Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 1999;99:292-298

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kaburagi, S.
Right arrow Articles by Sasayama, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kaburagi, S.
Right arrow Articles by Sasayama, S.
Related Collections
Right arrow Gene expression
Right arrow Heart failure - basic studies
Right arrow Endothelium/vascular type/nitric oxide

(Circulation. 1999;99:292-298.)
© 1999 American Heart Association, Inc.


Basic Science Reports

The Role of Endothelin-Converting Enzyme-1 in the Development of {alpha}1-Adrenergic-Stimulated Hypertrophy in Cultured Neonatal Rat Cardiac Myocytes

Satoshi Kaburagi, MD; Koji Hasegawa, MD, PhD; Tatsuya Morimoto, MD; Makoto Araki, MD; Tatsuya Sawamura, MD, PhD; Tomoh Masaki, MD, PhD; Shigetake Sasayama, MD, PhD

From the Department of Cardiovascular Medicine, Graduate School of Medicine, Kyoto University, Kyoto, Japan; and the Department of Bioscience, National Cardiovascular Research Center, Osaka, Japan (T.S., T. Masaki).

Correspondence to Koji Hasegawa, MD, PhD, Department of Cardiovascular Medicine, Graduate School of Medicine, Kyoto University, 54 Kawara-cho, Shogoin Sakyo-ku, Kyoto, 606-8507 Japan. E-mail koj{at}kuhp.kyoto-u.ac.jp


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background—Accumulating evidence suggests that the local synthesis of endothelin-1 (ET-1) plays a role in the development of heart failure in vivo. We investigated the role of endothelin-converting enzyme-1 (ECE-1), which mediates the conversion of big ET-1 to mature ET-1, in the development of {alpha}1-adrenergic–stimulated hypertrophy in cultured neonatal rat cardiac myocytes.

Methods and Results—Phenylephrine (PE) induced the expression of ET-1 in rat cardiac myocytes and accelerated the conversion of big ET-1 to ET-1. The ECE-1 mRNA levels were markedly increased 3 hours after PE stimulation (3.6-fold compared with saline stimulation, P<0.005). A specific ECE-1 antagonist, FR901533, inhibited the PE-stimulated increase in protein synthesis rate by 45% (P<0.05). As genetic markers for the hypertrophic response, FR901533 inhibited the PE-stimulated transcriptional activities of the 3.5-kb ß-myosin heavy chain promoter by 79% (P<0.01) but did not affect that of the 3.4-kb atrial natriuretic factor (ANF) promoter. In Bio14.6 Syrian cardiomyopathic hamsters, ventricular ET-1 and ANF mRNA levels did not correlate at 2 different stages.

Conclusions—ET-1-independent pathways may mediate activation of the ANF gene program in ventricular myocytes both in vitro and in vivo. These results also indicate that the conversion of big ET-1 to ET-1 in rat cardiac myocytes is required for the development of {alpha}1-adrenergic-stimulated hypertrophy and ß-myosin heavy chain gene transcription.


Key Words: endothelin • cardiac hypertrophy • gene expression


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Endothelin-1 (ET-1), a potent vasoconstrictor peptide, is synthesized from intermediate big ET-1 by endothelin-converting enzyme-1 (ECE-1).1 2 3 Although ET-1 is mainly produced by endothelial cells at the basal state, a number of cell types can synthesize ET-1 in response to various kinds of stimuli.4 5 6 ET-1 expression in cardiac myocytes is induced by the stimulation of myocardial stretch and by angiotensin II and catecholamine. In addition, ET-1 acts not only as a vasoconstrictor but also as a potent growth-promoting peptide. ET-1 is sufficient to induce the myocardial cell hypertrophy associated with the reactivation of the fetal gene program such as the induction of atrial natriuretic factor (ANF) and ß-myosin heavy chain (MHC) expression.7 The following observations suggest that ET-1 is involved in the development of cardiac hypertrophy and failure as a local factor in vivo. The elevation of left ventricular ET-1 in failing hearts8 is more marked than that of circulating ET-1.9 Immunohistochemistry demonstrated that ET-1 in the failing heart is localized in cardiac myocytes.8 In addition, the administration of an ET type-A receptor antagonist, BQ123, blocks the development of heart failure after myocardial infarction.8 However, it is unclear whether this blockade is mediated by the local antagonism of ET-1 action in cardiac myocytes or by a reduction of systemic arterial resistance. Since big ET-1 has little biological action by itself, ECE-1 may play a critical role in the cardiac biosynthesis of ET-1. Thus, the present study investigated the role of ECE-1 in the development of {alpha}1-adrenergic–stimulated hypertrophy in cultured neonatal cardiac myocytes.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Cell Culture
Primary ventricular cardiac myocytes were prepared from 1- to 2-day-old Sprague-Dawley rats (Japan SLC, Inc, Shizuoka, Japan) as previously described.10 Twenty-four hours after they were plated, cells were washed twice with serum-free media and then stimulated with saline or 1.0x10-4 mol/L of phenylephrine (PE) in serum-free media for 48 hours.

