GAPDH, 2.5 U
TaqAmpli polymerase (Perkin-Elmer Cetus), 35 cycles of amplification
for ECE-1 or 30 cycles for GAPDH, in the presence
of 1x106 cpm of
32P-
-dCTP and 100 ng of each sense and
antisense primers. The amplification was carried out as follows:
denaturation, 45 seconds at 94°C; annealing, 45 seconds at 54°C;
and extension, 90 seconds at 72°C. The PCR products (10 µL per
lane) were electrophoresed on a 6% polyacrylamide gel. The gel
was dried and analyzed with a bioimaging analyzer (BAS
2000, FUJIX).
|
Measurement of Protein Synthesis Rate
The cells were incubated with 5 µCi/mL of
[3H]phenylalanine (120 Ci/mmol) and unlabeled
phenylalanine (0.36 mmol/L) in the serum-free medium and incubated
for 48 hours. The cells were washed twice with PBS, and 10%
trichloroacetic acid was added at 4°C for 60 minutes to precipitate
protein. The precipitate was washed 3 times with 95% ethanol and then
resuspended in 0.15N NaOH. Aliquots were counted by a scintillation
counter.
Plasmid Constructs
The plasmid constructs
p-3542ß-MHCluc10 16 and
p-3412ANFluc16 composed of the most
proximal 3542 bp of the rat ß-MHC or 3412 bp of the rat
ANF gene 5'-flanking region, respectively, were inserted
into the promoterless firefly luciferase reporter plasmid
pXP2. pRSVCAT, containing Rous sarcoma
virus (RSV) long-terminal repeat sequences spliced to
chloramphenicol acetyltransferase (CAT),
has been described previously.10 16
Transfection and Luciferase/CAT Assays
The cells were cotransfected with 4 µg of the luciferase
construct of interest and 1 µg of pRSVCAT with
lipofectamine (GIBCO BRL) according to the manufacturer's
recommendation. After a 2-hour incubation with DNA-lipofectamine
complex, the cells were washed twice with serum-free media and further
incubated for 48 hour in serum-free media. The cells were then washed
twice with ice-cold PBS and lysed with lysis
buffer.10 16 The luciferase and CAT activities
were determined in the same cell lysate as previously
described.10 16
Experimental Animals and Tissue Preparation
Male cardiomyopathic hamsters of the Bio 14.6
strain and control F1B hamsters aged 20 or 35 weeks old were purchased
from Charles River, Japan. After the heart was excised and weighed, the
atria and the right ventricles were trimmed off and the left ventricle
was rinsed in cold physiological saline. For
measurement of cardiac ET-1 levels, the basal half of the left
ventricle was immediately homogenized with a Polytron
homogenizer for 30 seconds in 9 vol of 1 mol/L acetic
acid containing 0.1% Triton-X, boiled for 7 minutes, and
centrifuged at 20 000 g for 30 minutes at 4°C. The
supernatant was stored at -80°C until the measurement of ET-1 levels
by ELISA as described above. For mRNA analysis, total RNA was
isolated from the apical half of the left ventricles by the use of the
acid guanidinium isothiocyanate-phenol-chloroform method, as previously
described.16
RNA Analysis
Northern blotting analysis of aliquots of 10 µg of
total RNA was performed as previously
described.16 mRNA abundance was quantified by
phosphorimaging analysis (Molecular Dynamics). Values of
ANF mRNA were normalized relative to those of
GAPDH mRNA.
Statistical Analysis
Data are presented as mean±SE. Statistical comparisons
were performed by use of unpaired 2-tailed Student's t
tests or ANOVA with the Scheffé test when appropriate;
P<0.05 was considered statistically significant.
| Results |
|---|
|
|
|---|
1-adrenergic agonist phenylephrine
(PE) would induce the expression of ET-1 in cardiac myocytes, cells
were stimulated with saline or 1.0x10-4 mol/L
of PE for 48 hours and then stained with anti-ET-1 antibody. The CPK
levels in the media were very low and did not differ between the media
of the saline- (0.63±0.49 IU/L, n=8) and PE-stimulated cells
(0.88±0.57 IU/L, n=8). As shown in Figure 2
-actin of cardiac muscle cells but
not that of fibroblasts. As shown in Figure 2D
-actin (purple signals). A small population of cells
(<5%) was negative for HHF35 (data not shown).
|
The specific sandwich ELISA revealed that the ET-1 levels were
significantly higher in the media of the PE-stimulated cells than in
that of the saline-stimulated cells (Figure 3A
). In contrast, the big ET-1 levels did
not differ between these 2 states (Figure 3B
). Since the primary
production of big ET-1 may be represented as
(mature ET- 1+big ET-1), we defined the conversion rate (%) as
follows; % conversion rate=(mature ET-1)/(mature ET- 1+big ET-1)x100.
Thus, the percent conversion rate was significantly higher in the
PE-stimulated state (60.6±0.9%) than in the saline-stimulated state
(49.2±3.7%); P<0.05. The primary production of
big ET-1 (mature ET- 1+big ET-1) was also higher in the PE-stimulated
state (30.9±2.9 pmol/L) than in the saline-stimulated state (24.6±3.1
pmol/L), although this difference was not significant.
|
ECE-1 Gene Transcript is Increased After PE Stimulation
We examined whether PE stimulation induced the expression of
ECE-1 gene in these cells. Representative
autoradiograms of the quantitative RT-PCR experiment to
detect the expression of ECE-1 mRNA in the cultured neonatal
cardiac myocytes are shown in Figure 4A
, and the corresponding quantitative data after normalizing to the
constitutive control, GAPDH, are illustrated in Figure 4B
.
As shown, the level of ECE-1 transcript was markedly
increased at 3 hours after PE stimulation (3.6-fold increase of the
mean value compared with saline-stimulated control,
P<0.005), and maintained an elevated level up to 12 hours
in PE-stimulated cardiac myocytes. The increased ECE-1 transcription at
12 hours after PE stimulation was associated with increased ECE-1
activity, since the percent conversion rate was significantly higher in
the PE-stimulated state (63.1±3.8%) than in the saline-stimulated
state (51.8±4.5%) at this time point (P<0.001).
Forty-eight hours after the PE stimulation, the ECE-1 mRNA
levels did not significantly differ between saline- and PE-stimulated
cells. Other stimuli, such as angiotensin II
(10-6 mol/L) and isoproterenol
(10-4 mol/L), did not induce the expression of
ECE-1 gene in cardiac myocytes.
|
The Effect of a Specific ECE-1 Inhibitor on PE-Induced
Hypertrophic Response
FR901533 (Fujisawa Pharmaceutical Co), isolated from
Streptosporangium roseum No. 79089, is a potent and specific
inhibitor of ECE-1.17 FR901533
markedly inhibited the ECE-1 activity, with an
IC50 value of 1.4x10-7
mol/L, although it did not inhibit collagenase and NEP
activities <4.9x10-5 mol/L. Thus, the
inhibitory activity of FR901533 is highly selective for
ECE-1. By contrast, phosphoramidon is not a selective
ECE-1 inhibitor because this agent is about 50 times more
active against NEP than against ECE-1. One hundred mg/mL of this agent
markedly reduced the conversion rate from 55.2±3.6% to 26.2±4.6% in
cultured neonatal cardiac myocytes (P<0.001). Thus, we used
FR901533 to further clarify the role of ECE-1 in PE-induced
hypertrophy in cultured neonatal cardiac myocytes. As shown
in Figure 5
, this concentration of
FR901533 inhibited the PE-stimulated increase in the protein synthesis
rate in the cultured neonatal rat cardiac myocytes by 45%. We also
examined the effect of FR901533 on the transcriptional activities of
the ß-MHC and ANF genes. Both 3.5-kb
ß-MHC and 3.4-kb ANF promoter sequences have
been shown to confer the PE-responsive expression of luciferase gene in
cultured neonatal cardiocytes.18 19
Compatible with these previous findings, PE increased the relative
luciferase activities of p-3542ß-MHCluc and
p-3412ANFluc by 2.0-fold and 4.5-fold, respectively, in the
present study. FR901533 inhibited the PE-stimulated increase of the
3.5 kb ß-MHC promoter activity by 79%
(P<0.01) (Figure 6A
). In
contrast, FR901533 did not affect the PE-stimulated increase of the 3.4
kb ANF promoter activity (Figure 6B
). FR901533 alone did not
affect the protein synthesis rate (Figure 5
) or ANF and
ß-MHC promoter activities (Figure 6
) in the cardiac
myocytes.