Immunocytochemistry
The cells were fixed with 3% formaldehyde in PBS for 15 minutes at room temperature. Immunocytochemical staining for ET-1 was performed by use of the indirect immunoperoxidase method, as previously described.1 As the primary antibody, we used anti-ET-1 polyclonal antibody (Peptide Institute) at a dilution of 1:20. The cross-reactivity of this antibody with big ET-1 was <1%. To examine whether ET-1-expressing cells are derived from myocytes, double staining was performed by use of an anti-ET-1 antibody as described above and a monoclonal antibody against muscle-specific {alpha}-actin (HHF35) at a dilution of 1:100. Signals of {alpha}-actin were detected by the use of an alkaline phosphatase-conjugated Fab fragment of the secondary antibody (a dilution of 1:600, Jackson ImmunoResearch Laboratories) and nitroblue tetrazolium dye as the substrate.

Measurement of ET-1 and Big ET-1 Levels in Culture Media
We measured the immunoreactive ET-1 level in the culture media with an ELISA (Wako Chemical Co) as previously described.3 12 This ELISA is a 2-step sandwich method by use of a monoclonal antibody that recognizes the N-terminal of ET-1 and a peroxidase-conjugated polyclonal antibody that recognizes the C-terminal of ET-1. In this system, the cross-reactivity with ET-3 or big ET-1 is <0.4%.

The immunoreactive big ET-1 level in the culture media was measured by an ELISA (Iwai Chemical Co), according to the manufacturer's instructions as described.3 This ELISA is a 2-step sandwich method by use of a polyclonal antibody that recognizes the C-terminal of big ET-1 and a peroxidase-conjugated polyclonal antibody against ET-1. In this system, the cross-reactivity with ET-1 is <0.1%.

Quantitative Reverse Transcriptase-Polymerase Chain Reaction
Total RNA was isolated by the acid guanidinium thiocyanate-phenol-chloroform procedure. A quantitative reverse transcription-polymerase chain reaction (RT-PCR) was carried out as described previously.13 The PCR primers were designed on the basis of published rat cDNA sequences for ECE-12 14 and glyceraldehyde 3-phosphate dehydrogenase (GAPDH)15 as follows; sense for ECE-1: CGTAGCGATAGTCTTAGCAC, antisense for ECE-1: GTGCCACACCAAAACTACAG, sense for GAPDH: TTGCCATCAACGACCCCTTC and antisense for GAPDH: TTGTCATGGATGACCTTGGC. To define the optimal amplification conditions, a series of pilot studies were performed by the use of various amounts of RT products from 10 to 550 ng RNA and 20 to 45 cycles of PCR amplification in the presence of 32P-{alpha}-dCTP as described previously.13 A set of the representative data showing the amplification of ECE-1 and GAPDH is illustrated in Figure 1Down. On the basis of these initial experiments, the linear portion of the amplification was determined for both genes. The following conditions were therefore chosen as standard for the PCR reactions in a volume of 50 µL: RT products from 300 ng RNA for ECE-1 or 150 ng RNA for GAPDH, 2.5 U TaqAmpli polymerase (Perkin-Elmer Cetus), 35 cycles of amplification for ECE-1 or 30 cycles for GAPDH, in the presence of 1x106 cpm of 32P-{alpha}-dCTP and 100 ng of each sense and antisense primers. The amplification was carried out as follows: denaturation, 45 seconds at 94°C; annealing, 45 seconds at 54°C; and extension, 90 seconds at 72°C. The PCR products (10 µL per lane) were electrophoresed on a 6% polyacrylamide gel. The gel was dried and analyzed with a bioimaging analyzer (BAS 2000, FUJIX).



View larger version (24K):
[in this window]
[in a new window]
 
Figure 1. Quantification of amplified ECE-1 and GAPDH mRNAs in cultured neonatal rat cardiac myocytes. RT-PCR was carried out by use of the standard conditions as described in Materials and Methods, except that different amounts of RT products were used (A and B) or different cycles were applied for the amplification (C and D). The relative intensity is illustrated as a percentage of the signal over the sum of each condition.

Measurement of Protein Synthesis Rate
The cells were incubated with 5 µCi/mL of [3H]phenylalanine (120 Ci/mmol) and unlabeled phenylalanine (0.36 mmol/L) in the serum-free medium and incubated for 48 hours. The cells were washed twice with PBS, and 10% trichloroacetic acid was added at 4°C for 60 minutes to precipitate protein. The precipitate was washed 3 times with 95% ethanol and then resuspended in 0.15N NaOH. Aliquots were counted by a scintillation counter.