|
|
ET-1 Levels and ANF Expression in
Ventricular Myocardium in Syrian
Cardiomyopathic Hamsters at 2 Different Stages
To clarify the relationship between the response to ET-1 and ANF
expression in vivo, we examined ventricular ET-1 and
ANF mRNA levels in Syrian cardiomyopathic
hamsters of the Bio14.6 strain. At the age of 20 weeks (left
ventricular hypertrophy with compensation),
ventricular ANF mRNA levels normalized with
GAPDH mRNA levels were markedly increased (16-fold) compared
with those of age-matched control F1B (Figure 7A
). However, ventricular
ET-1 levels were only mildly elevated (1.7-fold) (Figure 7B
). As shown
in Figure 7A
, the increase of ventricular ANF
mRNA levels at 35 weeks old (failing phase) was marked (15-fold) and
similar to that in 20-week-old animals. In contrast to the
results at 20 weeks, ventricular ET-1 levels were markedly
elevated (5.8-fold) at this stage (Figure 7B
).
|
| Discussion |
|---|
|
|
|---|
1-adrenergic stimulation accelerated the
conversion of big ET-1 to bioactive, mature ET-1 in rat cardiac
myocytes and induced the expression of ECE-1, which mediates
this conversion and (2) a specific ECE-1 antagonist
inhibited
1-adrenergic stimulated increase of
the protein synthesis rate and ß-MHC transcription. We observed that
1-adrenergic stimulation induced the
expression of ET-1 in cardiac myocytes and accelerated the secretion of
ET-1 into the culture media. It has been reported that the left
ventricular content of ET-1 is markedly elevated in an
animal model of heart failure.6 8
Immunohistochemistry demonstrated that ET-1 immunoreactivity in failing
hearts is localized in cardiac myocytes. Although these data do not
rule out a possible role of nonmyocytes for the increased
synthesis of ET-1 in the failing heart, the data demonstrate that
cardiac myocytes are 1 of the main sources of ET-1. Compatible with the
cardiac expression of ET-1, the rat ET-1 promoter contains a
GATA element required for its full transcriptional
activities.20 Our recent
study16 demonstrated a role of GATA transcription
factors in the regulation of cardiac gene expression during pressure
overload hypertrophy in vivo. It is of interest as to
whether the GATA element in the ET-1 promoter plays a role
in the upregulated expression of ET-1 in myocardial cell
hypertrophy. We found that the ECE-1 mRNA levels were markedly increased 3 hours after PE stimulation. Wang et al14 reported that the ECE-1 mRNA levels increased immediately (within 6 hours) after rat carotid artery balloon angioplasty. The augmented expression of the ECE-1 gene may thus be 1 of the earliest responses to hormonal and mechanical stimuli. In agreement with the PE-inducible expression of the ECE-1 gene, PE accelerated the conversion of big ET-1 to ET-1. It has also been shown that the prepro-ET-1 mRNA levels are transiently increased after PE stimulation.6 These findings suggest that the PE-stimulated synthesis of ET-1 is regulated at both pre- and posttranslational levels.
We examined whether the myocardial ET-1 pathway is involved in the
transcriptional activation of ß-MHC and ANF
genes by
1-adrenergic stimulation. The
specific ECE-1 inhibitor FR901533 abolished the
PE-stimulated increase of the transfected 3.5-kb ß-MHC
promoter activities, suggesting that the PE-stimulated
ß-MHC gene transcription requires myocardial ET-1 pathway.
However, FR901533 did not affect the PE-stimulated 3.4-kb
ANF promoter activities. Our data do not rule out the
possibility that the ET-1-dependent pathway is involved in the
activation of ANF gene transcription in the redundant
networks. Nevertheless, the data suggest that the
1-adrenergicstimulated transcription of
ß-MHC and ANF genes are mediated, at least in
part, through differential pathways. cis-acting elements
that mediate the PE-inducible expression include the GAG motif in the
rat ANF promoter19 and the M-CAT
element in the rat ß-MHC promoter.18
To date, no conserved PE-responsive elements in different cardiac genes
have been identified. Thus,
1-adrenergic
stimulation may activate divergent signaling pathways. Further
studies are needed to determine the target cis element of
each pathway in the
1-adrenergic stimulated
transcription of ß-MHC and ANF genes.
The treatment with FR901533 inhibited the PE-stimulated increase in the protein synthesis rate but did not inhibit that of ANF gene expression. These findings suggest that cardiac hypertrophy and ANF expression are mediated, at least in part, through different pathways. In accordance with this idea, Sadoshima et al21 found that a 70-kDa S6 kinase inhibitor, rapamycin, inhibited the angiotensin II-stimulated increase in protein synthesis but did not affect the angiotensin II-induced activation of fetal genes, including those encoding ANF. It would be of particular interest to determine each intracellular signaling pathway that mediates cardiac hypertrophy and its specific gene expression.
In terms of the relationship between ET-1 level and ANF expression, it is interesting that ventricular ET-1 and ANF mRNA levels did not correlate at 2 different stages of Syrian cardiomyopathic hamster. These findings suggest an involvement of ET-1independent pathways for activation of the ANF gene program in vivo. In addition, the elevation of the left ventricular ET-1 levels is only slight at the hypertrophic stage but marked at the failing stage, which suggests that the accelerated production of cardiac ET-1 is involved in the transition from hypertrophy to failure in this animal model.
An application of our data in cultured neonatal cardiac myocytes to the in vivo setting in adults must be undertaken carefully because these 2 situations differ significantly. A previous report17 demonstrated that the intravenous administration of FR901533 at the concentration 1 mg/kg significantly inhibited the big ET-1induced pressor response in rats. Thus, the inhibitory effect of this agent is not confined to in vitro assays, but is also observed in the in vivo context. An ET type A receptor antagonist has been shown to be beneficial in animal models of heart failure.8 However, it was reported that the expression of the ET type A receptor was downregulated in hypertrophied hearts of spontaneously hypertensive rats22 and that ET-1 synthesis increased after the administration of the nonselective ET receptor antagonist bosentan.23 Bird et al24 demonstrated that the ECE-1 inhibitor phosphoramidon provided more pronounced beneficial effects on renal function and structure in ischemic renal failure than did the ET type A receptor antagonist. Thus, a comparison of ECE-1 inhibitors and ET receptor antagonists as therapeutic agents for heart failure in vivo would be of particular interest.
| Acknowledgments |
|---|
Received February 12, 1998; revision received August 21, 1998; accepted September 3, 1998.
| References |
|---|
|
|
|---|
2.
Shimada K, Takahashi M, Tanzawa K. Cloning and
functional expression of endothelin-converting enzyme from rat
endothelial cells. J Biol Chem. 1994;269:1827518278.
3. Ikura T, Sawamura T, Shiraki T, Hosokawa H, Kido T, Hoshikawa H, Shimada K, Tanzawa K, Kobayashi S, Miwa S, Masaki T. cDNA cloning and expression of bovine endothelin converting enzyme. Biochem Biophys Res Commun. 1994;203:14171422.[Medline] [Order article via Infotrieve]
4. Ito H, Hirata Y, Adachi S, Tanaka M, Tsujino M, Koike A, Nogami A, Murumo F, Hiroe M. Endothelin-1 is an autocrine/paracrine factor in the mechanism of angiotensin II-induced hypertrophy in cultured rat cardiomyocytes. J Clin Invest. 1993;92:398403.
5.
Yamazaki T, Komuro I, Kudoh S, Zou Y, Shiojima I,
Hiroi Y, Mizuno T, Maemura K, Kurihara H, Aikawa R, Takano T, Yazaki T.
Endothelin-1 is involved in mechanical stress-induced
cardiomyocyte hypertrophy. J Biol
Chem. 1996;271:32213228.
6.
Kaddoura S, Firth JD, Boheler KR, Sugden PH,
Pool-Wilson PA. Endothelin-1 is involved in
norepinephrine-induced ventricular
hypertrophy in vivo. Circulation. 1996;93:20682079.
7.
Shubeita HE, McDonough PM, Harris AN, Knowlton KU,
Glembotski CC, Brouwn JH, Chien KR. Endothelin induction of inositol
phospholipid hydrolysis, sarcomere assembly, and cardiac gene
expression in ventricular myocytes: a paracrine mechanism
for myocardial cell hypertrophy. J Biol
Chem. 1990;265:2055520562.
8. Sakai S, Miyauchi T, Kobayashi M, Yamaguchi I, Goto K, Sugishita K. Inhibition of myocardial endothelin pathway improves long-term survival in heart failure. Nature. 1996;384:353355.[Medline] [Order article via Infotrieve]
9.
Wei CM, Lerman A, Rodeheffer RJ, McGregor CGA, Brandt
RR, Wright S, Heublein DM, Kao PC, Edwards WD, Burnet JC Jr. Endothelin
in human congestive heart failure. Circulation. 1994;89:15801586.
10.