Plasmid Constructs
The plasmid constructs p-3542ß-MHCluc10 16 and p-3412ANFluc16 composed of the most proximal 3542 bp of the rat ß-MHC or 3412 bp of the rat ANF gene 5'-flanking region, respectively, were inserted into the promoterless firefly luciferase reporter plasmid pXP2. pRSVCAT, containing Rous sarcoma virus (RSV) long-terminal repeat sequences spliced to chloramphenicol acetyltransferase (CAT), has been described previously.10 16

Transfection and Luciferase/CAT Assays
The cells were cotransfected with 4 µg of the luciferase construct of interest and 1 µg of pRSVCAT with lipofectamine (GIBCO BRL) according to the manufacturer's recommendation. After a 2-hour incubation with DNA-lipofectamine complex, the cells were washed twice with serum-free media and further incubated for 48 hour in serum-free media. The cells were then washed twice with ice-cold PBS and lysed with lysis buffer.10 16 The luciferase and CAT activities were determined in the same cell lysate as previously described.10 16

Experimental Animals and Tissue Preparation
Male cardiomyopathic hamsters of the Bio 14.6 strain and control F1B hamsters aged 20 or 35 weeks old were purchased from Charles River, Japan. After the heart was excised and weighed, the atria and the right ventricles were trimmed off and the left ventricle was rinsed in cold physiological saline. For measurement of cardiac ET-1 levels, the basal half of the left ventricle was immediately homogenized with a Polytron homogenizer for 30 seconds in 9 vol of 1 mol/L acetic acid containing 0.1% Triton-X, boiled for 7 minutes, and centrifuged at 20 000 g for 30 minutes at 4°C. The supernatant was stored at -80°C until the measurement of ET-1 levels by ELISA as described above. For mRNA analysis, total RNA was isolated from the apical half of the left ventricles by the use of the acid guanidinium isothiocyanate-phenol-chloroform method, as previously described.16

RNA Analysis
Northern blotting analysis of aliquots of 10 µg of total RNA was performed as previously described.16 mRNA abundance was quantified by phosphorimaging analysis (Molecular Dynamics). Values of ANF mRNA were normalized relative to those of GAPDH mRNA.

Statistical Analysis
Data are presented as mean±SE. Statistical comparisons were performed by use of unpaired 2-tailed Student's t tests or ANOVA with the Scheffé test when appropriate; P<0.05 was considered statistically significant.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Phenylephrine Accelerates the Conversion of Big ET-1 to Mature ET-1
To determine whether stimulation by an {alpha}1-adrenergic agonist phenylephrine (PE) would induce the expression of ET-1 in cardiac myocytes, cells were stimulated with saline or 1.0x10-4 mol/L of PE for 48 hours and then stained with anti-ET-1 antibody. The CPK levels in the media were very low and did not differ between the media of the saline- (0.63±0.49 IU/L, n=8) and PE-stimulated cells (0.88±0.57 IU/L, n=8). As shown in Figure 2Down, brown positive signals were observed in almost all of the PE-stimulated cells but in none of the saline-stimulated cells. The specificity of the staining was confirmed by its abolition by the addition of an excess of synthetic ET-1 (Figure 2CDown). To check whether the ET-1-producing cells are derived from cardiac myocytes, we performed double staining by use of an anti-ET-1 antibody and HHF35, which recognizes the {alpha}-actin of cardiac muscle cells but not that of fibroblasts. As shown in Figure 2DDown, most of the PE-stimulated cells (>95%) were positive for both ET-1 (brown signals) and {alpha}-actin (purple signals). A small population of cells (<5%) was negative for HHF35 (data not shown).



View larger version (54K):
[in this window]
[in a new window]
 
Figure 2. Immunocytochemical staining of cultured rat ventricular myocytes labeled with antibody to ET-1. The primary antibody to ET-1 was stained with the secondary antibody conjugated with peroxidase (brown signals). A, Control cardiomyocytes exposed to saline. B and C, Cardiomyocytes exposed to PE (1.0x10-4 mol/L) for 48 hours. The addition of an excess of synthetic ET-1 abolished the signals (C). Double-staining (D) for ET-1 (brown signals) and for cardiac {alpha}-actin stained with the secondary antibody conjugated with alkaline phosphatase (purple signals). In E, an anti-ET-1 antibody was substituted with normal rabbit serum in double staining.

The specific sandwich ELISA revealed that the ET-1 levels were significantly higher in the media of the PE-stimulated cells than in that of the saline-stimulated cells (Figure 3ADown). In contrast, the big ET-1 levels did not differ between these 2 states (Figure 3BDown). Since the primary production of big ET-1 may be represented as (mature ET- 1+big ET-1), we defined the conversion rate (%) as follows; % conversion rate=(mature ET-1)/(mature ET- 1+big ET-1)x100. Thus, the percent conversion rate was significantly higher in the PE-stimulated state (60.6±0.9%) than in the saline-stimulated state (49.2±3.7%); P<0.05. The primary production of big ET-1 (mature ET- 1+big ET-1) was also higher in the PE-stimulated state (30.9±2.9 pmol/L) than in the saline-stimulated state (24.6±3.1 pmol/L), although this difference was not significant.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 3. The effect of PE on the secretions of ET-1 (A) and big ET-1 (B) by cultured ventricular cardiomyocytes. Neonatal ventricular cardiac myocytes were stimulated with saline or PE (1.0x10-4 mol/L). Immunoreactive ET-1 and big ET-1 in culture media were determined 48 hours later by a sandwich ELISA as described in Materials and Methods. Data are mean±SEM and show the combined results from 4 independent preparations.