Hasegawa K, Meyers MB, Kitsis RN. Transcriptional
coactivator p300 stimulates cell type-specific gene
expression in cardiac myocytes. J Biol Chem. 1997;272:2004920054.
11.
Hasegawa K, Fujiwara H, Doyama K, Miyamae M, Fujiwara
T, Suga S, Mukoyama M, Nakao K, Imura H, Sasayama S.
Ventricular expression of brain natriuretic
peptide in hypertrophic cardiomyopathy.
Circulation. 1993;88:372380.
12.
Hasegawa K, Fujiwara H, Koshiji M, Inada T, Ohtani S,
Doyama K, Tanaka M, Matsumori A, Fujiwara T, Shirakami G, Hosoda K,
Nakao K, Sasayama S. Endothelin-1 and its receptor in hypertrophic
cardiomyopathy. Hypertension. 1996;27:259264.
13.
Shioi T, Matsumori A, Sasayama S. Persistent expression
of cytokine in the chronic stage of viral myocarditis in mice.
Circulation. 1996;94:29302937.
14.
Wang X, Douglas SA, Louden C, Vickery-Clark LM,
Feuerstein GZ, Ohlstein EH. Expression of endothelin-1, endothelin-3,
endothelin-converting enzyme-1, and endothelin-A and endothelin-B
receptor mRNA after angioplasty-induced neointimal
formation in the rat. Circ Res. 1996;78:322328.
15.
Tso JY, Sun XH, Kao T, Reece KS, Wu R. Isolation and
characterization of rat and human glyceraldehyde
3-phosphate dehydrogenase cDNAs: genomic complexity and molecular
evolution of the gene. Nucleic Acids Res. 1985;13:24852502.
16. Hasegawa K, Lee SJ, Jobe SM, Markham BE, Kitsis RN. cis-Acting sequences that mediate induction of ß-myosin heavy chain gene expression during left ventricular hypertrophy due to aortic constriction. Circulation. 1997;1997:96:39433953.
17. Tsurumi Y, Fujie K, Nishikawa M, Kiyoto S, Okuhara M. Biological and pharmacological properties of highly selective new endothelin converting enzyme inhibitor WS79089B isolated from Streptosporangium roseum No. 79089. J Antibiot (Tokyo). 1995;48:169174.[Medline] [Order article via Infotrieve]
18.
Kariya K, Karns LR, Simpson PC. An enhancer core
element mediates stimulation of the rat ß-myosin heavy chain
promoter by an
1-adrenergic agonist and activated
ß-protein kinase C in hypertrophy of cardiac myocytes.
J Biol Chem. 1994;269:37753782.
19.
Ardati A, Nemer M. A nuclear pathway for
1-adrenergic receptor signaling in cardiac cells. Embo
J. 1993;12:51315139.[Medline]
[Order article via Infotrieve]
20. Kawana M, Lee ME, Quertermous EE, Quertermous T. Cooperative interaction of GATA-2 and AP1 regulates transcription of the endothelin-1 gene. Mol Cell Biol. 1995;15:42254231.[Abstract]
21.
Sadoshima J, Izumo S. Rapamycin selectively inhibits
angiotensin II-induced increase in protein synthesis in
cardiac myocytes in vitro: potential role of 70-kD S6 kinase in
angiotensin II-induced cardiac hypertrophy.
Circ Res. 1995;77:10401052.
22. Hayzer DJ, Cicilia G, Cockerham C, Griendling KK, Delafontaine P, Ng SC, Runge MS. Endothelin A and B receptors are down-regulated in the hearts of hypertensive rats. Am J Med Sci. 1994;307:222227.[Medline] [Order article via Infotrieve]
23. Kiowski W, Sütsch G, Hunziker P, Müller P, Kim J, Oechslin E, Schmitt R, Jones R, Bertel O. Evidence for endothelin-1-mediated vasoconstriction in severe chronic heart failure. Lancet. 1995;346:732736.[Medline] [Order article via Infotrieve]
24.
Bird JE, Webb ML, Wasserman AJ, Liu ECK, Giancarli MR,
Durham SK. Comparison of a novel ETA receptor antagonist
and phosphoramidon in renal ischemia.