ECE-1 Gene Transcript is Increased After PE Stimulation
We examined whether PE stimulation induced the expression of ECE-1 gene in these cells. Representative autoradiograms of the quantitative RT-PCR experiment to detect the expression of ECE-1 mRNA in the cultured neonatal cardiac myocytes are shown in Figure 4ADown, and the corresponding quantitative data after normalizing to the constitutive control, GAPDH, are illustrated in Figure 4BDown. As shown, the level of ECE-1 transcript was markedly increased at 3 hours after PE stimulation (3.6-fold increase of the mean value compared with saline-stimulated control, P<0.005), and maintained an elevated level up to 12 hours in PE-stimulated cardiac myocytes. The increased ECE-1 transcription at 12 hours after PE stimulation was associated with increased ECE-1 activity, since the percent conversion rate was significantly higher in the PE-stimulated state (63.1±3.8%) than in the saline-stimulated state (51.8±4.5%) at this time point (P<0.001). Forty-eight hours after the PE stimulation, the ECE-1 mRNA levels did not significantly differ between saline- and PE-stimulated cells. Other stimuli, such as angiotensin II (10-6 mol/L) and isoproterenol (10-4 mol/L), did not induce the expression of ECE-1 gene in cardiac myocytes.



View larger version (39K):
[in this window]
[in a new window]
 
Figure 4. The effect of PE on the expression of ECE-1 mRNA by cultured ventricular cardiomyocytes. Cardiomyocytes were challenged with saline, PE (1.0x10-4 mol/L), angiotensin II (AII, 1.0x10-6 mol/L), or isoproterenol (Iso, 1.0x10-6 mol/L) for various times up to 48 hours. A, Representative autoradiograms after an RT-PCR for ECE-1 and GAPDH mRNAs. B, Time course of the relative levels of ECE-1 mRNA expression in myocytes. Data are expressed as mean rations of ECE-1 mRNA to GAPDH mRNA. Bars indicate SEM. n=4 separate cell preparations for each group. *P<0.005.

The Effect of a Specific ECE-1 Inhibitor on PE-Induced Hypertrophic Response
FR901533 (Fujisawa Pharmaceutical Co), isolated from Streptosporangium roseum No. 79089, is a potent and specific inhibitor of ECE-1.17 FR901533 markedly inhibited the ECE-1 activity, with an IC50 value of 1.4x10-7 mol/L, although it did not inhibit collagenase and NEP activities <4.9x10-5 mol/L. Thus, the inhibitory activity of FR901533 is highly selective for ECE-1. By contrast, phosphoramidon is not a selective ECE-1 inhibitor because this agent is about 50 times more active against NEP than against ECE-1. One hundred mg/mL of this agent markedly reduced the conversion rate from 55.2±3.6% to 26.2±4.6% in cultured neonatal cardiac myocytes (P<0.001). Thus, we used FR901533 to further clarify the role of ECE-1 in PE-induced hypertrophy in cultured neonatal cardiac myocytes. As shown in Figure 5Down, this concentration of FR901533 inhibited the PE-stimulated increase in the protein synthesis rate in the cultured neonatal rat cardiac myocytes by 45%. We also examined the effect of FR901533 on the transcriptional activities of the ß-MHC and ANF genes. Both 3.5-kb ß-MHC and 3.4-kb ANF promoter sequences have been shown to confer the PE-responsive expression of luciferase gene in cultured neonatal cardiocytes.18 19 Compatible with these previous findings, PE increased the relative luciferase activities of p-3542ß-MHCluc and p-3412ANFluc by 2.0-fold and 4.5-fold, respectively, in the present study. FR901533 inhibited the PE-stimulated increase of the 3.5 kb ß-MHC promoter activity by 79% (P<0.01) (Figure 6ADown). In contrast, FR901533 did not affect the PE-stimulated increase of the 3.4 kb ANF promoter activity (Figure 6BDown). FR901533 alone did not affect the protein synthesis rate (Figure 5Down) or ANF and ß-MHC promoter activities (Figure 6Down) in the cardiac myocytes.



View larger version (44K):
[in this window]
[in a new window]
 
Figure 5. FR901533 (FR), a specific ECE-1 inhibitor, blocked the development of PE-stimulated hypertrophy in cultured neonatal cardiac myocytes. Neonatal rat ventricular cardiac myocytes were stimulated with saline or PE (1.0x10-4 mol/L) and incubated with [3H]phenylalanine for 48 hours. [3H]phenylalanine incorporation over 48 hours is expressed as percentage of the value obtained from saline-stimulated cells. Data are mean±SEM of 3 independent preparations of cells, each performed in duplicate.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 6. FR901533 (FR) differentially affected the PE-stimulated transcription of ß-MHC (A) and ANF (B) genes in cardiac myocytes. Neonatal ventricular cardiac myocytes were co-transfected with 4 mg of ß-myosin heavy chain (MHC) or ANF luciferase reporters and 1 µg pRSVCAT, and then stimulated with saline or PE (1.0x10-4 mol/L). The activities of luciferase and CAT were determined 48 hours later. Relative luciferase activity (mean±SEM) represents the luciferase activity corrected for CAT activity and is expressed as a percentage relative to that in saline-stimulated cardiocytes. Data are mean±SEM of 3 independent preparations of cells, each performed in duplicate.

ET-1 Levels and ANF Expression in Ventricular Myocardium in Syrian Cardiomyopathic Hamsters at 2 Different Stages
To clarify the relationship between the response to ET-1 and ANF expression in vivo, we examined ventricular ET-1 and ANF mRNA levels in Syrian cardiomyopathic hamsters of the Bio14.6 strain. At the age of 20 weeks (left ventricular hypertrophy with compensation), ventricular ANF mRNA levels normalized with GAPDH mRNA levels were markedly increased (16-fold) compared with those of age-matched control F1B (Figure 7ADown). However, ventricular ET-1 levels were only mildly elevated (1.7-fold) (Figure 7BDown). As shown in Figure 7ADown, the increase of ventricular ANF mRNA levels at 35 weeks old (failing phase) was marked (15-fold) and similar to that in 20-week-old animals. In contrast to the results at 20 weeks, ventricular ET-1 levels were markedly elevated (5.8-fold) at this stage (Figure 7BDown).



View larger version (24K):
[in this window]
[in a new window]
 
Figure 7. ANF expression (A) and ET-1 levels (B) in left ventricles of Bio14.6 cardiomyopathic and control F1B hamsters. A, Representative Northern blot showing steady-state levels of ANF mRNA and GAPDH mRNA in left ventricles of Bio14.6 cardiomyopathic and control F1B hamsters. B, ET-1 levels were measured by a sandwich ELISA as described in Methods. Values are mean±SEM. n=4 per group.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
The major findings of this study include (1) {alpha}1-adrenergic stimulation accelerated the conversion of big ET-1 to bioactive, mature ET-1 in rat cardiac myocytes and induced the expression of ECE-1, which mediates this conversion and (2) a specific ECE-1 antagonist inhibited {alpha}1-adrenergic stimulated increase of the protein synthesis rate and ß-MHC transcription. We observed that {alpha}1-adrenergic stimulation induced the expression of ET-1 in cardiac myocytes and accelerated the secretion of ET-1 into the culture media. It has been reported that the left ventricular content of ET-1 is markedly elevated in an animal model of heart failure.6 8 Immunohistochemistry demonstrated that ET-1 immunoreactivity in failing hearts is localized in cardiac myocytes. Although these data do not rule out a possible role of nonmyocytes for the increased synthesis of ET-1 in the failing heart, the data demonstrate that cardiac myocytes are 1 of the main sources of ET-1. Compatible with the cardiac expression of ET-1, the rat ET-1 promoter contains a GATA element required for its full transcriptional activities.20 Our recent study16 demonstrated a role of GATA transcription factors in the regulation of cardiac gene expression during pressure overload hypertrophy in vivo. It is of interest as to whether the GATA element in the ET-1 promoter plays a role in the upregulated expression of ET-1 in myocardial cell hypertrophy.

We found that the ECE-1 mRNA levels were markedly increased 3 hours after PE stimulation. Wang et al14 reported that the ECE-1 mRNA levels increased immediately (within 6 hours) after rat carotid artery balloon angioplasty. The augmented expression of the ECE-1 gene may thus be 1 of the earliest responses to hormonal and mechanical stimuli. In agreement with the PE-inducible expression of the ECE-1 gene, PE accelerated the conversion of big ET-1 to ET-1. It has also been shown that the prepro-ET-1 mRNA levels are transiently increased after PE stimulation.6 These findings suggest that the PE-stimulated synthesis of ET-1 is regulated at both pre- and posttranslational levels.

We examined whether the myocardial ET-1 pathway is involved in the transcriptional activation of ß-MHC and ANF genes by {alpha}1-adrenergic stimulation. The specific ECE-1 inhibitor FR901533 abolished the PE-stimulated increase of the transfected 3.5-kb ß-MHC promoter activities, suggesting that the PE-stimulated ß-MHC gene transcription requires myocardial ET-1 pathway. However, FR901533 did not affect the PE-stimulated 3.4-kb ANF promoter activities. Our data do not rule out the possibility that the ET-1-dependent pathway is involved in the activation of ANF gene transcription in the redundant networks. Nevertheless, the data suggest that the {alpha}1-adrenergic–stimulated transcription of ß-MHC and ANF genes are mediated, at least in part, through differential pathways. cis-acting elements that mediate the PE-inducible expression include the GAG motif in the rat ANF promoter19 and the M-CAT element in the rat ß-MHC promoter.18 To date, no conserved PE-responsive elements in different cardiac genes have been identified. Thus, {alpha}1-adrenergic stimulation may activate divergent signaling pathways. Further studies are needed to determine the target cis element of each pathway in the {alpha}1-adrenergic stimulated transcription of ß-MHC and ANF genes.

The treatment with FR901533 inhibited the PE-stimulated increase in the protein synthesis rate but did not inhibit that of ANF gene expression. These findings suggest that cardiac hypertrophy and ANF expression are mediated, at least in part, through different pathways. In accordance with this idea, Sadoshima et al21 found that a 70-kDa S6 kinase inhibitor, rapamycin, inhibited the angiotensin II-stimulated increase in protein synthesis but did not affect the angiotensin II-induced activation of fetal genes, including those encoding ANF. It would be of particular interest to determine each intracellular signaling pathway that mediates cardiac hypertrophy and its specific gene expression.

In terms of the relationship between ET-1 level and ANF expression, it is interesting that ventricular ET-1 and ANF mRNA levels did not correlate at 2 different stages of Syrian cardiomyopathic hamster. These findings suggest an involvement of ET-1–independent pathways for activation of the ANF gene program in vivo. In addition, the elevation of the left ventricular ET-1 levels is only slight at the hypertrophic stage but marked at the failing stage, which suggests that the accelerated production of cardiac ET-1 is involved in the transition from hypertrophy to failure in this animal model.

An application of our data in cultured neonatal cardiac myocytes to the in vivo setting in adults must be undertaken carefully because these 2 situations differ significantly. A previous report17 demonstrated that the intravenous administration of FR901533 at the concentration 1 mg/kg significantly inhibited the big ET-1–induced pressor response in rats. Thus, the inhibitory effect of this agent is not confined to in vitro assays, but is also observed in the in vivo context. An ET type A receptor antagonist has been shown to be beneficial in animal models of heart failure.8 However, it was reported that the expression of the ET type A receptor was downregulated in hypertrophied hearts of spontaneously hypertensive rats22 and that ET-1 synthesis increased after the administration of the nonselective ET receptor antagonist bosentan.23 Bird et al24 demonstrated that the ECE-1 inhibitor phosphoramidon provided more pronounced beneficial effects on renal function and structure in ischemic renal failure than did the ET type A receptor antagonist. Thus, a comparison of ECE-1 inhibitors and ET receptor antagonists as therapeutic agents for heart failure in vivo would be of particular interest.


*    Acknowledgments
 
This work was supported in part by grants from the Kanae Foundation of Research for New Medicine, the Japanese Heart Foundation, the Japan Cardiovascular Research Foundation, and the Ministry of Education, Science and Culture of Japan (Dr Hasegawa).

Received February 12, 1998; revision received August 21, 1998; accepted September 3, 1998.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 

  1. Yanagisawa M, Kurihara H, Kimura S, Tomobe Y, Kobayashi M, Mitsui Y, Yazaki Y, Goto K, Masaki T. A novel potent vasoconstrictor peptide produced by vascular endothelial cells. Nature. 1988;332:411–415.[Medline] [Order article via Infotrieve]
  2. Shimada K, Takahashi M, Tanzawa K. Cloning and functional expression of endothelin-converting enzyme from rat endothelial cells. J Biol Chem. 1994;269:18275–18278.[Abstract/Free Full Text]
  3. Ikura T, Sawamura T, Shiraki T, Hosokawa H, Kido T, Hoshikawa H, Shimada K, Tanzawa K, Kobayashi S, Miwa S, Masaki T. cDNA cloning and expression of bovine endothelin converting enzyme. Biochem Biophys Res Commun. 1994;203:1417–1422.[Medline] [Order article via Infotrieve]
  4. Ito H, Hirata Y, Adachi S, Tanaka M, Tsujino M, Koike A, Nogami A, Murumo F, Hiroe M. Endothelin-1 is an autocrine/paracrine factor in the mechanism of angiotensin II-induced hypertrophy in cultured rat cardiomyocytes. J Clin Invest. 1993;92:398–403.
  5. Yamazaki T, Komuro I, Kudoh S, Zou Y, Shiojima I, Hiroi Y, Mizuno T, Maemura K, Kurihara H, Aikawa R, Takano T, Yazaki T. Endothelin-1 is involved in mechanical stress-induced cardiomyocyte hypertrophy. J Biol Chem. 1996;271:3221–3228.[Abstract/Free Full Text]
  6. Kaddoura S, Firth JD, Boheler KR, Sugden PH, Pool-Wilson PA. Endothelin-1 is involved in norepinephrine-induced ventricular hypertrophy in vivo. Circulation. 1996;93:2068–2079.[Abstract/Free Full Text]
  7. Shubeita HE, McDonough PM, Harris AN, Knowlton KU, Glembotski CC, Brouwn JH, Chien KR. Endothelin induction of inositol phospholipid hydrolysis, sarcomere assembly, and cardiac gene expression in ventricular myocytes: a paracrine mechanism for myocardial cell hypertrophy. J Biol Chem. 1990;265:20555–20562.[Abstract/Free Full Text]
  8. Sakai S, Miyauchi T, Kobayashi M, Yamaguchi I, Goto K, Sugishita K. Inhibition of myocardial endothelin pathway improves long-term survival in heart failure. Nature. 1996;384:353–355.[Medline] [Order article via Infotrieve]
  9. Wei CM, Lerman A, Rodeheffer RJ, McGregor CGA, Brandt RR, Wright S, Heublein DM, Kao PC, Edwards WD, Burnet JC Jr. Endothelin in human congestive heart failure. Circulation. 1994;89:1580–1586.[Abstract/Free Full Text]
  10. Hasegawa K, Meyers MB, Kitsis RN. Transcriptional coactivator p300 stimulates cell type-specific gene expression in cardiac myocytes. J Biol Chem. 1997;272:20049–20054.[Abstract/Free Full Text]
  11. Hasegawa K, Fujiwara H, Doyama K, Miyamae M, Fujiwara T, Suga S, Mukoyama M, Nakao K, Imura H, Sasayama S. Ventricular expression of brain natriuretic peptide in hypertrophic cardiomyopathy. Circulation. 1993;88:372–380.[Abstract/Free Full Text]
  12. Hasegawa K, Fujiwara H, Koshiji M, Inada T, Ohtani S, Doyama K, Tanaka M, Matsumori A, Fujiwara T, Shirakami G, Hosoda K, Nakao K, Sasayama S. Endothelin-1 and its receptor in hypertrophic cardiomyopathy. Hypertension. 1996;27:259–264.[Abstract/Free Full Text]
  13. Shioi T, Matsumori A, Sasayama S. Persistent expression of cytokine in the chronic stage of viral myocarditis in mice. Circulation. 1996;94:2930–2937.[Abstract/Free Full Text]
  14. Wang X, Douglas SA, Louden C, Vickery-Clark LM, Feuerstein GZ, Ohlstein EH. Expression of endothelin-1, endothelin-3, endothelin-converting enzyme-1, and endothelin-A and endothelin-B receptor mRNA after angioplasty-induced neointimal formation in the rat. Circ Res. 1996;78:322–328.[Abstract/Free Full Text]
  15. Tso JY, Sun XH, Kao T, Reece KS, Wu R. Isolation and characterization of rat and human glyceraldehyde 3-phosphate dehydrogenase cDNAs: genomic complexity and molecular evolution of the gene. Nucleic Acids Res. 1985;13:2485–2502.[Abstract/Free Full Text]
  16. Hasegawa K, Lee SJ, Jobe SM, Markham BE, Kitsis RN. cis-Acting sequences that mediate induction of ß-myosin heavy chain gene expression during left ventricular hypertrophy due to aortic constriction. Circulation. 1997;1997:96:3943–3953.
  17. Tsurumi Y, Fujie K, Nishikawa M, Kiyoto S, Okuhara M. Biological and pharmacological properties of highly selective new endothelin converting enzyme inhibitor WS79089B isolated from Streptosporangium roseum No. 79089. J Antibiot (Tokyo). 1995;48:169–174.[Medline] [Order article via Infotrieve]
  18. Kariya K, Karns LR, Simpson PC. An enhancer core element mediates stimulation of the rat ß-myosin heavy chain promoter by an {alpha}1-adrenergic agonist and activated ß-protein kinase C in hypertrophy of cardiac myocytes. J Biol Chem. 1994;269:3775–3782.[Abstract/Free Full Text]
  19. Ardati A, Nemer M. A nuclear pathway for {alpha}1-adrenergic receptor signaling in cardiac cells. Embo J. 1993;12:5131–5139.[Medline] [Order article via Infotrieve]
  20. Kawana M, Lee ME, Quertermous EE, Quertermous T. Cooperative interaction of GATA-2 and AP1 regulates transcription of the endothelin-1 gene. Mol Cell Biol. 1995;15:4225–4231.[Abstract]
  21. Sadoshima J, Izumo S. Rapamycin selectively inhibits angiotensin II-induced increase in protein synthesis in cardiac myocytes in vitro: potential role of 70-kD S6 kinase in angiotensin II-induced cardiac hypertrophy. Circ Res. 1995;77:1040–1052.[Abstract/Free Full Text]
  22. Hayzer DJ, Cicilia G, Cockerham C, Griendling KK, Delafontaine P, Ng SC, Runge MS. Endothelin A and B receptors are down-regulated in the hearts of hypertensive rats. Am J Med Sci. 1994;307:222–227.[Medline] [Order article via Infotrieve]
  23. Kiowski W, Sütsch G, Hunziker P, Müller P, Kim J, Oechslin E, Schmitt R, Jones R, Bertel O. Evidence for endothelin-1-mediated vasoconstriction in severe chronic heart failure. Lancet. 1995;346:732–736.[Medline] [Order article via Infotrieve]
  24. Bird JE, Webb ML, Wasserman AJ, Liu ECK, Giancarli MR, Durham SK. Comparison of a novel ETA receptor antagonist and phosphoramidon in renal ischemia. Pharmacology. 1995;50:9–23.We investigated the role of endothelin-converting enzyme-1, which mediates the conversion of big endothelin-1 to mature endothelin-1, in the development of {alpha}1-adrenergic–stimulated hypertrophy in cultured neonatal rat cardiac myocytes. The results suggest that endothelin-1–independent pathways mediate the activation of atrial natriuretic factor gene program in ventricular myocytes both in vitro and in vivo and that the conversion of big endothelin-1 to endothelin-1 in rat cardiac myocytes is required for the development of {alpha}1-adrenergic–stimulated hypertrophy and ß-myosin heavy chain gene transcription.[Medline] [Order article via Infotrieve]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
T. Takaya, T. Kawamura, T. Morimoto, K. Ono, T. Kita, A. Shimatsu, and K. Hasegawa
Identification of p300-targeted Acetylated Residues in GATA4 during Hypertrophic Responses in Cardiac Myocytes
J. Biol. Chem., April 11, 2008; 283(15): 9828 - 9835.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
L. Chang, J. Zhang, Y.-H. Tseng, C.-Q. Xie, J. Ilany, J. C. Bruning, Z. Sun, X. Zhu, T. Cui, K. A. Youker, et al.
Rad GTPase Deficiency Leads to Cardiac Hypertrophy
Circulation, December 18, 2007; 116(25): 2976 - 2983.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
N. Shimojo, S. Jesmin, S. Zaedi, M. Soma, T. Kobayashi, S. Maeda, I. Yamaguchi, K. Goto, and T. Miyauchi
Effect of eicosapentaenoic Acid on the different endothelin system components in endothelin-1-induced hypertrophied cardiomyocytes.
Experimental Biology and Medicine, June 1, 2006; 231(6): 888 - 892.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
Y. Xia and M. Karmazyn
Obligatory Role for Endogenous Endothelin in Mediating the Hypertrophic Effects of Phenylephrine and Angiotensin II in Neonatal Rat Ventricular Myocytes: Evidence for Two Distinct Mechanisms for Endothelin Regulation
J. Pharmacol. Exp. Ther., July 1, 2004; 310(1): 43 - 51.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
T. Yanazume, K. Hasegawa, T. Morimoto, T. Kawamura, H. Wada, A. Matsumori, Y. Kawase, M. Hirai, and T. Kita
Cardiac p300 Is Involved in Myocyte Growth with Decompensated Heart Failure
Mol. Cell. Biol., May 15, 2003; 23(10): 3593 - 3606.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
M. Araki, K. Hasegawa, E. Iwai-Kanai, M. Fujita, T. Sawamura, T. Kakita, H. Wada, T. Morimoto, and S. Sasayama
Endothelin-1 as a protective factor against beta-adrenergic agonist-induced apoptosis in cardiac myocytes
J. Am. Coll. Cardiol., October 1, 2000; 36(4): 1411 - 1418.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
J. Fukuzawa, G. W. Booz, R. A. Hunt, N. Shimizu, V. Karoor, K. M. Baker, and D. E. Dostal
Cardiotrophin-1 Increases Angiotensinogen mRNA in Rat Cardiac Myocytes Through STAT3 : An Autocrine Loop for Hypertrophy
Hypertension, June 1, 2000; 35(6): 1191 - 1196.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Morimoto, K. Hasegawa, S. Kaburagi, T. Kakita, H. Wada, T. Yanazume, and S. Sasayama
Phosphorylation of GATA-4 Is Involved in alpha 1-Adrenergic Agonist-responsive Transcription of the Endothelin-1 Gene in Cardiac Myocytes
J. Biol. Chem., April 28, 2000; 275(18): 13721 - 13726.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
G. P. Rossi and A. C Pessina
Endothelin-1 in angiotensin II-dependent hypertension: Answer to the Letter to the Editor
Cardiovasc Res, November 1, 1999; 44(2): 450 - 451.
[Full Text] [PDF]


Home page
HypertensionHome page
E. L. Schiffrin
Role of Endothelin-1 in Hypertension
Hypertension, October 1, 1999; 34(4): 876 - 881.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Morimoto, K. Hasegawa, H. Wada, T. Kakita, S. Kaburagi, T. Yanazume, and S. Sasayama
Calcineurin-GATA4 Pathway Is Involved in beta -Adrenergic Agonist-responsive Endothelin-1 Transcription in Cardiac Myocytes
J. Biol. Chem., September 7, 2001; 276(37): 34983 - 34989.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
L. Moser, J. Faulhaber, R. J. Wiesner, and H. Ehmke
Predominant activation of endothelin-dependent cardiac hypertrophy by norepinephrine in rat left ventricle
Am J Physiol Regulatory Integrative Comp Physiol, May 1, 2002; 282(5): R1389 - R1394.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kaburagi, S.
Right arrow Articles by Sasayama, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kaburagi, S.
Right arrow Articles by Sasayama, S.
Related Collections
Right arrow Gene expression
Right arrow Heart failure - basic studies
Right arrow Endothelium/vascular type/nitric oxide