Pharmacology. 1995;50:923.We investigated the role of
endothelin-converting enzyme-1, which mediates the conversion of big
endothelin-1 to mature endothelin-1, in the development of
1-adrenergicstimulated hypertrophy in
cultured neonatal rat cardiac myocytes. The results suggest that
endothelin-1independent pathways mediate the activation of
atrial natriuretic factor gene program in
ventricular myocytes both in vitro and in vivo and that the
conversion of big endothelin-1 to endothelin-1 in rat cardiac myocytes
is required for the development of
1-adrenergicstimulated hypertrophy and
ß-myosin heavy chain gene transcription.[Medline]
[Order article via Infotrieve]
This article has been cited by other articles:
![]() |
T. Takaya, T. Kawamura, T. Morimoto, K. Ono, T. Kita, A. Shimatsu, and K. Hasegawa Identification of p300-targeted Acetylated Residues in GATA4 during Hypertrophic Responses in Cardiac Myocytes J. Biol. Chem., April 11, 2008; 283(15): 9828 - 9835. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Chang, J. Zhang, Y.-H. Tseng, C.-Q. Xie, J. Ilany, J. C. Bruning, Z. Sun, X. Zhu, T. Cui, K. A. Youker, et al. Rad GTPase Deficiency Leads to Cardiac Hypertrophy Circulation, December 18, 2007; 116(25): 2976 - 2983. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Shimojo, S. Jesmin, S. Zaedi, M. Soma, T. Kobayashi, S. Maeda, I. Yamaguchi, K. Goto, and T. Miyauchi Effect of eicosapentaenoic Acid on the different endothelin system components in endothelin-1-induced hypertrophied cardiomyocytes. Experimental Biology and Medicine, June 1, 2006; 231(6): 888 - 892. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Xia and M. Karmazyn Obligatory Role for Endogenous Endothelin in Mediating the Hypertrophic Effects of Phenylephrine and Angiotensin II in Neonatal Rat Ventricular Myocytes: Evidence for Two Distinct Mechanisms for Endothelin Regulation J. Pharmacol. Exp. Ther., July 1, 2004; 310(1): 43 - 51. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yanazume, K. Hasegawa, T. Morimoto, T. Kawamura, H. Wada, A. Matsumori, Y. Kawase, M. Hirai, and T. Kita Cardiac p300 Is Involved in Myocyte Growth with Decompensated Heart Failure Mol. Cell. Biol., May 15, 2003; 23(10): 3593 - 3606. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Araki, K. Hasegawa, E. Iwai-Kanai, M. Fujita, T. Sawamura, T. Kakita, H. Wada, T. Morimoto, and S. Sasayama Endothelin-1 as a protective factor against beta-adrenergic agonist-induced apoptosis in cardiac myocytes J. Am. Coll. Cardiol., October 1, 2000; 36(4): 1411 - 1418. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Fukuzawa, G. W. Booz, R. A. Hunt, N. Shimizu, V. Karoor, K. M. Baker, and D. E. Dostal Cardiotrophin-1 Increases Angiotensinogen mRNA in Rat Cardiac Myocytes Through STAT3 : An Autocrine Loop for Hypertrophy Hypertension, June 1, 2000; 35(6): 1191 - 1196. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Morimoto, K. Hasegawa, S. Kaburagi, T. Kakita, H. Wada, T. Yanazume, and S. Sasayama Phosphorylation of GATA-4 Is Involved in alpha 1-Adrenergic Agonist-responsive Transcription of the Endothelin-1 Gene in Cardiac Myocytes J. Biol. Chem., April 28, 2000; 275(18): 13721 - 13726. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. P. Rossi and A. C Pessina Endothelin-1 in angiotensin II-dependent hypertension: Answer to the Letter to the Editor Cardiovasc Res, November 1, 1999; 44(2): 450 - 451. [Full Text] [PDF] |
||||
![]() |
E. L. Schiffrin Role of Endothelin-1 in Hypertension Hypertension, October 1, 1999; 34(4): 876 - 881. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Morimoto, K. Hasegawa, H. Wada, T. Kakita, S. Kaburagi, T. Yanazume, and S. Sasayama Calcineurin-GATA4 Pathway Is Involved in beta -Adrenergic Agonist-responsive Endothelin-1 Transcription in Cardiac Myocytes J. Biol. Chem., September 7, 2001; 276(37): 34983 - 34989. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Moser, J. Faulhaber, R. J. Wiesner, and H. Ehmke Predominant activation of endothelin-dependent cardiac hypertrophy by norepinephrine in rat left ventricle Am J Physiol Regulatory Integrative Comp Physiol, May 1, 2002; 282(5): R1389 - R1394. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1999 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |